bioroebe 0.10.80

data/lib/bioroebe/fasta_and_fastq/download_fasta.rb

@@ -0,0 +1,248 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# === Bioroebe::DownloadFasta
+#
+# This class can download fasta files and automatically name the
+# files "appropriately". The first argument should be the remote
+# URL to the fasta file at hand.
+#
+# Usage example:
+#
+#   Bioroebe::DownloadFasta.new(ARGV)
+#
+# =========================================================================== #
+# require 'bioroebe/fasta_and_fastq/download_fasta.rb'
+# =========================================================================== #
+require 'bioroebe/base/commandline_application/commandline_application.rb'
+
+module Bioroebe
+
+class DownloadFasta < ::Bioroebe::CommandlineApplication # === Bioroebe::DownloadFasta
+
+  require 'bioroebe/ncbi/efetch.rb'
+
+  # ========================================================================= #
+  # === NAMESPACE
+  # ========================================================================= #
+  NAMESPACE = inspect
+
+  # ========================================================================= #
+  # === BASE_URL
+  # ========================================================================= #
+  BASE_URL = 'https://www.ncbi.nlm.nih.gov'
+
+  # ========================================================================= #
+  # === DEFAULT_URL_TO_USE
+  #
+  # Here you can designate a default file to use.
+  #
+  # This file should contain URLs to a target nucleotide sequence.
+  #
+  # The format is just one URL per line, then a newline.
+  # ========================================================================= #
+  DEFAULT_URL_TO_USE = '/FASTA_FILE_URL.md'
+
+  # ========================================================================= #
+  # === initialize
+  # ========================================================================= #
+  def initialize(
+      i           = nil,
+      run_already = true
+    )
+    reset
+    set_commandline_arguments(i)
+    run if run_already
+  end
+
+  # ========================================================================= #
+  # === reset                                                     (reset tag)
+  # ========================================================================= #
+  def reset
+    super()
+    # ======================================================================= #
+    # === @namespace
+    # ======================================================================= #
+    @namespace = NAMESPACE
+  end
+
+  # ========================================================================= #
+  # === enter_log_directory
+  # ========================================================================= #
+  def enter_log_directory(be_verbose = true)
+    _ = log_dir?
+    if !(return_pwd == _)
+      if be_verbose
+        opnn; e "Now changing directory to `#{sdir(_)}`."
+      end
+      unless File.exist? _
+        mkdir(_)
+      end
+      cd _
+    end
+  end
+
+  # ========================================================================= #
+  # === report_where_the_file_is_stored_at
+  # ========================================================================= #
+  def report_where_the_file_is_stored_at(
+      i = @file_is_stored_here
+    )
+    if i and File.exist?(i)
+      opnn; erev "The file is now stored at `#{sfile(i)}#{rev}`."
+    end
+  end
+
+  # ========================================================================= #
+  # === file_is_stored_here?
+  # ========================================================================= #
+  def file_is_stored_here?
+    @file_is_stored_here
+  end; alias location? file_is_stored_here? # === location?
+
+  # ========================================================================= #
+  # === rename_to_fasta
+  # ========================================================================= #
+  def rename_to_fasta(i)
+    @file = rds(File.dirname(i)+'/'+File.basename(i)+'.fa')
+    opnn; erev "Next renaming `#{sfile(i)}` to `#{sfile(@file)}`."
+    mv(i, @file)
+  end
+
+  # ========================================================================= #
+  # === download_remote_file
+  #
+  # The URL should be in the form of a NM_ file.
+  #
+  # We will then find the proper fasta entry from that.
+  # ========================================================================= #
+  def download_remote_file(url)
+    if url.is_a? Array
+      url.each {|entry| download_remote_file(entry) }
+    else
+      url = url.dup if url.frozen?
+      url.strip! # We don't want trailing newlines or ' ' characters.
+      url.delete!("\n")
+      # ===================================================================== #
+      # We will have to read the URL for the proper href="" entry. 
+      # ===================================================================== #
+      regex = /href="(.+\?report=fasta)"/ # http://rubular.com/r/pGYEMD2VCy
+      # ===================================================================== #
+      # Numbers are easier to handle, so we can bypass most of the next
+      # logic.
+      # ===================================================================== #
+      if url =~ /^\d+$/ or url.start_with?('NC_') or # If only numbers or start with a NC_ value.
+        url.include?('&id=XP_') or
+        url.include?('&id=NP_') or
+        url.include?('&id=YP_') or
+        url.include?('&id=NM_') or
+        url.include?('&id=WP_')
+        match = url
+      else
+        opnn; e "We will use the URL `#{simp(url)}`"
+        remote_file_content = ''.dup # Our variable.
+        # =================================================================== #
+        # We store the content of the remote page in the variable called
+        # remote_file_content, a String.
+        # =================================================================== #
+        begin
+          URI.open(url) {|file|
+            file.each_line {|line|
+              remote_file_content << line
+            }
+          }
+          if url.include?('ncbi')
+            # =============================================================== #
+            # Determine the regex we will use to grab more information.
+            # Right now we look for two entries: fasta or genbank entry.
+            # =============================================================== #
+            regex = /(\d{1,18}\.?\d{0,5})\?report=(fasta|genbank)/ # See https://rubular.com/r/hiOp9ZPBOfDGJq
+            # =============================================================== #
+            # Match it against the page-content.
+            # =============================================================== #
+            remote_file_content =~ regex
+            match = $1.to_s.dup
+          else
+            match = remote_file_content.split("\n").first.to_s.delete('>').strip
+            if match.include? '|' # sp|Q9CR68
+              match = match.split('|')[1]
+            end 
+          end
+        rescue Errno::ENOENT => error
+          opnn; e tomato('We encountered an error, which we will feedback next.')
+          pp error
+          match = url
+        end
+      end
+      # ===================================================================== #
+      # Ok, next we have the NCBI Url. We still have to extract the
+      # relevant fasta content from that. No longer needed.
+      # ===================================================================== #
+      # ncbi_url = BASE_URL+match
+      if url.include? 'ncbi'
+        # =================================================================== #
+        # The url may look like this:
+        #
+        #   https://www.ncbi.nlm.nih.gov/protein/NP_001065289.1?report=fasta
+        #
+        # =================================================================== #
+        _ = File.basename(match)
+        @file_is_stored_here = ::Bioroebe::Ncbi.efetch_by_url(_)
+      else
+        @file_is_stored_here = log_dir?+match.to_s+'.fasta'
+        write_what_into(remote_file_content, @file_is_stored_here)
+      end
+      report_where_the_file_is_stored_at(@file_is_stored_here)
+      return @file_is_stored_here
+    end
+  end
+
+  # ========================================================================= #
+  # === run                                                         (run tag)
+  # ========================================================================= #
+  def run
+    enter_log_directory
+    if commandline_arguments?.empty?
+      # ===================================================================== #
+      # Assign a default URL to use in the event that the user did not
+      # provide a valid URL for us to download & fetch.
+      # ===================================================================== #
+      commandline_arguments? << DEFAULT_URL_TO_USE
+    end
+    commandline_arguments?.each {|this_file|
+      this_file = this_file.to_s # To avoid follow-up problems.
+      if File.exist? this_file # This here is mostly done for testing-purposes.
+        this_file = File.readlines(this_file).reject {|entry| entry.strip.empty? }
+        unless this_file.first.include? '/'
+          opnn; erev 'Now working on '+this_file.size.to_s+' entries.'
+          this_file.map! {|entry|
+            entry = entry.dup if entry.frozen?
+            entry.delete!("\n")
+            entry = 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=protein&id='+
+                    entry.to_s+'&rettype=fasta&retmode=text'
+            entry.strip
+          }
+        end
+      end
+      download_remote_file(this_file)
+    }
+  end
+
+end
+
+# =========================================================================== #
+# === Bioroebe.download_fasta
+#
+# Easier wrapper-method to download fasta files.
+# =========================================================================== #
+def self.download_fasta(i)
+  ::Bioroebe::DownloadFasta.new(i).location?
+end
+
+end
+
+if __FILE__ == $PROGRAM_NAME
+  Bioroebe::DownloadFasta.new(ARGV)
+end # downloadfasta
+    # downloadfasta /root/Bioroebe/table_ids.md

data/lib/bioroebe/fasta_and_fastq/fasta_defline/README.md

@@ -0,0 +1,2 @@
+This is to parse the FASTA def-line, which is the very first line
+of a FASTA file.

data/lib/bioroebe/fasta_and_fastq/fasta_defline/fasta_defline.rb

@@ -0,0 +1,113 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# === Bioroebe::FastaDefline
+#
+# The defline is also known as the "Geninfo number".
+#
+# The format for the defline can be seen here:
+#
+#   https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=BlastHelp
+#
+# Usage example:
+#
+#   Bioroebe::FastaDefline.new(ARGV)
+#
+# =========================================================================== #
+# require 'bioroebe/fasta_and_fastq/fasta_defline/fasta_defline.rb'
+# =========================================================================== #
+require 'bioroebe/base/commandline_application/commandline_application.rb'
+
+module Bioroebe
+
+class FastaDefline < ::Bioroebe::CommandlineApplication # === Bioroebe::FastaDefline
+
+  # ========================================================================= #
+  # === NAMESPACE
+  # ========================================================================= #
+  NAMESPACE = inspect
+
+  # ========================================================================= #
+  # === initialize
+  # ========================================================================= #
+  def initialize(
+      commandline_arguments = nil,
+      run_already           = true
+    )
+    reset
+    set_commandline_arguments(
+      commandline_arguments
+    )
+    run if run_already
+  end
+
+  # ========================================================================= #
+  # === reset                                                     (reset tag)
+  # ========================================================================= #
+  def reset
+    super()
+  end
+
+  # ========================================================================= #
+  # === do_parse_the_defline
+  #
+  # This is the method that can parse an existing FASTA file.
+  # ========================================================================= #
+  def do_parse_the_defline(
+      i = first?
+    )
+    if i and File.exist?(i)
+      i = File.readlines(i).reject {|line| line.start_with?('#') }.first.to_s
+    end
+    i = i.delete('>')
+    splitted = i.split('|')
+    @entry_id = splitted[0 .. 1].join('|')
+    @gi       = splitted[1]
+    @accession = splitted[3]
+    if @accession.include? '.'
+      @accession = @accession.split('.').first.to_s
+    end
+    @acc_version = splitted[3]
+  end
+
+  # ========================================================================= #
+  # === accession?
+  # ========================================================================= #
+  def accession?
+    @accession
+  end; alias accession accession? # === accession
+
+  # ========================================================================= #
+  # === gi?
+  # ========================================================================= #
+  def gi?
+    @gi
+  end; alias gi gi? # === gi
+
+  # ========================================================================= #
+  # === entry_id?
+  # ========================================================================= #
+  def entry_id?
+    @entry_id
+  end; alias entry_id entry_id? # === entry_id
+
+  # ========================================================================= #
+  # === run                                                         (run tag)
+  # ========================================================================= #
+  def run
+    do_parse_the_defline
+  end
+
+  # ========================================================================= #
+  # === Bioroebe::FastaDefline[]
+  # ========================================================================= #
+  def self.[](i = '')
+    new(i)
+  end
+
+end; end
+
+if __FILE__ == $PROGRAM_NAME
+  pp Bioroebe::FastaDefline.new(ARGV)
+end # fastadefline

data/lib/bioroebe/fasta_and_fastq/fasta_parser.rb

@@ -0,0 +1,167 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# === Bioroebe::FastaParser
+#
+# This file can fetch a FASTA file from a remote web-site.
+#
+# The URL to be given is the first argument to this class.
+#
+# Usage example:
+#
+#   Bioroebe::FastaParser.new
+#
+# =========================================================================== #
+# require 'bioroebe/fasta/fasta_parser.rb'
+# =========================================================================== #
+require 'bioroebe/base/base.rb'
+
+module Bioroebe
+
+class FastaParser < Base # === Bioroebe::FastaParser
+
+  # ========================================================================= #
+  # === MAIN_URL
+  # ========================================================================= #
+  MAIN_URL = 'https://www.ncbi.nlm.nih.gov/'
+
+  # ========================================================================= #
+  # === BASE_URL
+  # ========================================================================= #
+  BASE_URL = MAIN_URL+'protein/'
+
+  # ========================================================================= #
+  # === APPEND_THIS
+  # ========================================================================= #
+  APPEND_THIS = '?report=fasta'
+
+  # ========================================================================= #
+  # === DEFAULT_URL
+  # ========================================================================= #
+  DEFAULT_URL = 340622821
+
+  # ========================================================================= #
+  # === DISPLAY_HTML_RESULT
+  # ========================================================================= #
+  DISPLAY_HTML_RESULT = true
+
+  # ========================================================================= #
+  # === SAVE_HTML_FILE_HERE
+  # ========================================================================= #
+  SAVE_HTML_FILE_HERE = ::Bioroebe.log_dir?+
+                        'SavedFasta.html'
+
+  # ========================================================================= #
+  # === initialize
+  # ========================================================================= #
+  def initialize(
+      url         = DEFAULT_URL,
+      run_already = true
+    )
+    reset
+    set_full_url(url)
+    run if run_already
+  end
+
+  # ========================================================================= #
+  # === reset
+  # ========================================================================= #
+  def reset
+    super()
+    # ======================================================================= #
+    # === @result
+    # ======================================================================= #
+    @result = nil
+    # ======================================================================= #
+    # === @url
+    # ======================================================================= #
+    @url = nil
+    # ======================================================================= #
+    # === @save_html_file_here
+    # ======================================================================= #
+    @save_html_file_here = SAVE_HTML_FILE_HERE
+  end
+
+  # ========================================================================= #
+  # === set_full_url
+  # ========================================================================= #
+  def set_full_url(
+      i          = DEFAULT_URL,
+      be_verbose = true
+    )
+    case i # case tag
+    when nil
+      i = DEFAULT_URL
+    when 'help','help?'
+      feedback_help_then_exit
+    end
+    i = BASE_URL+i.to_s+APPEND_THIS
+    @url = i
+    e 'Setting to use this URL: '+sfancy(@url) if be_verbose
+  end
+
+  # ========================================================================= #
+  # === feedback_help_then_exit
+  # ========================================================================= #
+  def feedback_help_then_exit
+    e 'The URL is:'
+    e
+    e "  #{simp(MAIN_URL)}"
+    e
+    exit(0)
+  end
+
+  # ========================================================================= #
+  # === read_remote_url
+  # ========================================================================= #
+  def read_remote_url
+    @result = open(@url).read
+    sanitize_result
+    e @result if DISPLAY_HTML_RESULT
+  end
+
+  # ========================================================================= #
+  # === sanitize_result
+  # ========================================================================= #
+  def sanitize_result # make @result look better.
+    @result.squeeze!(' ')
+  end
+
+  # ========================================================================= #
+  # === report_url_used
+  # ========================================================================= #
+  def report_url_used
+    e 'We used this URL:'
+    e "  #{simp(@url)}"
+  end
+
+  # ========================================================================= #
+  # === save_html_file
+  # ========================================================================= #
+  def save_html_file
+    if @result # Save the HTML data.
+      unless Dir.exist?(File.basename(@save_html_file_here))
+        @save_html_file_here = File.expand_path('~')+'/'+
+          File.basename(SAVE_HTML_FILE_HERE)
+      end
+      e 'We will save the HTML file here:'
+      e "  #{simp(@save_html_file_here)}"
+      save_file(@result, @save_html_file_here,'w+')
+    end
+  end
+
+  # ========================================================================= #
+  # === run                                                         (run tag)
+  # ========================================================================= #
+  def run
+    read_remote_url
+    report_url_used
+    save_html_file
+  end
+
+end; end
+
+if __FILE__ == $PROGRAM_NAME
+  Bioroebe::FastaParser.new(ARGV.first)
+end # $RUBY_BIOROEBE/fasta/fasta_parser.rb

data/lib/bioroebe/fasta_and_fastq/fastq_format_explainer.rb

@@ -0,0 +1,131 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# === Bioroebe::FastqFormatExplainer
+#
+# This class will explain the .fastq format, via the commandline.
+#
+# A FASTQ file containing a single sequence, might look like this:
+# 
+#   @SEQ_ID
+#   GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+#   +
+#   !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
+# 
+# The character '!' represents the lowest quality while '~' is the
+# highest. Here are the quality value characters in left-to-right
+# increasing order of quality (ASCII):
+# 
+#   !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+#
+# Usage example:
+#
+#   Bioroebe::FastqFormatExplainer.new(ARGV)
+#
+# =========================================================================== #
+# require 'bioroebe/fastq_and_fastq/fastq_format_explainer.rb'
+# =========================================================================== #
+require 'bioroebe/base/commandline_application/commandline_application.rb'
+
+module Bioroebe
+
+class FastqFormatExplainer < ::Bioroebe::CommandlineApplication # === Bioroebe::FastqFormatExplainer
+
+  # ========================================================================= #
+  # === initialize
+  # ========================================================================= #
+  def initialize(
+      i           = nil,
+      run_already = true
+    )
+    reset
+    set_commandline_arguments(i)
+    run if run_already
+  end
+
+  # ========================================================================= #
+  # === reset                                                     (reset tag)
+  # ========================================================================= #
+  def reset
+    super()
+    # ======================================================================= #
+    # === @sequence
+    # ======================================================================= #
+    @sequence = nil
+    # ======================================================================= #
+    # === @ljust_value
+    # ======================================================================= #
+    @ljust_value = 20
+  end
+
+  # ========================================================================= #
+  # === parse_input
+  # ========================================================================= #
+  def parse_input(i = first?)
+    if i and File.exist?(i)
+      dataset = File.read(i)
+      splitted = dataset.split("\n")
+      @header = splitted[0]
+      @sequence = splitted[1]
+      @quality_score = splitted[3]
+    else
+      e "No file exists at #{sfile(i)}."
+    end
+  end
+
+  # ========================================================================= #
+  # === report_the_quality_score
+  # ========================================================================= #
+  def report_the_quality_score
+    erev ('Quality score: ').ljust(@ljust_value)+
+         slateblue(@quality_score)
+  end
+
+  # ========================================================================= #
+  # === report_the_sequence
+  # ========================================================================= #
+  def report_the_sequence
+    erev ('Sequence: ').ljust(@ljust_value)+
+         lightblue(@sequence+' # '+@sequence.size.to_s+' nucleotides')
+  end
+
+  # ========================================================================= #
+  # === report_the_header
+  # ========================================================================= #
+  def report_the_header
+    erev ('Header: ').ljust(@ljust_value)+
+         orange(@header)
+  end
+
+  # ========================================================================= #
+  # === report_result                                            (report tag)
+  # ========================================================================= #
+  def report_result
+    if @sequence
+      report_the_header
+      report_the_sequence
+      report_the_quality_score
+    end
+  end; alias report report_result # === report
+
+  # ========================================================================= #
+  # === run                                                         (run tag)
+  # ========================================================================= #
+  def run
+    parse_input
+    report_result
+  end
+
+  # ========================================================================= #
+  # === Bioroebe::FastqFormatExplainer[]
+  # ========================================================================= #
+  def self.[](i = '')
+    new(i)
+  end
+
+end; end
+
+if __FILE__ == $PROGRAM_NAME
+  Bioroebe::FastqFormatExplainer.new(ARGV)
+end # fastqformatexplainer fastq_example_file.fastq