bioroebe 0.10.80

data/lib/bioroebe/fasta_and_fastq/split_this_fasta_file_into_chromosomes/split_this_fasta_file_into_chromosomes.rb

@@ -0,0 +1,290 @@
+#!/user/bioinf4/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# === Bioroebe::SplitThisFastaFileIntoChromosomes
+#
+# This class can be used to split a larger, eukaryotic .fasta/.fa file
+# into fasta files grouped according to chromosomes, e. g. all entries
+# in such a created file will belong to a particular chromosome.
+#
+# Usage example:
+#
+#   Bioroebe::SplitThisFastaFileIntoChromosomes.new(ARGV)
+#
+# =========================================================================== #
+# require 'bioroebe/fasta/split_this_fasta_file_into_chromosomes/split_this_fasta_file_into_chromosomes.rb'
+# Bioroebe::SplitThisFastaFileIntoChromosomes.new
+# =========================================================================== #
+require 'bioroebe/base/commandline_application/commandline_application.rb'
+
+module Bioroebe
+
+class SplitThisFastaFileIntoChromosomes < ::Bioroebe::CommandlineApplication # === Bioroebe::SplitThisFastaFileIntoChromosomes
+
+  require 'bioroebe/fasta_and_fastq/return_fasta_subsection_of_this_file.rb'
+  require 'bioroebe/fasta_and_fastq/split_this_fasta_file_into_chromosomes/constants.rb'
+  require 'bioroebe/fasta_and_fastq/split_this_fasta_file_into_chromosomes/menu.rb'
+  require 'bioroebe/fasta_and_fastq/split_this_fasta_file_into_chromosomes/misc.rb'
+  require 'bioroebe/fasta_and_fastq/split_this_fasta_file_into_chromosomes/reset.rb'
+
+  # ========================================================================= #
+  # === initialize
+  # ========================================================================= #
+  def initialize(
+      commandline_arguments = nil,
+      run_already           = true
+    )
+    reset
+    set_commandline_arguments(
+      commandline_arguments
+    )
+    run if run_already
+  end
+
+  # ========================================================================= #
+  # === set_active_chromosome
+  #
+  # We will keep track of which chromosome is active, such as "2" or
+  # "5" or "X". This allows us to put the FASTA nucleotide sequence
+  # into the proper filename.
+  # ========================================================================= #
+  def set_active_chromosome(i)
+    i = i.to_s
+    @active_chromosome = i
+  end
+
+  # ========================================================================= #
+  # === determine_the_prefix_for_the_autogenerated_files
+  #
+  # This method will try to automatically determine the prefix for
+  # the autogenerated files. This can be overruled by the user on
+  # the commandline, via:
+  #   --prefix=ncrna
+  # ========================================================================= #
+  def determine_the_prefix_for_the_autogenerated_files(
+      i = File.basename(return_pwd)
+    )
+    @prefix_for_the_autogenerated_files = i
+  end
+
+  # ========================================================================= #
+  # === set_use_this_prefix
+  # ========================================================================= #
+  def set_use_this_prefix(i)
+    @prefix_for_the_autogenerated_files = i
+  end
+
+  # ========================================================================= #
+  # === main_file?
+  # ========================================================================= #
+  def main_file?
+    @this_file
+  end
+
+  # ========================================================================= #
+  # === active_chromosome?
+  # ========================================================================= #
+  def active_chromosome?
+    @active_chromosome
+  end
+
+  # ========================================================================= #
+  # === last_line_is_empty?
+  #
+  # Here we query whether the last line was empty or whether it was not.
+  # ========================================================================= #
+  def last_line_is_empty?
+    !last_line?.end_with?("\n")
+  end
+
+  # ========================================================================= #
+  # === has_only_nucleotides?
+  #
+  # This method will return true if the input-line has only nucleotides;
+  # and false otherwise.
+  # ========================================================================= #
+  def has_only_nucleotides?(i)
+    # ======================================================================= #
+    # First grab the unique characters from the given input String - we
+    # assume that a String has been passed.
+    # ======================================================================= #
+    unique_chars = i.strip.chars.uniq
+    return_value = true
+    unique_chars.each {|character|
+      case character
+      when *ALLOWED_CHARACTERS
+        # These cases are fine.
+      else
+        return_value = false
+      end
+    }
+    return return_value
+  end
+
+  # ========================================================================= #
+  # === append_this_line_into_the_default_chromosome
+  #
+  # This method exists mostly only due to readability reasons alone, as we
+  # could otherwise use append_this_line_into_that_file() as-is.
+  #
+  # Note that this method is exclusively called when we have lines that
+  # only have a FASTA nucleotide sequence right now, such as "ATGCACG".
+  # ========================================================================= #
+  def append_this_line_into_the_default_chromosome(i)
+    if @store_the_fasta_body_as_a_single_line
+      append_this_line_into_that_file(i, @active_chromosome, :reject_newlines)
+    else
+      append_this_line_into_that_file(i, @active_chromosome)
+    end
+  end
+
+  # ========================================================================= #
+  # === append_newline
+  # ========================================================================= #
+  def append_newline
+    append_this_line_into_that_file(N, :default_name)
+  end
+
+  # ========================================================================= #
+  # === append_this_line_into_that_file                          (append tag)
+  #
+  # Append the input-line into the file at hand.
+  # ========================================================================= #
+  def append_this_line_into_that_file(
+      line, # ← This is the content that will be put into the file at hand.
+      name_of_the_file   = @active_chromosome,
+      additional_options = nil # This can be :reject_newlines or nil.
+    )
+    case name_of_the_file
+    when :default_name
+      name_of_the_file = @active_chromosome
+    end
+    if line.is_a? Array
+      line = line.first
+    end
+    unless name_of_the_file.end_with? '.fa'
+      name_of_the_file << '.fa'
+    end
+    what = line.dup
+    set_last_line(what) # Keep track of the last line in use.
+    if additional_options == :reject_newlines
+      what.strip!
+    end
+    into = "#{@prefix_for_the_autogenerated_files}#{name_of_the_file}"
+    append_what_into(what, into)
+  end
+
+  # ========================================================================= #
+  # === set_last_line
+  # ========================================================================= #
+  def set_last_line(i)
+    @last_line = i.dup
+  end
+
+  # ========================================================================= #
+  # === last_line?
+  # ========================================================================= #
+  def last_line?
+    @last_line
+  end
+
+  # ========================================================================= #
+  # === show_help                                                  (help tag)
+  # ========================================================================= #
+  def show_help
+    e 'Documented options available:'
+    e
+    e '  --prefix=ncrna # This is the prefix for the autogenerated .fa files'
+    e
+  end
+
+  # ========================================================================= #
+  # === run                                                         (run tag)
+  # ========================================================================= #
+  def run
+    menu
+    # ======================================================================= #
+    # See: https://rubular.com/r/AFwJeQdJ5fuut1
+    # ======================================================================= #
+    use_this_regex = /chromosome:#{@use_this_genome}:([0-9A-Z]+):/
+    _ = main_file?
+    unless File.exist? _
+      opnn; no_file_exists_at(_)
+      return
+    end
+    if File.exist? _
+      # ===================================================================== #
+      # We first obtain the array of our dataset, already properly split up
+      # for us.
+      # ===================================================================== #
+      array = ::Bioroebe.return_fasta_subsection_of_this_file(_, :keep_it_flat)
+      # ===================================================================== #
+      # We iterate over our data structure - first the FASTA header, then
+      # the FASTA body, both of which are Strings at this point.
+      # ===================================================================== #
+      array.each {|fasta_header_string, fasta_body_string|
+        # =================================================================== #
+        # Check for the line containing the substring 'chromosome:'.
+        # =================================================================== #
+        if fasta_header_string.include? 'chromosome:'
+          fasta_header_string =~ use_this_regex
+          match = $1.to_s.dup
+          if match.empty?
+            # =============================================================== #
+            # This clause is used when we have found a line containing a
+            # "chromosome:" substring but without a proper "assumed"
+            # match, such as a number or X or Y. For example, the FASTA
+            # header id may include a substring such as _PATCH, which does
+            # not denote any chromosome.
+            # =============================================================== #
+            @n_unidentified_lines += 1
+            cliner
+            erev "The line at #{slateblue(fasta_header_string)}#{rev} was not identified."
+            erev 'It will be shown regardless, so as to notify you about it.'
+            if fasta_header_string.include? '_PATCH'
+              erev 'It is most likely a patch-set to the (genomic) '\
+                   'dataset at hand.'
+            end
+            next # We will skip when reaching this point.
+          else
+            # =============================================================== #
+            # Here we have found a match, so we can simply store this
+            # into the file in that event.
+            # =============================================================== #
+            if @be_verbose
+              opnn; erev "The following line belongs to chromosome "\
+                         "number `#{sfancy(match)}#{rev}`."
+              e crimson(fasta_header_string)
+            end
+            if @last_line
+              unless last_line?.empty?
+                append_newline
+              end
+            end
+            set_active_chromosome(match)
+            append_this_line_into_that_file(fasta_header_string, match)
+          end
+          # ================================================================= #
+          # We must also store the FASTA body, which will be done by
+          # the following line.
+          # ================================================================= #
+          append_this_line_into_the_default_chromosome(fasta_body_string)
+        end
+      }
+    end
+  end
+
+  # ========================================================================= #
+  # === Bioroebe::SplitThisFastaFileIntoChromosomes[]
+  # ========================================================================= #
+  def self.[](i = '')
+    new(i)
+  end
+
+end; end
+
+if __FILE__ == $PROGRAM_NAME
+  Bioroebe::SplitThisFastaFileIntoChromosomes.new(ARGV)
+end # splitthisfastafileintochromosomes
+    # splitthisfastafileintochromosomes Mus_musculus.GRCm38.ncrna.fa

data/lib/bioroebe/genbank/README.md

@@ -0,0 +1 @@
+This directory will contain GenBank-related classes and code.

data/lib/bioroebe/genbank/genbank_flat_file_format_generator.rb

@@ -0,0 +1,275 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# === Bioroebe::GenbankFlatFileFormatGenerator
+#
+# This file can create a GenBank Flat File Format.
+#
+# A sample for this format can be found here:
+#
+#   https://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html
+#
+# Usage example:
+#
+#   Bioroebe::GenbankFlatFileFormatGenerator.new(ARGV)
+#
+# =========================================================================== #
+# require 'bioroebe/genbank/genbank_flat_file_format_generator.rb'
+# =========================================================================== #
+require 'bioroebe/base/commandline_application/commandline_application.rb'
+
+module Bioroebe
+
+class GenbankFlatFileFormatGenerator < ::Bioroebe::CommandlineApplication # === Bioroebe::GenBankFlatFileFormatGenerator
+
+  # ========================================================================= #
+  # === DEFAULT_NAME_OF_THE_LOCUS
+  # ========================================================================= #
+  DEFAULT_NAME_OF_THE_LOCUS = 'tmpseq_0'
+
+  # ========================================================================= #
+  # === initialize
+  # ========================================================================= #
+  def initialize(
+      i           = nil,
+      run_already = true
+    )
+    reset
+    set_input(i)
+    case run_already # case tag
+    when :do_not_run_yet
+      run_already = false
+    end
+    # ======================================================================= #
+    # === Handle blocks next
+    # ======================================================================= #
+    if block_given?
+      yielded = yield
+      # ===================================================================== #
+      # === Handle Hashes next
+      # ===================================================================== #
+      if yielded.is_a? Hash
+        # =================================================================== #
+        # === :sequence_id
+        # =================================================================== #
+        if yielded.has_key? :sequence_id
+          set_id(yielded.delete(:sequence_id))
+        end
+      # ===================================================================== #
+      # === Handle Symbols next
+      # ===================================================================== #
+      elsif yielded.is_a? Symbol
+        case yielded
+        # =================================================================== #
+        # === :be_quiet
+        # =================================================================== #
+        when :be_quiet
+          @be_verbose = false
+        end
+      end
+    end
+    run if run_already
+  end
+
+  # ========================================================================= #
+  # === reset                                                     (reset tag)
+  # ========================================================================= #
+  def reset
+    super()
+    # ======================================================================= #
+    # === @be_verbose
+    # ======================================================================= #
+    @be_verbose = true
+    # ======================================================================= #
+    # === @shall_we_downcase
+    # ======================================================================= #
+    @shall_we_downcase = true
+    # ======================================================================= #
+    # === @string
+    # ======================================================================= #
+    @string = ''.dup # This is the one that will be output.
+    set_name_of_the_locus
+  end
+
+  # ========================================================================= #
+  # === n_nucleotides?
+  # ========================================================================= #
+  def n_nucleotides?
+    @input.size
+  end
+
+  # ========================================================================= #
+  # === set_input
+  # ========================================================================= #
+  def set_input(
+      i                 = '',
+      shall_we_downcase = @shall_we_downcase
+    )
+    i = i.first if i.is_a? Array
+    i = i.to_s.dup.strip
+    if i and File.file?(i)
+      i = File.readlines(i)
+      i.shift if i.first.start_with?('>')
+      i = i.join("\n")
+    end
+    if shall_we_downcase
+      i.downcase! # For now we keep everything downcased, as this is the default for GenBank files.
+    end
+    @input = i
+  end
+
+  # ========================================================================= #
+  # === n_adenines?
+  # ========================================================================= #
+  def n_adenines?
+    @input.count('a')
+  end
+
+  # ========================================================================= #
+  # === n_cytosines?
+  # ========================================================================= #
+  def n_cytosines?
+    @input.count('c')
+  end
+
+  # ========================================================================= #
+  # === n_thymines?
+  # ========================================================================= #
+  def n_thymines?
+    @input.count('t')
+  end
+
+  # ========================================================================= #
+  # === n_guanines?
+  # ========================================================================= #
+  def n_guanines?
+    @input.count('g')
+  end
+
+  # ========================================================================= #
+  # === add
+  # ========================================================================= #
+  def add(i)
+    @string << i
+  end
+
+  # ========================================================================= #
+  # === return_current_date
+  # ========================================================================= #
+  def return_current_date
+    day   = ::Time.now.strftime('%d')
+    year  = ::Time.now.strftime('%Y')
+    month = ::Time.now.strftime('%B').upcase # month tag
+    "#{day}-#{month}-#{year}"
+  end
+
+  # ========================================================================= #
+  # === chromosome_form?
+  #
+  # This will be linear or circular chromosome.
+  # ========================================================================= #
+  def chromosome_form?
+    'linear'
+  end
+
+  # ========================================================================= #
+  # === show_main_string
+  # ========================================================================= #
+  def show_main_string
+    e @string if @be_verbose
+  end
+
+  # ========================================================================= #
+  # === string?
+  # ========================================================================= #
+  def string?
+    @string
+  end
+
+  # ========================================================================= #
+  # === set_name_of_the_locus
+  # ========================================================================= #
+  def set_name_of_the_locus(i = DEFAULT_NAME_OF_THE_LOCUS)
+    @name_of_the_locus = i
+  end; alias use_this_as_id= set_name_of_the_locus # === use_this_as_id=
+       alias set_id          set_name_of_the_locus # === set_id
+
+  # ========================================================================= #
+  # === add_required_content
+  # ========================================================================= #
+  def add_required_content
+    add 'LOCUS       '+name_of_the_locus?+'                 '+n_nucleotides?.to_s+' bp            '+chromosome_form?+'       '+return_current_date+'
+DEFINITION  No definition line found.
+ACCESSION   '+name_of_the_locus?+'
+VERSION     
+KEYWORDS    .
+SOURCE      Unknown.
+  ORGANISM  Unknown.
+            Unclassified.
+FEATURES             Location/Qualifiers
+     source          1..'+n_nucleotides?.to_s+'
+BASE COUNT       '+n_adenines?.to_s+' a     '+n_cytosines?.to_s+' c     '+n_guanines?.to_s+' g     '+n_thymines?.to_s+' t
+ORIGIN
+'+
+return_chunked_numbered_and_properly_spaced_sequence+
+'//
+'
+  end
+
+  # ========================================================================= #
+  # === input?
+  # ========================================================================= #
+  def input?
+    @input
+  end; alias nucleotide_sequence? input? # === nucleotide_sequence?
+       alias dna_sequence?        input? # === dna_sequence?
+
+  # ========================================================================= #
+  # === name_of_the_locus?
+  # ========================================================================= #
+  def name_of_the_locus?
+    @name_of_the_locus
+  end; alias sequence_id? name_of_the_locus? # === sequence_id?
+       alias id?          name_of_the_locus? # === id?
+
+  # ========================================================================= #
+  # === return_nucleotide_sequence_as_ten_nucleotides_chunks
+  #
+  # This will return the input sequence in the form of chunks.
+  # ========================================================================= #
+  def return_nucleotide_sequence_as_ten_nucleotides_chunks
+    ::Bioroebe.return_nucleotide_sequence_as_ten_nucleotides_chunks(nucleotide_sequence?)
+  end
+
+  # ========================================================================= #
+  # === return_chunked_numbered_and_properly_spaced_sequence
+  #
+  # This method will display the nucleotides via a proper chunk.
+  # ========================================================================= #
+  def return_chunked_numbered_and_properly_spaced_sequence(
+      i = dna_sequence?
+    ) 
+    ::Bioroebe.return_chunked_display(i)
+  end
+
+  # ========================================================================= #
+  # === run                                                         (run tag)
+  # ========================================================================= #
+  def run
+    add_required_content
+    show_main_string
+  end
+
+  # ========================================================================= #
+  # === Bioroebe::GenbankFlatFileFormatGenerator[]
+  # ========================================================================= #
+  def self.[](i = '')
+    new(i)
+  end
+
+end; end
+
+if __FILE__ == $PROGRAM_NAME
+  Bioroebe::GenbankFlatFileFormatGenerator.new(ARGV)
+end # genbankflatfilegen ATGGGGCCTGCAATGGGGCCTGCAATGGGGCCTGCAATGGGGCCTGCAATGGGGCCTGCAATGGGGCCTGCAATGGGGCCTGCAATGGGGCCTGCA