bioroebe 0.10.80

data/lib/bioroebe/utility_scripts/showorf/show.rb

@@ -0,0 +1,97 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+module Bioroebe
+
+class ShowOrf < ::Bioroebe::CommandlineApplication
+
+  # ========================================================================= #
+  # === orange_f1
+  # ========================================================================= #
+  def orange_f1
+    orange('  F1  ')+rev
+  end; alias f1 orange_f1 # === f1
+
+  # ========================================================================= #
+  # === orange_f2
+  # ========================================================================= #
+  def orange_f2
+    orange('  F2  ')+rev
+  end; alias f2 orange_f2 # === f2
+
+  # ========================================================================= #
+  # === orange_f3
+  # ========================================================================= #
+  def orange_f3
+    orange('  F3  ')+rev
+  end; alias f3 orange_f3 # === f3
+
+  # ========================================================================= #
+  # === r1
+  # ========================================================================= #
+  def r1
+    orangered('  R1  ')+rev
+  end
+
+  # ========================================================================= #
+  # === r2
+  # ========================================================================= #
+  def r2
+    orangered('  R2  ')+rev
+  end
+
+  # ========================================================================= #
+  # === r3
+  # ========================================================================= #
+  def r3
+    orangered('  R3  ')+rev
+  end
+
+  # ========================================================================= #
+  # === show_this_frame
+  # ========================================================================= #
+  def show_this_frame(
+      i           = frame_1,
+      which_frame = :frame1
+    )
+    _ = max_allowed_size_per_line
+    n_aminoacids = i.delete(' ').chars.size.to_s
+    right_padding = '  '.dup
+    case which_frame
+    when :frame1
+      which_frame = orange_f1
+      right_padding << '  '
+    when :frame2
+      which_frame = orange_f2
+      right_padding << ' '
+    when :frame3
+      which_frame = orange_f3
+    end
+    leading_part = which_frame+(' ' * 3)+'  '+i
+    # ======================================================================= #
+    # === Colourize stop codons in the colour red
+    # ======================================================================= #
+    if colourize_stop_codons_in_red? and use_colours?
+      leading_part.gsub!(/(\*)/, swarn('\\1')+rev)
+    end
+    leading_part << right_padding
+    # ======================================================================= #
+    # We may have to modify the variable n_aminoacids if there is a stop
+    # codon.
+    # ======================================================================= #
+    if i.include? '*'
+      n_aminoacids = i[(i.rindex('*')+1) .. i.size].delete(' ').size.to_s.
+                     rjust(i.size.to_s.size)
+    end
+    # ======================================================================= #
+    # Next also append how many aminoacids are part of this squence:
+    # ======================================================================= #
+    string = leading_part+
+             darkolivegreen(
+               n_aminoacids.to_s+' aminoacids'
+             )+rev
+    e string
+  end
+
+end; end

data/lib/bioroebe/utility_scripts/showorf/showorf.rb

@@ -0,0 +1,488 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# === Bioroebe::ShowOrf
+#
+# This class is capable of showing the 3 different forward frames, frame1,
+# frame2 and frame3 ORFs. It is loosely based on EMBOSS showorf.
+#
+# It can also show the 3 reverse frames, R1, R2 and R3.
+# =========================================================================== #
+# require 'bioroebe/utility_scripts/showorf/showorf.rb'
+# =========================================================================== #
+require 'bioroebe/base/commandline_application/commandline_application.rb'
+require 'bioroebe/utility_scripts/showorf/constants.rb'
+require 'bioroebe/utility_scripts/showorf/help.rb'
+require 'bioroebe/utility_scripts/showorf/initialize.rb'
+require 'bioroebe/utility_scripts/showorf/menu.rb'
+require 'bioroebe/utility_scripts/showorf/reset.rb'
+require 'bioroebe/utility_scripts/showorf/show.rb'
+require 'bioroebe/utility_scripts/showorf/run.rb'
+
+module Bioroebe
+
+class ShowOrf < ::Bioroebe::CommandlineApplication # === Bioroebe::ShowOrf
+
+  require 'bioroebe/codons/codons.rb'
+  require 'bioroebe/toplevel_methods/complement.rb'
+
+  # ========================================================================= #
+  # === set_show_these_frames
+  # ========================================================================= #
+  def set_show_these_frames(i)
+    case i # case tag
+    # ======================================================================= #
+    # === frame1
+    # ======================================================================= #
+    when :frame1,
+         :f1
+      @show_these_frames = [:frame1]
+    # ======================================================================= #
+    # === frame2
+    # ======================================================================= #
+    when :frame2,
+         :f2
+      @show_these_frames = [:frame2]
+    # ======================================================================= #
+    # === frame3
+    # ======================================================================= #
+    when :frame3,
+         :f3
+      @show_these_frames = [:frame3]
+    # ======================================================================= #
+    # === frame1_frame
+    # ======================================================================= #
+    when :frame1_frame2,
+         :f1_and_f2
+      @show_these_frames = [:frame1, :frame2]
+    # ======================================================================= #
+    # === f1_and_f2_and_f3
+    # ======================================================================= #
+    when :f1_and_f2_and_f3
+      @show_these_frames = [:frame1, :frame2, :frame3]
+    # ======================================================================= #
+    # === all_frames                                                (all tag)
+    #
+    # Use this when you wish to show all 6 reading frames.
+    # ======================================================================= #
+    when :all_frames,
+         :show_three_frames,
+         :frame1_frame2_frame3,
+         :frame1_frame2_frame2_reverse1_reverse2_reverse3
+      @show_these_frames = [
+        :frame1,
+        :frame2,
+        :frame3,
+        :reverse_frame1,
+        :reverse_frame2,
+        :reverse_frame3
+      ]
+    end
+  end
+
+  # ========================================================================= #
+  # === show_frame_1?
+  # ========================================================================= #
+  def show_frame_1?
+    @show_these_frames.include? :frame1
+  end
+
+  # ========================================================================= #
+  # === show_frame_2?
+  # ========================================================================= #
+  def show_frame_2?
+    @show_these_frames.include? :frame2
+  end
+
+  # ========================================================================= #
+  # === show_frame_3?
+  # ========================================================================= #
+  def show_frame_3?
+    @show_these_frames.include? :frame3
+  end
+
+  # ========================================================================= #
+  # === show_reverse_frame_1?
+  # ========================================================================= #
+  def show_reverse_frame_1?
+    @show_these_frames.include? :reverse_frame1
+  end
+
+  # ========================================================================= #
+  # === show_reverse_frame_2?
+  # ========================================================================= #
+  def show_reverse_frame_2?
+    @show_these_frames.include? :reverse_frame2
+  end
+
+  # ========================================================================= #
+  # === show_reverse_frame_3?
+  # ========================================================================= #
+  def show_reverse_frame_3?
+    @show_these_frames.include? :reverse_frame3
+  end
+
+  # ========================================================================= #
+  # === obtain_commandline_arguments_and_reject_double_separators
+  #
+  # Presently, we only work on Arrays as input.
+  # ========================================================================= #
+  def obtain_commandline_arguments_and_reject_double_separators(i)
+    _ = i
+    if i.is_a? Array
+      if _.any? {|entry| entry.include? '--' }
+        @commandline_arguments = _.select {|line| line.include? '--'}
+        _.reject! {|line| line.include? '--'}
+      end
+    end
+    return _
+  end
+
+  # ========================================================================= #
+  # === inner_strip
+  # ========================================================================= #
+  def inner_strip(i)
+    i.delete(' ')
+  end
+
+  # ========================================================================= #
+  # === set_input_sequence
+  #
+  # Set the DNA sequence here.
+  # ========================================================================= #
+  def set_input_sequence(i)
+    i = i.join if i.is_a? Array
+    i = remove_newlines(i)
+    i = strip(i) # Get rid of trailing thingies.
+    i = inner_strip(i)
+    @input_sequence = i
+  end
+
+  # ========================================================================= #
+  # === input_sequence?
+  # ========================================================================= #
+  def input_sequence?
+    @input_sequence
+  end; alias input? input_sequence? # === input?
+
+  # ========================================================================= #
+  # === remove_newlines
+  #
+  # This method will simply remove all newlines.
+  # ========================================================================= #
+  def remove_newlines(i)
+    if i.is_a? Array
+      i.flatten.map {|entry| remove_newlines(entry)}
+    else
+      i.delete(N)
+    end
+  end
+
+  # ========================================================================= #
+  # === strip
+  # ========================================================================= #
+  def strip(i)
+    if i.is_a? Array
+      i.map {|entry| strip(entry) }
+    else
+      i.strip
+    end
+  end
+
+  # ========================================================================= #
+  # === set_frame_1
+  # ========================================================================= #
+  def set_frame_1(i)
+    i = i.to_s
+    @frame_1 = i
+  end
+
+  # ========================================================================= #
+  # === set_frame_2
+  # ========================================================================= #
+  def set_frame_2(i)
+    i = i.to_s
+    @frame_2 = i
+  end
+
+  # ========================================================================= #
+  # === set_frame_3
+  # ========================================================================= #
+  def set_frame_3(i)
+    i = i.to_s
+    @frame_3 = i
+  end
+
+  # ========================================================================= #
+  # === total_length?
+  # ========================================================================= #
+  def total_length?
+    input?.size
+  end; alias total_size? total_length? # === total_size?
+
+  # ========================================================================= #
+  # === return_spacer
+  # ========================================================================= #
+  def return_spacer(n_spacer_tokens = 100)
+    '-' * n_spacer_tokens.abs
+  end
+
+  # ========================================================================= #
+  # === token_pad
+  # ========================================================================= #
+  def token_pad
+    '--------' # Horizontal padding.
+  end
+
+  # ========================================================================= #
+  # === reverse_complement
+  # ========================================================================= #
+  def reverse_complement(i)
+    i = complement(i.reverse)
+  end
+
+  # ========================================================================= #
+  # === return_numbers_based_on_this_input
+  # ========================================================================= #
+  def return_numbers_based_on_this_input(i)
+    _ = ''.dup
+    case i.size
+    when 11..20
+      _ << '10'+pad
+    when 21..29
+      _ << '10'+pad+'20'+pad
+    when 30..39
+      _ << '10'+pad+'20'+pad+'30'+pad
+    when 40..49
+      _ << '10'+pad+'20'+pad+'30'+pad+'40'+pad
+    when 50..59
+      _ << '10'+pad+'20'+pad+'30'+pad+'40'+pad+'50'+pad
+    when 60..69
+      _ << '10'+pad+'20'+pad+'30'+pad+'40'+pad+'50'+pad+'60'+pad
+    when 70..79
+      _ << '10'+pad+'20'+pad+'30'+pad+'40'+pad+'50'+pad+'60'+pad+'70'+pad
+    when 80..89
+      _ << '10'+pad+'20'+pad+'30'+pad+'40'+pad+'50'+pad+'60'+pad+'70'+pad+'80'+pad
+    when 90..99
+      _ << '10'+pad+'20'+pad+'30'+pad+'40'+pad+'50'+pad+'60'+pad+'70'+pad+'80'+pad+'90'+pad
+    else
+      _ << '10'+pad+'20'+pad+'30'+pad+'40'+pad+'50'+pad+'60'+pad+'70'+pad+'80'+pad+'90'+pad(-1)+'100'+pad
+    end
+    return _ # Return it here.
+  end
+
+  # ========================================================================= #
+  # === default_padding                                (padding tag, pad tag)
+  # ========================================================================= #
+  def default_padding(
+      optional_remove_last_character_n_times = false
+    )
+    result = '        '.dup
+    if optional_remove_last_character_n_times
+      optional_remove_last_character_n_times.abs.times { result.chop! }
+    end
+    return result
+  end; alias pad default_padding # === pad
+
+  # ========================================================================= #
+  # === n_nucleotides?
+  # ========================================================================= #
+  def n_nucleotides?
+    input?.size
+  end
+
+  # ========================================================================= #
+  # === colourize_stop_codons_in_red?
+  # ========================================================================= #
+  def colourize_stop_codons_in_red?
+    COLOURIZE_STOP_CODONS_IN_RED
+  end
+
+  # ========================================================================= #
+  # === frame_1?
+  # ========================================================================= #
+  def frame_1?
+    @frame_1
+  end; alias frame_1 frame_1? # === frame_1
+       alias frame1  frame_1? # === frame1
+
+  # ========================================================================= #
+  # === frame_2?
+  # ========================================================================= #
+  def frame_2?
+    @frame_2
+  end; alias frame_2 frame_2? # === frame_2
+       alias frame2  frame_2? # === frame2
+
+  # ========================================================================= #
+  # === frame_3?
+  # ========================================================================= #
+  def frame_3?
+    @frame_3
+  end; alias frame_3 frame_3? # === frame_3
+       alias frame3  frame_3? # === frame3
+
+  # ========================================================================= #
+  # === return_vertical_token
+  #
+  # If we want to return a colourized '|' token.
+  # ========================================================================= #
+  def return_vertical_token
+    _ = '|'
+    _ = palegreen(_)+rev if COLOURIZE_VERTICAL_TOKEN
+    return _
+  end
+
+  # ========================================================================= #
+  # === max_allowed_size_per_line
+  #
+  # This method will return a number, which states how many characters
+  # are allowed in the main header, above frame 1.
+  # ========================================================================= #
+  def max_allowed_size_per_line
+    _ = input?
+    n_nucleotides = _.size + 2 + _.size.to_s.size
+    return n_nucleotides
+  end
+
+  # ========================================================================= #
+  # === to_frame1
+  #
+  # Frame1 requires no change, so we can simply pass it into the
+  # method Bioroebe.translate_dna_into_aminoacid().
+  # ========================================================================= #
+  def to_frame1(i)
+    return ::Bioroebe.translate_dna_into_aminoacid(
+      i
+    ) # We need the module-method here.
+  end
+
+  # ========================================================================= #
+  # === to_frame2
+  #
+  # Frame2 requires a change, hence the second line in the method body.
+  # ========================================================================= #
+  def to_frame2(i)
+    i = i.dup
+    i[0,1] = '' # Chop off the first character.
+    return ::Bioroebe.translate_dna_into_aminoacid(
+      i
+    )
+  end
+
+  # ========================================================================= #
+  # === to_frame3
+  #
+  # Frame3 requires a change.
+  # ========================================================================= #
+  def to_frame3(i)
+    i = i.dup
+    i[0,1] = '' # Chop off the first character.
+    i[0,1] = '' # And again.
+    return ::Bioroebe.translate_dna_into_aminoacid(
+      i
+    )
+  end
+
+  # ========================================================================= #
+  # === to_reverse_frame3
+  # ========================================================================= #
+  def to_reverse_frame3(i)
+    i = reverse_complement(i).dup
+    return ::Bioroebe.translate_dna_into_aminoacid(i)
+  end
+
+  # ========================================================================= #
+  # === to_reverse_frame1
+  # ========================================================================= #
+  def to_reverse_frame1(i)
+    i = reverse_complement(i).dup
+    i[0,1] = ''
+    return ::Bioroebe.translate_dna_into_aminoacid(
+      i
+    )
+  end
+ 
+  # ========================================================================= #
+  # === to_reverse_frame2
+  # ========================================================================= #
+  def to_reverse_frame2(i)
+    i = reverse_complement(i).dup
+    i[0,1] = ''
+    i[0,1] = ''
+    return ::Bioroebe.translate_dna_into_aminoacid(
+      i
+    )
+  end
+
+  # ========================================================================= #
+  # === return_properly_formated_spacer_tokens
+  #
+  # Input how many '-' tokens you need to have for this line.
+  # ========================================================================= #
+  def return_properly_formated_spacer_tokens(i)
+    _ = return_spacer(i)
+    _.gsub(/----------/, '---------'+return_vertical_token)
+  end
+
+  # ========================================================================= #
+  # === return_horizontal_bar
+  # ========================================================================= #
+  def return_horizontal_bar(i = input?)
+    _ = return_spacer * i.size
+    # ======================================================================= #
+    # Next, at every 10th position, replace.
+    # ======================================================================= #
+    _.gsub!(/----------/, '---------'+return_vertical_token)
+    if _.size > LIMIT_AT_N_NUCLEOTIDES
+      _ = _[0, LIMIT_AT_N_NUCLEOTIDES]
+    end
+    return _
+  end
+
+  # ========================================================================= #
+  # === hor_bar
+  #
+  # This method is used to generate a horizontal bar.
+  #
+  # The second argument tells it how many times to repeat the main token.
+  # ========================================================================= #
+  def hor_bar(
+      i,
+      how_many_times
+    )
+    use_this_token = '-'
+    # ======================================================================= #
+    # Next, return the assembly.
+    # ======================================================================= #
+    token_pad+
+    use_this_token+
+    use_this_token+
+    use_this_token+
+    (i * how_many_times)
+  end
+
+  # ========================================================================= #
+  # === complement
+  # ========================================================================= #
+  def complement(i)
+    ::Bioroebe.complement(i)
+  end
+
+end
+
+# =========================================================================== #
+# === Bioroebe.showorf
+# =========================================================================== #
+def self.showorf(i = ARGV)
+  Bioroebe::ShowOrf.new(i, :all_frames)
+end
+
+end
+
+if __FILE__ == $PROGRAM_NAME
+  Bioroebe::ShowOrf.new(ARGV, :all_frames)
+end # showorf CACAGCAGCAGGCCCTCGGTCGTCGCTCCACATCAGCCGTCACATAGAGCTGATAG
+    # showorf CACAGCAGCAGGCCCTCGGTCGTCGCTCCACATCAGCCGTCACATAGAGCTGATAG --frame-1_and_2
+    # showorf CACAGCAGCAGGCCCTCGGTCGTCGCTCCACATCAGCCGTCACATAGAGCTGATAG --show-only-frame-1

data/lib/bioroebe/version/version.rb

@@ -0,0 +1,44 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# require 'bioroebe/version/version.rb'
+# =========================================================================== #
+module Bioroebe
+
+  # ========================================================================= #
+  # === VERSION
+  # ========================================================================= #
+  VERSION = '0.10.80'
+
+  # ========================================================================= #
+  # === LAST_UPDATE
+  #
+  # This variable keeps track as to when the bioroebe project was last
+  # updated. The notation is: DD.MM.YYYY
+  # ========================================================================= #
+  LAST_UPDATE = '24.06.2022'
+
+  # ========================================================================= #
+  # === URL_TO_THE_DOCUMENTATION
+  #
+  # Keep track of where the documentation to BioRoebe is kept at.
+  # ========================================================================= #
+  URL_TO_THE_DOCUMENTATION =
+    "https://www.rubydoc.info/gems/#{self.to_s.downcase}/#{VERSION}"
+
+  # ========================================================================= #
+  # === Bioroebe.last_updated?
+  # ========================================================================= #
+  def self.last_updated?
+    LAST_UPDATE
+  end
+
+  # ========================================================================= #
+  # === Bioroebe.version?
+  # ========================================================================= #
+  def self.version?
+    ::Bioroebe::VERSION
+  end; self.instance_eval { alias version version? } # === Bioroebe.version
+
+end

data/lib/bioroebe/viennarna/README.md

@@ -0,0 +1,3 @@
+This directory may contain some ad-hoc code that can be useful for
+the ViennaRNA package. I needed this in early 2019, so I wrote some
+code to help me here. The code here isn't of best quality, though.