bioroebe 0.10.80

data/lib/bioroebe/shell/show_report_and_display.rb

@@ -0,0 +1,2901 @@
+#!/usr/bin/ruby -w
+# Encoding: UTF-8
+# frozen_string_literal: true
+# =========================================================================== #
+# require 'bioroebe/shell/show_report_and_display.rb'
+# =========================================================================== #
+module Bioroebe
+
+class Shell < ::Bioroebe::CommandlineApplication
+
+  require 'bioroebe/shell/search.rb'
+  require 'bioroebe/codons/show_codon_usage.rb'
+  require 'bioroebe/codons/show_this_codon_table.rb'
+  require 'bioroebe/count/count_amount_of_aminoacids.rb'
+
+  # ========================================================================= #
+  # === report_main_sequence
+  #
+  # We will call dna_with_ends() here in this method. The argument colourize will
+  # determine whether we will colourize the DNA strand or not.
+  #
+  # Invocation examples:
+  #
+  #    report_main_sequence(::Bioroebe.start_codon?)
+  #    report_main_sequence(:start_codon) # ← is the same as the ^^^ above
+  #    report_main_sequence(:stop_codon)  # ← Colourize the stop-codons.
+  #
+  # ========================================================================= #
+  def report_main_sequence(
+      colourize = nil,
+      input     = dna_sequence_as_string?
+    )
+    case colourize
+    # ======================================================================= #
+    # === :stop_codon
+    #
+    # We attempt to colourize the stop-codons via this method.
+    # ======================================================================= #
+    when :stop_codon
+      colourize = stop_codons?
+    # ======================================================================= #
+    # === :stop_codon_in_frame1
+    # ======================================================================= #
+    when :stop_codon_in_frame1
+      new_string = remove_trailing_escape_code(
+        colour_for_nucleotides(
+          ''.dup
+        ).dup
+      ).dup
+      scanned = input.scan(/.../)
+      scanned.each {|codon|
+        if is_a_stop_codon? codon
+          new_string << colour_for_stop_codon(codon.dup).dup+
+                        remove_trailing_escape_code(
+                          colour_for_nucleotides
+                        )
+        else
+          new_string << codon.dup
+        end
+      }
+      e padding?+
+        rev+
+        leading_five_prime+
+        new_string+
+        rev+
+        trailing_three_prime
+      return
+    # ======================================================================= #
+    # === :start_codon
+    # ======================================================================= #
+    when :start_codon # Instruction to use a start codon here.
+      colourize = start_codon?
+    # ======================================================================= #
+    # === :start_and_stop_codon
+    # ======================================================================= #
+    when :start_and_stop_codon
+      colourize = [start_codon?, stop_codons?]
+    end
+    # ======================================================================= #
+    # The old code was:
+    #   erev padding?+
+    #        dna_with_ends(input, colourize) { :honour_coding_area_if_it_exists } # The dna_with_ends() method can deal with Arrays.
+    # This is now mostly ported (April 2020), but the :honour_coding_area_if_it_exists
+    # is not yet ported, so the above code will remain as-is, for the time
+    # being.
+    # ======================================================================= #
+    show_nucleotide_sequence?.report_this_sequence(input) {{
+      padding_to_use: padding?,
+      colourize_this_subsequence: colourize
+    }}
+  end; alias show_main_string         report_main_sequence # === show_main_string
+       alias show_main_sequence       report_main_sequence # === show_main_sequence
+       alias show_colourized_sequence report_main_sequence # === show_colourized_sequence
+       alias show_dna_sequence        report_main_sequence # === show_dna_sequence
+
+  # ========================================================================= #
+  # === show_composition
+  #
+  # This method will analyse the DNA string composition.
+  #
+  # Invocation example:
+  #
+  #   scompo
+  #
+  # ========================================================================= #
+  def show_composition(
+      i = dna_string?
+    )
+    length = i.size
+    report_size_of_main_string
+    hash = ::Bioroebe::CountAmountOfNucleotides.show_composition(i) # bl count_nucleotides
+    erev 'Showing how many of the '+steelblue('four nucleotides')+rev+
+         ' are in that sequence (absolute numbers):'
+    print '  '
+    string = ''.dup
+    hash.each_pair {|nucleotide, n_times|
+      string << "#{nucleotide}: #{lightslategray(n_times.to_s)}#{rev}, "
+    }
+    e string.rstrip.chop # .chop() to get rid of the last ',' token.
+    erev "The respective frequencies derived from these absolute "\
+         "numbers, #{steelblue('in percent')}#{rev}"\
+         ", are:"
+    print '  '
+    hash.each_pair {|nucleotide, n_times|
+      percentage = (n_times.to_f * 100 / length).round(2).to_s
+      print "#{rev}#{nucleotide}: #{orange(percentage)}#{rev}% "
+    }; erev
+  end
+
+  # ========================================================================= #
+  # === show_codon_usage
+  #
+  # This shows the codon usage of the string.
+  # ========================================================================= #
+  def show_codon_usage(
+      i = dna_sequence_as_string?
+    )
+    if i.is_a? Array
+      if i.empty?
+        i = dna_sequence_as_string?
+      else
+        i = i.flatten.compact.join
+      end
+    end
+    ::Bioroebe::ShowCodonUsage.new(i)
+  end
+
+  # ========================================================================= #
+  # === show_all_codon_tables
+  #
+  # We used to tap into the Bio::CodonTable here for this part.
+  #
+  # But since some time, we no longer depend on this part - we
+  # have made available all of this in yaml files.
+  #
+  # The argument to this method can either be:
+  #
+  #   :everything
+  #   :only_names
+  #
+  # The first one is the default. This means that we will show everything.
+  #
+  # The second version is useful if you only what to report the names
+  # of the codon table in question. Several aliases exist for the
+  # second invocation.
+  # ========================================================================= #
+  def show_all_codon_tables(
+      show_what = :everything
+    )
+    unless Bioroebe.const_defined? :ShowCodonTables
+      require 'bioroebe/codons/show_codon_tables.rb'
+    end
+    e
+    ::Bioroebe::ShowCodonTables.new(show_what)
+    e
+  end
+
+  # ========================================================================= #
+  # === report_n_start_codons
+  #
+  # Use this method to count how many ATG codons we have. We will honour
+  # the default start_codon in use.
+  #
+  # The third argument determines which reading frame is to be used. By
+  # default, the method will use the first reading frame.
+  # ========================================================================= #
+  def report_n_start_codons(
+      this_string             = string?,
+      use_this_as_start_codon = ::Bioroebe.start_codon?, # Use the proper start codon.
+      in_which_frame          = :frame1
+    )
+    # ======================================================================= #
+    # === Handle blocks next
+    # ======================================================================= #
+    if block_given?
+      yielded = yield
+      case yielded
+      when /^frame/
+        in_which_frame = yielded.to_sym
+      end
+    end
+    # ======================================================================= #
+    # The following can be invoked via:
+    #   n_ORF? frame1
+    # ======================================================================= #
+    case in_which_frame
+    when :frame1
+      in_which_frame = 'frame 1'
+    when :frame2
+      in_which_frame = 'frame 2'
+    when :frame3
+      in_which_frame = 'frame 3'
+    end
+    n_start_codons = this_string.upcase.scan(/#{use_this_as_start_codon}/).size.to_s
+    # ======================================================================= #
+    # The above is not yet in the proper frame, though.
+    # ======================================================================= #
+    trailing_message = " Initiation Codons "\
+                       "(in #{orangered(in_which_frame)}#{rev})."
+    erev "Our main string has #{sfancy(n_start_codons)}#{rev}"\
+         " #{simp(use_this_as_start_codon)}#{rev} ("\
+         "#{use_this_as_start_codon.tr('T','U')})"+
+         trailing_message
+    if coding_area? # This has been user-supplied in that case.
+      erev 'However had, only the nucleotides from position'
+      erev "#{sfancy(coding_area?.to_s.split('..').first.to_s)}#{rev}"\
+           " to position #{sfancy(coding_area?.to_s.split('..').last.to_s)}"\
+           "#{rev} will be colourized."
+    end
+  end
+
+  # ========================================================================= #
+  # === show_human_genome_version
+  #
+  # Use this method to show the most current human genome version.
+  # ========================================================================= #
+  def show_human_genome_version
+    human_genome_version = '' # Default.
+    remote_URL = 'https://www.ensembl.org/Homo_sapiens/Info/Index'
+    dataset = URI.open(remote_url).read
+    use_this_regex = /Genome assembly: (.{1,11}\.p\d+) <small>/ # See: https://rubular.com/r/DD5FhaPs3b
+    scanned = dataset.scan(use_this_regex).flatten
+    human_genome_version = scanned.first.to_s
+    erev "The most current human genome version is: "\
+         "#{sfancy(human_genome_version)}"
+    erev "The URL that was used to query this has been: "\
+         "#{steelblue(remote_URL)}"
+  end
+
+  # ========================================================================= #
+  # === show_oligo_length_three
+  #
+  # We align in chunks of three and tell the user how often we can find
+  # these individual codons.
+  #
+  # Invocation example:
+  #
+  #   random 99; oligo_3
+  #
+  # ========================================================================= #
+  def show_oligo_length_three(
+      sequence = dna_sequence_object?
+    )
+    sequence = sequence.upcase # This is the sequence that will be scanned.
+    dna = ::Bioroebe.dna? # This is equal to A, T, C and G.
+    erev 'We will align the nucleotides in chunks of 3 and show their '\
+         'frequency.'
+    dna.each {|first_entry| # First nucleotide.
+      dna.each {|second_entry| # Second nucleotide.
+        dna.each {|third_entry| # Third nucleotide.
+          _ = first_entry+second_entry+third_entry
+          erev _+' '+sequence.scan(_).size.to_s
+        }
+      }
+    }
+  end
+
+  # ========================================================================= #
+  # === show_oligo_length_two
+  #
+  # Show all oligo of length two.
+  # ========================================================================= #
+  def show_oligo_length_two(
+      string = string?
+    )
+    sequence = string.upcase # Shorter copy and always upcased.
+    dna = ::Bioroebe.dna?
+    dna.each {|first_entry|
+      dna.each {|second_entry|
+        _ = "#{first_entry}#{second_entry}"
+        erev _+' '+sequence.scan(_).size.to_s
+      }
+    }
+  end
+
+  # ========================================================================= #
+  # === show_position_for_the_main_sequence
+  # ========================================================================= #
+  def show_position_for_the_main_sequence
+    array = sequence?.scan(/.{,25}/)
+    index_position = 1
+    array.each {|entry|
+      unless entry.empty?
+        erev entry.split(//).join('   ')
+        second_line = ''
+        start = index_position
+        index_position += entry.size
+        start.upto(index_position-1) {|position|
+          second_line << position.to_s.ljust(4)
+        }
+        erev cadetblue(second_line)+rev
+        e
+      end
+    }
+  end
+
+  # ========================================================================= #
+  # === report_this_input_was_not_found
+  #
+  # This method is used to notify the user that a certain input was
+  # not found.
+  # ========================================================================= #
+  def report_this_input_was_not_found(
+      i = ''
+    )
+    unless i.empty?
+      erev "Input `#{sfancy(i.to_s)}#{rev}` was not "\
+           "found to be a valid input for the BioShell."
+    end
+  end
+
+  # ========================================================================= #
+  # === show_local_sequences
+  #
+  # This method will show the available local sequences.
+  # ========================================================================= #
+  def show_local_sequences
+    possible_matches = return_fasta_files_in_the_log_directory
+    if possible_matches.empty?
+      erev 'No local fasta sequences could be found.'
+    else
+      e
+      erev 'The following local sequences were found in '\
+           'the main log'
+      erev 'directory ('+sdir(log_dir?)+rev+').'
+      e
+      possible_matches.each_with_index {|entry, index|
+        index += 1
+        _ = possible_matches.size.to_s.size
+        erev padding?+'('+index.to_s.rjust(_)+') '+rev+
+             sfile(File.basename(entry))+rev
+      }; e
+    end
+  end
+
+  # ========================================================================= #
+  # === show_nucleotide_sequence?
+  # ========================================================================= #
+  def show_nucleotide_sequence?
+    @internal_hash[:show_nucleotide_sequence]
+  end; alias display_nucleotide_object? show_nucleotide_sequence? # === display_nucleotide_object?
+
+  # ========================================================================= #
+  # === show_sequence_with_a_ruler
+  #
+  # This will show the main sequence together with a "ruler" on top.
+  #
+  # The first argument specifies how many nucleotides are to be displayed
+  # per given line.
+  #
+  # This method can also be called in this way:
+  #
+  #   show_sequence_with_a_ruler { :without_colours }
+  #
+  # This will skip showing the ruler.
+  # ========================================================================= #
+  def show_sequence_with_a_ruler(
+      group_together_n_nucleotides = :default,
+      use_this_sequence            = main_sequence?
+    )
+    if group_together_n_nucleotides.is_a?(Array)
+      group_together_n_nucleotides = group_together_n_nucleotides.first
+      if group_together_n_nucleotides.nil? or group_together_n_nucleotides.empty?
+        group_together_n_nucleotides = :default
+      end
+    end
+    case group_together_n_nucleotides
+    # ======================================================================= #
+    # === :default
+    # ======================================================================= #
+    when :default,
+         nil
+      group_together_n_nucleotides = 70
+    end
+    if group_together_n_nucleotides.is_a? String
+      # ===================================================================== #
+      # We need an Integer here.
+      # ===================================================================== #
+      group_together_n_nucleotides = group_together_n_nucleotides.to_i
+    end
+    e
+    e "Displaying the main sequence (length: #{use_this_sequence.to_s.size}) "\
+      "in a chunk of #{slateblue(group_together_n_nucleotides.to_s)}#{rev}"\
+      " nucleotides/\naminoacids next."
+    e
+    use_this_sequence = use_this_sequence.to_s
+    chunks = use_this_sequence.split(/(.{#{group_together_n_nucleotides}})/).reject(&:empty?)
+    array = chunks.each_slice(group_together_n_nucleotides).to_a.flatten #.join.split("\n")
+    use_this_ruler_type = :show_ruler # Note that :show_ruler is the default.
+    # ======================================================================= #
+    # === Handle blocks given next
+    # ======================================================================= #
+    if block_given?
+      yielded = yield
+      case yielded
+      # ===================================================================== #
+      # === :without_colours
+      # ===================================================================== #
+      when :without_colours
+        use_this_ruler_type = :without_colours
+      end
+    end
+    array.each {|sequence|
+      show_nucleotide_sequence?.display_with_prior_formatting(sequence) {
+        use_this_ruler_type
+      }
+      e
+    }
+  end
+
+  # ========================================================================= #
+  # === dna_with_ends
+  #
+  # Display DNA with proper ends.
+  #
+  # The first argument should be the string that we will colourize.
+  #
+  # If the second argument is given (`optional_colourize`), then this
+  # method will colourize the sequence at certain positions. This
+  # can be useful to display, for instance, restriction-sites.
+  # ========================================================================= #
+  def dna_with_ends(
+      i                    = dna_sequence_as_string?,
+      optional_colourize   = nil,
+      colourize_everything = true
+    )
+    i.upcase! if config?.respond_to?(:upcase_nucleotides) and config?.upcase_nucleotides
+    if optional_colourize.is_a? String
+      optional_colourize = [optional_colourize]
+    end
+    if block_given?
+      yielded = yield
+      case yielded
+      # ===================================================================== #
+      # === :honour_coding_area_if_it_exists
+      # ===================================================================== #
+      when :honour_coding_area_if_it_exists
+        if optional_colourize and @internal_hash[:coding_area]
+          # ================================================================= #
+          # We will colourize based on the coding area that was designated.
+          # ================================================================= #
+          _ = @internal_hash[:coding_area]
+          # ================================================================= #
+          # We deduct 1 because ruby Arrays start at 0.
+          # ================================================================= #
+          start_position = _.split('..').first.to_i - 1
+          end_position   = _.split('..').last.to_i  - 1
+          internal_segment = i[start_position .. end_position]
+          use_this_as_return_string = ''
+          use_this_as_return_string << i[0..(start_position-1)]
+          optional_colourize.each {|inner_entry|
+            internal_segment.gsub!(inner_entry, yellow+inner_entry+rev)
+          }
+          use_this_as_return_string << internal_segment
+          use_this_as_return_string << i[(end_position+1) .. -1]
+          i = use_this_as_return_string
+        elsif optional_colourize
+          # ================================================================= #
+          # Apply all entries given in the Array.
+          # ================================================================= #
+          if optional_colourize.is_a? Array
+            optional_colourize.flatten.each {|inner_entry|
+              i.gsub!(
+                inner_entry, colour_for_stop_codon(inner_entry)+rev
+              ) # Colourize in yellow.
+            }
+          else
+            # =================================================================== #
+            # Make sure that we have a String past this point.
+            # =================================================================== #
+            optional_colourize = optional_colourize.to_s
+            if colourize_everything == true
+              i.gsub!(optional_colourize, colour_for_stop_codon(optional_colourize)+rev)
+            else
+              if colourize_everything == 1
+                i.sub!(optional_colourize, colour_for_stop_codon(optional_colourize)+rev)
+              end
+            end
+          end
+        end
+      end
+    else
+      i = "#{sfancy(i)}#{rev}"
+    end
+    # ======================================================================= #
+    # We will report the DNA sequence with leading 5' prime and
+    # trailing 3' prime.
+    # ======================================================================= #
+    return "#{leading_five_prime}#{i}#{trailing_three_prime}"
+  end
+
+  require 'bioroebe/toplevel_methods/matches.rb'
+  # ========================================================================= #
+  # === report_the_first_atg
+  #
+  # This method will simply report the first ATG codon.
+  # ========================================================================= #
+  def report_the_first_atg
+    dna_sequence = dna_sequence_object_as_string?
+    array_matches = ::Bioroebe.return_all_substring_matches(
+      dna_sequence, start_codon?
+    )
+    start_position = array_matches.first.first
+    erev 'The first ATG can be found at position '+
+          simp(start_position.to_s)+rev+'.'
+    erev 'We will next show the first 100 nucleotides, starting from this:'
+    report_five_prime_three_prime(
+      dna_sequence_object?[start_position-1,100]
+    )
+  end
+
+  # ========================================================================= #
+  # === show_aminoacid_sequence
+  #
+  # To show the aminoacid sequence, do:
+  #   show_aa
+  # ========================================================================= #
+  def show_aminoacid_sequence
+    erev padding?+
+         aminoacid_sequence? # aminoacids? # Will also use some padding.
+  end
+
+  # ========================================================================= #
+  # === show_dna_string                           (show string tag, show tag)
+  #
+  # Use this method to show the @sequence, or another string of your
+  # choosing, if you pass it to the method.
+  #
+  # You can also invoke this method with something like this:
+  #
+  #   show_string { :with_colourized_separator }
+  #
+  # This means that we will use '|' separators that are colourized.
+  # ========================================================================= #
+  def show_dna_string(
+      this_string              = dna_string?,
+      truncate_too_long_result = do_truncate?
+    )
+    result = rev.dup # This is the String that will be returned.
+    case truncate_too_long_result
+    when :do_not_truncate
+      truncate_too_long_result = false
+    end
+    truncate_at_n_elements = TRUNCATE_AT_N_ELEMENTS
+    if this_string.nil?
+      this_string = dna_string? if dna_string?
+    end
+    if this_string.to_s.empty?
+      report_that_a_string_must_be_assigned_first
+    else
+      # this_string.upcase! # Nope, do not upcase here. Use other methods to do so.
+      if mode? == :dna
+        if this_string.size > truncate_at_n_elements # Threshold for now.
+          if truncate_too_long_result or
+            (truncate_too_long_result == :do_not_truncate_and_do_not_show_leader_and_trailer)
+            this_string =
+              this_string[0, truncate_at_n_elements]+
+              swarn(' [TRUNCATED as the sequence '\
+              'is longer than '+truncate_at_n_elements.to_s+' nucleotides]')
+          end
+        end
+        # =================================================================== #
+        # Next, display the main string, without upcasing it.
+        # =================================================================== #
+        if block_given?
+          yielded = yield
+          case yielded
+          when :with_colourized_separator
+            _ = this_string.split(//)
+            str = ''.dup
+            _.each_with_index {|char, index|
+              str << char
+              str << paleturquoise('|')+sfancy if (index+1) % 3 == 0
+            }
+            this_string = str
+          end
+        end
+        if truncate_too_long_result == :do_not_truncate_and_do_not_show_leader_and_trailer
+        else
+          result << padding?+leading_5_prime
+        end
+        # =================================================================== #
+        # Next, add the DNA sequence to the result that will be displayed.
+        # =================================================================== #
+        result << colourize_dna_sequence(this_string)+rev
+        if truncate_too_long_result == :do_not_truncate_and_do_not_show_leader_and_trailer
+        else
+          result << trailing_3_prime
+        end
+        # =================================================================== #
+        # Delegate to class ShowNucleotideSequence next:
+        # =================================================================== #
+        display_nucleotide_sequence(this_string)
+      else # Else use the aminoacid mode.
+        show_aminoacid_sequence
+      end
+    end
+  end; alias show_main_string       show_dna_string # === show_main_string
+       alias report_sequence        show_dna_string # === report_sequence
+       alias show_sequence          show_dna_string # === show_sequence
+       alias show_main_dna_sequence show_dna_string # === show_main_dna_sequence
+       alias show_string            show_dna_string # === show_string
+
+  # ========================================================================= #
+  # === report_size_of_main_string
+  # ========================================================================= #
+  def report_size_of_main_string(
+      i              = dna_sequence_object?,
+      type_of_string = 'main ' # This is usually the main DNA string.
+    )
+    i = dna_sequence_object? if i.nil?
+    i = dna_sequence_object? if i.is_a?(Array) and i.empty?
+    erev 'The '+type_of_string+'string has '+sfancy(i.size.to_s)+
+         rev+' '+nucleotides_or_aminoacids?+'.'
+  end; alias report_length_of_the_dna_string report_size_of_main_string # === report_length_of_the_dna_string
+       alias report_size_of_this_sequence    report_size_of_main_string # === report_size_of_this_sequence
+
+  # ========================================================================= #
+  # === show_editor_in_use
+  # ========================================================================= #
+  def show_editor_in_use
+    e MAIN_EDITOR
+  end
+
+  # ========================================================================= #
+  # === show_welcome_message
+  #
+  # Show a little welcome message on startup. This can be disabled of
+  # course.
+  # ========================================================================= #
+  def show_welcome_message
+    unless silent_startup?
+      erev 'Welcome to the Bioroebe::Shell Version '+
+           sfancy(version?.to_s)+
+           rev+
+           ', last updated: '+
+           simp(::Bioroebe.last_updated?)+
+           rev+'.'
+      erev 'Type "'+sfancy('help')+rev+'" to get some help.'
+    end
+  end
+
+  # ========================================================================= #
+  # === show_the_weight_of_the_four_individual_nucleotides
+  # ========================================================================= #
+  def show_the_weight_of_the_four_individual_nucleotides
+    e
+    erev '  A: '+adenin?.rjust(10)+' '+
+          palevioletred(weight_of_adenin?)
+    erev '  T: '+thymin?.rjust(10)+' '+
+          palevioletred(weight_of_thymin?)
+    erev '  C: '+cytosin?.rjust(10)+' '+
+          palevioletred(weight_of_cytosin?)
+    erev '  G: '+guanin?.rjust(10)+' '+
+          palevioletred(weight_of_guanin?)
+    e
+  end
+
+  # ========================================================================= #
+  # === show_this_subsequence
+  #
+  # Sometimes we want to show a subsequence. This method helps us to do
+  # so, too.
+  #
+  # The input may be "tainted", e. g. be a String like "12,345" or
+  # "12.345", so this method will have to eliminate the ',' and '.'
+  # characters as well, before converting this String into an
+  # Integer. (It must be an Integer because nucleotide counting
+  # can logically not be a Float.)
+  #
+  # Usage example:
+  #
+  #   random 99; [22..33]
+  #
+  # ========================================================================= #
+  def show_this_subsequence(
+      start_position        =  1,
+      end_position          = 10,
+      work_on_this_sequence = dna_sequence_object?
+    )
+    start_position = start_position.to_s.delete(',.').to_i
+    end_position   = end_position.to_s.delete(',.').to_i
+    if start_position < 1
+      erev 'The minimum for the start-position must be 1, so this'
+      erev 'is now treated as one rather than '+start_position.to_s+'.'
+      start_position = 1
+    end
+    if end_position > work_on_this_sequence.size
+      erev 'The sequence is '+slateblue('too long')+rev+' ('+
+           crimson('end_position')+rev+' is '\
+           'at '+sfancy(end_position.to_s)+rev+', '+
+           nucleotides_or_aminoacids?.to_s+' sequence length '\
+           'was: '+sfancy(work_on_this_sequence.size.to_s)+
+           rev+').'
+      erev 'It will be limited next to '+
+           sfancy(work_on_this_sequence.size.to_s)+rev+' in length.'
+      end_position = work_on_this_sequence.size
+    end
+    sequence = work_on_this_sequence.start_end(
+      start_position,
+      end_position
+    )
+    if sequence
+      size = sequence.size.to_s
+      nucleotides_or_aminoacids_or_empty = ''
+      if work_on_this_sequence.respond_to? :nucleotides_or_aminoacids?
+        nucleotides_or_aminoacids_or_empty = work_on_this_sequence.nucleotides_or_aminoacids?.to_s
+      end
+      erev 'Next showing a subsequence, '+
+           nucleotides_or_aminoacids_or_empty+' '+
+           olive(start_position.to_s)+rev+' to '+
+           olive(end_position.to_s)+rev+
+           ' (including '+olive(start_position.to_s)+
+           rev+' and '+olive(end_position.to_s)+rev+').'
+      erev 'The length of the fragment will be '+
+           simp(size)+rev+
+           ' '+
+           nucleotides_or_aminoacids_or_empty+
+           '.'
+      report_this_dna_sequence_with_proper_trailer_and_leader(sequence) { :try_to_colourize_start_codon }
+    else
+      erev 'This subsequence appears to be invalid '\
+           '(start: '+start_position.to_s+', end: '+end_position.to_s+')'
+    end
+  end
+
+  # ========================================================================= #
+  # === report_where_the_home_directory_can_be_found
+  # ========================================================================= #
+  def report_where_the_home_directory_can_be_found(
+      i = log_dir?
+    )
+    erev 'The "home" directory (actually called the log directory) '\
+         'can be found here:'
+    e
+    e "  #{sdir(i)}"
+    e
+  end
+
+  # ========================================================================= #
+  # === show_double_strand
+  # ========================================================================= #
+  def show_both_dna_strands
+    show_main_sequence
+    show_complement(string?, :include_prime_ends)
+  end; alias show_double_strand show_both_dna_strands # === show_double_strand
+
+  # ========================================================================= #
+  # === show_codon_piped_sequence
+  # ========================================================================= #
+  def show_codon_piped_sequence
+    # _ = dna_sequence_object?.gsub(/(...)/, "\\1|") # Add | at every third position.
+    # erev rev+padding?+leading_5_prime+sfancy(_)+rev+trailing_3_prime
+    display_nucleotide_sequence(:default) { :piped }
+  end
+
+  # ========================================================================= #
+  # === show                                                       (show tag)
+  #
+  # Bundle together some show-related methods.
+  # ========================================================================= #
+  def show(i)
+    i = i.join(' ').strip if i.is_a? Array
+    case i
+    when 'codon_table','codon','codon table'
+      show_codon_table
+    when 'blosum','blosum matrix','blosum_matrix'
+      show_blosum_matrix
+    when '',nil # Empty or nil.
+      show_dna_string
+    end
+  end
+
+  # ========================================================================= #
+  # === display_nucleotide_sequence
+  #
+  # Consistently use this method whenever you wish to display a
+  # nucleotide sequence.
+  # ========================================================================= #
+  def display_nucleotide_sequence(
+      this_sequence = dna_sequence_object?,
+      &block
+    )
+    case this_sequence
+    when :default
+      this_sequence = dna_sequence_object?
+    end
+    do_show_piped_output = false
+    if block_given?
+      yielded = yield
+      case yielded
+      when :piped,
+           :show_piped
+        do_show_piped_output = true
+      end
+    end
+    hash = {
+      padding_to_use:    padding?,
+      show_piped_output: do_show_piped_output
+    }
+    show_nucleotide_sequence?.report_this_sequence(this_sequence) { hash }
+  end; alias display_this_nucleotide_sequence display_nucleotide_sequence # === display_this_nucleotide_sequence
+       alias display_this_sequence            display_nucleotide_sequence # === display_this_sequence
+       alias show_this_sequence               display_nucleotide_sequence # === show_this_sequence
+
+  # ========================================================================= #
+  # === report_how_many_aminoacids_we_have
+  #
+  # This method will report how many aminoacids we have assigned.
+  # ========================================================================= #
+  def report_how_many_aminoacids_we_have
+    if aminoacids?
+      n_aminoacids = aminoacids?.size
+    else
+      n_aminoacids = dna_sequence_object?.size / 3.0
+    end
+    n_aminoacids = n_aminoacids.to_i
+    erev "This sequence has #{simp(n_aminoacids.to_s)}#{rev} aminoacids."
+  end
+
+  # ========================================================================= #
+  # === show_chromosome_table
+  # ========================================================================= #
+  def show_chromosome_table
+    lpadding_to_use = 16
+    erev 'Chromosome Table from file '+sfile(FILE_CHROMOSOME_NUMBERS)+rev
+    if File.exist? FILE_CHROMOSOME_NUMBERS
+      dataset = YAML.load_file(FILE_CHROMOSOME_NUMBERS)
+      e
+      dataset.each_pair {|key, value|
+        erev "  "+key.ljust(lpadding_to_use)+
+             ' '+
+             steelblue(value.to_s.rjust(3))
+      }
+      e
+    else
+      no_file_exists_at(FILE_CHROMOSOME_NUMBERS)
+    end
+  end
+
+  # ========================================================================= #
+  # === report_everything_about_this_amino_acid
+  #
+  # Use this method to report everything about any particular amino acid.
+  # ========================================================================= #
+  def report_everything_about_this_amino_acid(i)
+    if i.is_a? Array
+      i.each {|entry| report_everything_about_this_amino_acid(entry) }
+    else
+      i.delete!('?') if i.include? '?'
+      erev 'It seems as is we did find an Amino Acid ('+simp(i)+rev+
+           '). Its characteristic residue (R) is:'+N+N
+      unless AMINO_ACIDS_RESTE.has_key?(i)
+        # =================================================================== #
+        # This here is to map german names, such as "glycin",
+        # onto "glycine", the corresponding english name.
+        # =================================================================== #
+        if AMINO_ACIDS_LONG_NAME_TO_ONE_LETTER.has_key?(i)
+          i = AMINO_ACIDS_LONG_NAME_TO_ONE_LETTER[i]
+          i = AMINO_ACIDS_ENGLISH[i].downcase
+        end
+      end
+      residue = AMINO_ACIDS_RESTE[i.downcase].to_s
+      efancy "  #{residue}#{N}"
+      erev 'The codons coding for the aminoacid '+simp(i)+rev+' are:'
+      e
+      e '  '+mediumturquoise(
+          ::Bioroebe::PossibleCodonsForThisAminoacid.new(i).pretty_result
+        )
+      e
+      molecular_mass_of(i, 2) # The 2 says to round to 2 digit.
+    end
+  end
+
+  # ========================================================================= #
+  # === report_five_prime_three_prime
+  # ========================================================================= #
+  def report_five_prime_three_prime(i)
+    erev dna_with_ends(i)
+  end
+
+  # ========================================================================= #
+  # === show_startup_information
+  #
+  # This method here will usually be shown only once, on an initial startup
+  # of the Bioroebe::Shell. Afterwards, it will no longer be shown at all.
+  #
+  # Note that showing this can be disabled.
+  # ========================================================================= #
+  def show_startup_information
+    e
+    erev "This seems to be the first time that you are using the "\
+         "#{olivedrab('Bioroebe::Shell')}#{rev}, at the least on"
+    erev 'this computer.'
+    e
+    erev 'It is recommended to have a look at the following components first:'
+    e
+    efancy '   help'
+    efancy '   random'
+    efancy '   assign'
+    efancy '   complement'
+    e
+    erev 'If you want to show this intro-menu again, do:'
+    e
+    efancy '  show-intro'
+    e
+    erev 'You can also see more documentation at:'
+    e
+    e "  #{slateblue(URL_TO_THE_DOCUMENTATION)}"
+    e
+    erev 'If you feel that something is missing or incorrect, feel '\
+         'free to send an email to:'
+    e
+    efancy "  #{EMAIL}"
+    e
+  end
+
+  require 'bioroebe/colours/colourize_sequence.rb'
+  # ========================================================================= #
+  # === report_colourized_sequence
+  #
+  # This method will use the new class ColourizeSequence, rather than
+  # the old internal way.
+  #
+  # In the long run, it may be best to transition all of the Bioroebe::Shell
+  # into the new class - but for now, we will use a hybrid system.
+  #
+  # To invoke this method, try:
+  #
+  #   start_and_stop?
+  #
+  # ========================================================================= #
+  def report_colourized_sequence(
+      colourize_what = :start_and_stop_codon
+    )
+    _ = ColourizeSequence.return_sequence(dna_sequence_object?) { colourize_what }
+    show_nucleotide_sequence?.display(_)
+    e
+  end
+
+  # ========================================================================= #
+  # === show_complement
+  #
+  # If the second argument is true, we pad via 5' and 3'.
+  #
+  # As of Feb 2015, we will try with leading padding as well.
+  # ========================================================================= #
+  def show_complement(
+      i                       = dna_string?,
+      also_include_prime_ends = false
+    )
+    case also_include_prime_ends
+    # ======================================================================= #
+    # === :show_leading_primes
+    # ======================================================================= #
+    when :show_leading_primes,
+         :include_prime_ends
+      also_include_prime_ends = true
+    end
+    i = dna_string? if i.nil?
+    i = i.join('') if i.is_a? Array
+    if also_include_prime_ends
+      erev padding?+rev+
+           leading_3_prime+
+           sfancy(complement(i))+
+           rev+trailing_5_prime
+    else
+      erev complement(i)
+    end
+  end
+
+  # ========================================================================= #
+  # === show_position_of_sequence
+  #
+  # This currently works only for Amino Acids - at the least I have tested
+  # it only on aminoacids so far, and not on DNA/RNA.
+  # ========================================================================= #
+  def show_position_of_sequence(
+      i          = aa_sequence?,
+      chunk_size = 10 # How many chunks to display per row.
+    )
+    array = i.chars
+    _ = '' # The Display-String.
+    index_string = ''
+    0.upto(array.size) {|index|
+      _ << array[index].to_s.rjust(2)+' '
+      unless array.size == index
+        index_string << palevioletred((index+1).to_s.rjust(2)+' ')
+      end
+      if index % chunk_size == (chunk_size - 1)
+        _ << N
+        _ << index_string << rev << N << N
+        index_string = ''
+      end
+    }
+    erev _ # Report it finally.
+    erev index_string
+  end
+
+  # ========================================================================= #
+  # === show_alu_sequence
+  #
+  # Invoke this method by doing something like:
+  #
+  #   alu_sequence?
+  #
+  # ========================================================================= #
+  def show_alu_sequence
+    fasta_dataset = ::Bioroebe.parse_fasta(FILE_ALU_ELEMENTS)
+    _ = fasta_dataset.fasta_sequence
+    erev 'The ALU sequence in humans may be this (length: '+
+          sfancy(_.size.to_s)+rev+'):'
+    erev'  '+simp(_)
+  end
+
+  # ========================================================================= #
+  # === show_possible_codons_for_this_aminoacid
+  # ========================================================================= #
+  def show_possible_codons_for_this_aminoacid(i)
+    possible_codons = PossibleCodonsForThisAminoacid[i,
+      :use_only_the_four_standard_nucleotide_letters]
+    @array_aminoacid_sequence << possible_codons
+    return possible_codons
+  end
+
+  # ========================================================================= #
+  # === show_date
+  # ========================================================================= #
+  def show_date
+    erev Time.now.strftime('%d.%m.%Y')
+  end
+
+  # ========================================================================= #
+  # === show_taxid
+  #
+  # This method will show the particular TaxID, using the NCBI taxonomy
+  # database.
+  #
+  # The tax-id 9606 is "Homo sapiens".
+  # ========================================================================= #
+  def show_taxid(id = 9606)
+    id = 9606 if id.nil?
+    id = id.to_s
+    url = 'http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id='+id+'&lvl=0'
+    erev 'The remote URL is: '+sfancy(url)
+    webpage = open(url).read
+    regex = /^<table width="100%"><tr><td valign="top"><h2>(Homo sapiens)<\/h2>/ # See: http://rubular.com/r/aQK5O8ZfGa
+    webpage =~ regex
+    name_of_the_organism = $1.to_s.dup
+    erev 'The TaxID of '+simp(id)+rev+' corresponds to `'+
+          sfancy(name_of_the_organism)+rev+'`.'
+  end
+
+  # ========================================================================= #
+  # === show_nucleotides_table
+  #
+  # Use this method to show the nucleotides table - their formula and
+  # the molecular mass.
+  # ========================================================================= #
+  def show_nucleotides_table
+    array_display_these = %w(
+      Adenin Cytosin Guanin Thymin
+    )
+    # ======================================================================= #
+    # Grab the nucleotides.yml dataset next
+    # ======================================================================= #
+    dataset = YAML.load_file(FILE_NUCLEOTIDES)
+    dataset.each_pair {|key, chemical_formula|
+      if array_display_these.include? key # Display it in this case.
+        molmasse = ChemistryParadise::CalculateAtomicMass.new(chemical_formula, :do_not_report).masse?
+        molmasse = molmasse.to_f.round(2)
+        e key.to_s.ljust(8)+' -> '+chemical_formula.to_s.rjust(8)+
+          rev+' (Molecular mass: '+simp(molmasse.to_s)+')'+rev
+      end
+    }
+  end
+
+  # ========================================================================= #
+  # === show_ori_sequences
+  #
+  # The DnaA box is: TTATC[CA]A[CA]A
+  # ========================================================================= #
+  def show_ori_sequences
+    erev 'The DnaA box has this consensus sequence: '+
+          sfancy("5'-TTATC[CA]A[CA]A-3'")
+    _ = 'TTATCCACA'
+    erev 'Searching for '+_
+    try_to_find_restriction_enzymes_for(_)
+    _ = 'TTATCAAAA'
+    erev 'Searching for '+_
+    try_to_find_restriction_enzymes_for(_)
+  end
+
+  # ========================================================================= #
+  # === show_segments
+  #
+  # This method will show the DNA segments via a R-compatible way.
+  #
+  # Usage example:
+  #
+  #   set AAAATGCAGTAACCCATGCCC; show_segments
+  #
+  # ========================================================================= #
+  def show_segments
+    array = ::Bioroebe.scan_this_input_for_startcodons(dna_sequence_object?)
+    erev '         start end width'
+    array.each_with_index {|inner_array, index|
+      index += 1
+      start_position = inner_array.first
+      codon          = inner_array.last.first
+      erev '  ['+index.to_s+']  '+start_position.to_s.rjust(5)+' '+
+            (start_position+2).to_s.rjust(5)+' '+'3'.rjust(4)+' ['+codon.downcase+']'
+    }
+  end
+
+  require 'bioroebe/toplevel_methods/aminoacids_and_proteins.rb'
+  # ========================================================================= #
+  # === show_possible_phosphorylation_sites
+  #
+  # This method will find all possible phosphorylation sites in any
+  # given target sequence. It will also identify the aminoacids that
+  # can be phosphorylated.
+  #
+  # To test this, try:
+  #
+  #   random 250; P?
+  #
+  # ========================================================================= #
+  def show_possible_phosphorylation_sites(i = aminoacid_sequence?)
+    _ = dna_sequence_object?
+    array_all_codons = []
+    array_all_codons << ::Bioroebe.codons_for?(:serine)
+    array_all_codons << ::Bioroebe.codons_for?(:tyrosine)
+    array_all_codons << ::Bioroebe.codons_for?(:threonine)
+    array_all_codons.flatten!
+    # ======================================================================= #
+    # === Convert Y into Purine/Pyrimidine next
+    # ======================================================================= #
+    if array_all_codons.any? {|entry| entry.end_with? 'Y' }
+      array_all_codons.map! {|inner_entry|
+        if inner_entry.end_with? 'Y'
+          inner_entry = [
+            inner_entry.sub(/Y$/,'T'),
+            inner_entry.sub(/Y$/,'C')
+          ]
+        end
+        inner_entry
+      }
+      array_all_codons.flatten!
+    end
+    all_codons_found_in_the_sequence = []
+    n_phosphorylation_sites = 0
+    n_phosphorylation_sites = 
+      array_all_codons.map {|entry|
+        if _.scan(/#{entry}/).size > 0
+          all_codons_found_in_the_sequence << entry
+        end
+        _.scan(/#{entry}/).size  }.inject(0){|sum, inner_element| sum + inner_element
+      }
+    all_codons_found_in_the_sequence.uniq!
+    singular_or_plural = 'site'
+    if n_phosphorylation_sites < 1
+      singular_or_plural << 's'
+    end
+    erev 'In this sequence, we have found '+simp(n_phosphorylation_sites.to_s)+rev+
+         ' possible phosphorylation '+singular_or_plural+', using all '\
+         '3 possible frames.'
+    e
+    erev 'In particular, these '+all_codons_found_in_the_sequence.size.to_s+
+         ' different codons were found: '
+    e
+    erev '  '+simp(all_codons_found_in_the_sequence.join('/'))+rev
+    e
+    erev 'For the first frame, the start positions are these:'
+    e
+    # ======================================================================= #
+    # === Find the start positions for frame 1 next
+    # ======================================================================= #
+    array_start_positions_for_frame_1 = []
+    scanned_result = _.scan(/.../)
+    scanned_result.each_with_index {|codon, index|
+      if all_codons_found_in_the_sequence.include? codon
+        array_start_positions_for_frame_1 << (index * 3)+1
+      end
+    }
+    erev '  DNA:     '+simp(array_start_positions_for_frame_1.join('/'))+rev
+    erev '  Protein: '+simp(array_start_positions_for_frame_1.map {|entry|
+      entry = entry.to_i * 3
+      entry.to_s
+    }.join('/'))+rev
+    # ======================================================================= #
+    # Now modify the DNA sequence there but only in the first frame.
+    # ======================================================================= #
+    new_colourized_dna_sequence = ''
+    all_triplets = _.scan(/.../)
+    all_triplets.each {|codon|
+      codon = swarn(codon) if all_codons_found_in_the_sequence.include? codon
+      new_colourized_dna_sequence << codon+rev
+    }
+    e
+    erev 'The DNA sequence with possible phosphorylation sites is:'
+    e
+    erev left_padding?+leading_five_prime+new_colourized_dna_sequence+trailing_three_prime
+    e
+    erev 'The Aminoacid sequence with possible phosphorylation sites is:'
+    e
+    erev '  '+
+         ::Bioroebe.colourize_aa(i, ARRAY_AMINOACIDS_THAT_CAN_BE_PHOSPHORYLATED).to_s
+    e
+  end
+
+  # ========================================================================= #
+  # === show_molweight
+  # ========================================================================= #
+  def show_molweight(use_cliner = true)
+    cliner if use_cliner
+    MolecularWeightOfNucleotides.weights.each_with_index {|entry, index|
+      case index
+      when 0
+        erev 'Adenine:  '+sfancy(entry.to_s)+rev
+      when 1
+        erev 'Thymine:  '+sfancy(entry.to_s)+rev
+      when 2
+        erev 'Guanine:  '+sfancy(entry.to_s)+rev
+      when 3
+        erev 'Cytosine: '+sfancy(entry.to_s)+rev
+      end
+    }; cliner if use_cliner
+  end
+
+  # ========================================================================= #
+  # === show_weight_of_this_nucleotide
+  #
+  # Use this method to show the total weight of a specific nucleotide.
+  #
+  # Usage examples:
+  #
+  #   weight? U
+  #   weight? T
+  #   weight? Adenine
+  #
+  # ========================================================================= #
+  def show_weight_of_this_nucleotide(i)
+    i = i.to_s
+    if i.empty?
+      erev 'Please supply a nucleotide, such as "Adenine" or "A".'
+      erev 'Note that the short variant is preferred.'
+      return
+    end
+    i = i[0,1] if i.size > 1
+    _ = FILE_NUCLEOTIDES_WEIGHT # bl /Users/x/DATA/SCIENCE/YAML/nucleotides_weight.yml
+    if File.exist?(_)
+      _ = YAML.load_file(_)
+      dataset = {}
+      _.each_pair {|key, value|
+        dataset[key[0,1]] = value
+      }
+      if dataset.has_key?(i)
+        erev 'The weight of '+sfancy(i)+rev+' is: '+
+          sfancy(
+            ChemistryParadise.atomic_mass_of(dataset[i])
+          )
+      else
+        erev 'The key `'+sfancy(i)+rev+'` was not found.'
+      end
+    else
+      ewarn 'We did not find a required file at '+sfile(_)+rev+'.'
+    end
+  end
+
+  # ========================================================================= #
+  # === show_todo_file
+  # ========================================================================= #
+  def show_todo_file
+    cat '$RUBY_SRC/bioroebe/doc/TODO_FOR_THE_BIOROEBE_PROJECT.md'
+  end
+
+  # ========================================================================= #
+  # === report_where_the_pdf_tutorial_can_be_found
+  #
+  # Do notify the user where to find the .pdf tutorial.
+  # ========================================================================= #
+  def report_where_the_pdf_tutorial_can_be_found
+    _ = File.basename(FILE_BIOROEBE_TUTORIAL)
+    erev 'You can find the tutorial here:'
+    e
+    erev '  '+simp('http://shevegen.square7.ch/'+_)+rev
+    e
+  end
+
+  # ========================================================================= #
+  # === show_directory_content
+  # ========================================================================= #
+  def show_directory_content(of_this_dir = '*')
+    of_this_dir.prepend '*' unless of_this_dir.include? '*'
+    cliner {
+      Dir[of_this_dir].sort.each_with_index {|entry, index|
+        index += 1
+        entry << '/' if File.directory?(entry)
+        erev index.to_s.rjust(2)+') '+entry
+      }
+    }
+  end
+
+  require 'bioroebe/protein_structure/alpha_helix.rb'
+  # ========================================================================= #
+  # === show_length_of_alpha_helix
+  # ========================================================================= #
+  def show_length_of_alpha_helix(i)
+    erev ::Bioroebe::AlphaHelix.length?(i)
+  end
+
+  # ========================================================================= #
+  # === show_and_calculate_weight_of_dna_string
+  # ========================================================================= #
+  def show_and_calculate_weight_of_dna_string(
+      i = dna_sequence_object?
+    )
+    i = dna_sequence_object? if i.nil?
+    i = dna_sequence_object? if is_a? Array and i.empty?
+    sum = 0
+    i.upcase.chars.each {|nucleotide|
+      _ = case nucleotide
+      when 'A'
+        weight_of_adenin?
+      when 'T'
+        weight_of_thymin?
+      when 'C'
+        weight_of_cytosin?
+      when 'G'
+        weight_of_guanin?
+      end
+      sum += _.to_f
+    }
+    # ======================================================================= #
+    # Round the sum properly here.
+    # ======================================================================= #
+    sum = sum.round(2)
+    erev 'The weight of this nucleotide sequence is: '+
+          simp(sum.to_s)+rev+' Dalton.'
+  end
+
+  # ========================================================================= #
+  # === show_name_of_the_gene
+  # ========================================================================= #
+  def show_name_of_the_gene
+    erev 'The name of the gene at hand is: '+
+          sfancy(sequence_object?.name_of_gene)
+  end
+
+  # ========================================================================= #
+  # === show_agarose_table
+  #
+  # This method will simply show common agarose concentrations.
+  # ========================================================================= #
+  def show_agarose_table
+    hash = load_bioroebe_yaml_file(:agarose)
+    e
+    e 'Agarose concentrations:'
+    e
+    hash.each_pair {|concentration_of_the_gel, kb_fragment|
+      erev '  A concentration of '+simp(concentration_of_the_gel.to_s+'%')+
+           rev+' will separate DNA fragments between '+sfancy(kb_fragment)+
+           rev+' kb.'
+    }; e
+  end
+
+  # ========================================================================= #
+  # === start_codon?
+  # ========================================================================= #
+  def start_codon?
+    ::Bioroebe.start_codon?
+  end
+
+  # ========================================================================= #
+  # === stop_codons?
+  # ========================================================================= #
+  def stop_codons?
+    ::Bioroebe.stop_codons?
+  end
+
+  # ========================================================================= #
+  # === show_all_dmp_files
+  #
+  # Show all .dmp files here.
+  # ========================================================================= #
+  def show_all_dmp_files
+    show_directory_content('.dmp')
+  end
+
+  # ========================================================================= #
+  # === show_and_calculate_weight_of_dna_string_or_aminoacid_sequence
+  # ========================================================================= #
+  def show_and_calculate_weight_of_dna_string_or_aminoacid_sequence(
+      i = dna_sequence_object?
+    )
+    if i.nil?
+      if dna_sequence_object?
+        i = dna_sequence_object?
+      end
+    end
+    # ======================================================================= #
+    # First, we check if the input is an aminoacid-sequence.
+    # ======================================================================= #
+    if ::Bioroebe.is_aminoacid?(i)
+      reverse = AMINO_ACIDS_ENGLISH.reverse
+      i = reverse[i] # Replace it with the one-letter code next.
+      # ===================================================================== #
+      # Obtain the mass of this aminoacid.
+      # ===================================================================== #
+      i = AMINO_ACIDS_AVERAGE_MASS_TABLE[i]
+      erev 'The weight of this aminoacid is: '+
+            simp(i.to_s)+rev+' Dalton.'
+    else
+      show_and_calculate_weight_of_dna_string(i)
+    end
+  end
+
+  # ========================================================================= #
+  # === show_t_phages
+  # ========================================================================= #
+  def show_t_phages
+    dataset = YAML.load_file(
+      ::Bioroebe.yaml_dir?+'viruses/ecoli_phages.yml'
+    )
+    # ======================================================================= #
+    # Next, display that as a table.
+    # ======================================================================= #
+    erev 'Name of Phage | Plaque Size | Head diameter | tail length | latent period | burst size'
+    cliner length: 88
+    dataset.each_pair {|name_of_phage, value|
+      print '|',name_of_phage.to_s.center(13),'|'
+      # ===================================================================== #
+      # Display the plague size next, aka small, medium or large.
+      # ===================================================================== #
+      plaque_size = value['plaque_size']
+      print plaque_size.to_s.center(13),'|'
+      head = value['head']
+      print head.to_s.center(15),'|'
+      tail = value['tail']
+      print tail.to_s.center(13),'|'
+      # ===================================================================== #
+      # Display the latent period.
+      # ===================================================================== #
+      latent_period = value['latent_period']
+      print latent_period.to_s.center(15),'|'
+      burst_size = value['burst_size']
+      print burst_size.to_s.center(12),'|'
+      e
+      cliner length: 88
+    }
+  end
+
+  # ========================================================================= #
+  # === show_html_colours
+  # ========================================================================= #
+  def show_html_colours
+    e 'The available HTML colours are:'; e
+    ::Colours.show_html_colours; e
+  end
+
+  # ========================================================================= #
+  # === show_restriction_table
+  #
+  # This method will show a restriction table, that is, a table with
+  # some different restriction enzymes.
+  #
+  # To invoke this method, do:
+  #
+  #   show_restriction_table
+  #
+  # ========================================================================= #
+  def show_restriction_table
+    most_ljust = 20
+    erev 'Showing a few different cutters (4,5,6,7,8) in table format next:'
+    erev '---------------------------------------------------------'
+    e peru('  4-cutter'.ljust(most_ljust))+' | '+orange('ChaI'.ljust(10))+' | '+
+      olivedrab('GATC'.ljust(10))
+    e peru('  5-cutter'.ljust(most_ljust))+' | '+orange('FmuI'.ljust(10))+' | '+
+      olivedrab('GGNCC'.ljust(10))
+    e peru('  6-cutter'.ljust(most_ljust))+' | '+orange('EcoRI'.ljust(10))+' | '+
+      olivedrab('GAATTC'.ljust(10))
+    e peru('  7-cutter'.ljust(most_ljust))+' | '+orange('PfoI'.ljust(10))+' | '+
+      olivedrab('TCCNGGA'.ljust(10))
+    e peru('  8-cutter'.ljust(most_ljust))+' | '+orange('PacI'.ljust(10))+' | '+
+      olivedrab('TTAATTAA'.ljust(10))
+    erev '---------------------------------------------------------'
+  end
+
+  # ========================================================================= #
+  # === show_numbered_nucleotide_positions
+  #
+  # This method will show "numbered" nucleotide positions such as:
+  #
+  #     1234567891234567891234567
+  #     ATGCAGGTCATCAGTCAGTCAGTCA
+  #
+  # ========================================================================= #  
+  def show_numbered_nucleotide_positions
+    _ = sequence?.string?
+    chars = _.chars
+    chunk = chars.each_slice(40) 
+    chunked = chunk.map {|line| line.join }
+    chunked.each {|line|
+      chars = line.chars
+      upper_strand = ''.dup
+      counter = 0
+      chars.each {|char| counter += 1
+        if counter > 9
+          counter = 0
+        end
+        upper_strand << counter.to_s
+      }
+      e lightsteelblue(upper_strand)
+      erev line
+    }
+  end
+
+  # ========================================================================= #
+  # === show_fastq_quality_score_table
+  # ========================================================================= #
+  def show_fastq_quality_score_table
+    _ = FILE_FASTQ_QUALITY_SCHEMES
+    if File.exist? _
+      dataset = YAML.load_file(_)
+      keys = dataset.keys
+      keys.each {|this_key|
+        e sfancy(this_key+':')
+        e
+        inner_dataset = dataset[this_key]
+        erev '  Ascii character range: '+
+             seagreen(inner_dataset['ascii_character_range'].to_s)
+        erev '  Offset:                '+
+             seagreen(inner_dataset['offset'].to_s)
+        erev '  Quality score type:    '+
+             seagreen(inner_dataset['quality_score_type'].to_s)
+        erev '  Quality score range:   '+
+             seagreen(inner_dataset['quality_score_range'].to_s)
+        e
+      }; e
+    end
+  end
+
+  # ========================================================================= #
+  # === report_the_protein_weight
+  # ========================================================================= #
+  def report_the_protein_weight
+    _ = aminoacid_sequence?
+    if _.include? '*'
+      erev 'Note that this aminoacid sequence has a stop codon, denoted by the *:'
+      e
+      erev '  '+sfancy(_)+rev
+      e
+      erev 'Since a stop codon is not translated into an aminoacid'
+      erev 'it makes little sense to include it into the weight-calculation.'
+      erev 'Thus, we will use only the part up to the first * token.'
+      _ = _[0 .. (_.index('*') - 1)]
+    end
+    sum = ::Bioroebe.amino_acid_average_mass(_)
+    e 'The total weight of these '+simp(_.size.to_s)+rev+
+      ' aminoacids is: '+sfancy(sum.to_f.round(2).to_s)+rev+
+      ' Dalton'
+  end
+
+  # ========================================================================= #
+  # === report_all_stop_codons
+  #
+  # This method will report all stop codons in the given sequence.
+  #
+  # We will not modify the input given to this method.
+  #
+  # The three stop codons, in RNA, are:
+  #
+  #     UGA
+  #     UAG
+  #     UAA
+  #
+  # ========================================================================= #
+  def report_all_stop_codons(
+      i = dna_sequence_object?
+    )
+    i.upcase!
+    erev 'Our input sequence has '+simp(i.size.to_s)+rev+' nucleotides.'
+    n_UGA = 'UGA'
+    n_UGA = 'TGA' if is_dna?
+    erev 'We did find '+
+          simp(
+            i.scan(/#{n_UGA}/
+          ).size.to_s.rjust(2))+rev+' '+n_UGA+' stop codons.'
+    n_UAG = 'UAG'
+    n_UAG = 'TAG' if is_dna?
+    erev 'We did find '+
+          simp(i.scan(/#{n_UAG}/).size.to_s.rjust(2))+rev+' '+n_UAG+' stop codons.'
+    n_UAA = 'UAA'
+    n_UAA = 'TAA' if is_dna?
+    erev 'We did find '+
+          simp(i.scan(/#{n_UAA}/).size.to_s.rjust(2))+rev+' '+n_UAA+' stop codons.'
+  end
+
+  # ========================================================================= #
+  # === determine_and_report_all_stop_codons
+  # ========================================================================= #
+  def determine_and_report_all_stop_codons
+    dna_sequence = dna_sequence_object?
+    erev 'Because 3 different stop codons exist, we have '\
+         'to do '+slateblue('3 runs')+rev+'.'
+    stop_codons?.each {|this_stop_codon|
+      array_matches = ::Bioroebe.return_all_substring_matches(
+        dna_sequence, this_stop_codon
+      )
+      if array_matches.empty?
+        erev 'No match has been found.'
+      else
+        start_position = array_matches.last.first
+        erev 'For the stop codon '+sfancy(this_stop_codon)+rev+' the last codon'
+        erev 'occurrs at position '+simp(start_position.to_s)+rev+'.'
+      end
+    }
+  end
+
+  # ========================================================================= #
+  # === show_seq_1
+  # ========================================================================= #
+  def show_seq_1(i = seq1?)
+    erev padding?+leading_five_prime+
+         sfancy(i)+rev+trailing_three_prime
+  end
+
+  # ========================================================================= #
+  # === show_seq_2
+  # ========================================================================= #
+  def show_seq_2(i = seq2?)
+    erev padding?+leading_five_prime+
+         sfancy(i)+rev+trailing_three_prime
+  end
+
+  # ========================================================================= #
+  # === show_seq_3
+  # ========================================================================= #
+  def show_seq_3(i = seq3?)
+    erev padding?+leading_five_prime+
+         sfancy(i)+rev+trailing_three_prime
+  end
+
+  # ========================================================================= #
+  # === show_seq_4
+  # ========================================================================= #
+  def show_seq_4
+    erev padding?+leading_five_prime+sfancy(seq4?)+rev+trailing_three_prime
+  end
+
+  # ========================================================================= #
+  # === show_seq_5
+  # ========================================================================= #
+  def show_seq_5
+    erev padding?+leading_five_prime+sfancy(seq5?)+rev+trailing_three_prime
+  end
+
+  # ========================================================================= #
+  # === show_seq_6
+  # ========================================================================= #  
+  def show_seq_6
+    erev padding?+leading_five_prime+sfancy(seq6?)+rev+trailing_three_prime
+  end
+
+  # ========================================================================= #
+  # === show_start_and_stop_codons
+  #
+  # This will show BOTH start and stop codons, in different colours.
+  #
+  # Since start codons may be more important, we will first locate
+  # and colourize them, and afterwards, will also colourize the
+  # stop codons.
+  # ========================================================================= #
+  def show_start_and_stop_codons
+    _ = string?
+    start_codon = ::Bioroebe.start_codon?
+    stop_codons = ::Bioroebe.stop_codons?
+    _.gsub!(/(#{start_codon})/, yellow+'\\1'+colour_for_nucleotide)
+    stop_codons.each {|stop_codon|
+      _.gsub!(/(#{stop_codon})/, salmon('\\1')+colour_for_nucleotide)
+    }
+    erev 'Start codon: '+yellow+start_codon+rev
+    stop_codons = stop_codons.join(', ').strip
+    stop_codons.chop! if stop_codons.end_with? ','
+    # ======================================================================= #
+    # Show the stop codons that we will use:
+    # ======================================================================= #
+    erev 'Stop codons: '+salmon(stop_codons)+rev
+    erev dna_padding(_)
+  end
+
+  # ========================================================================= #
+  # === report_when_the_bioroebe_project_was_last_updated
+  # ========================================================================= #
+  def report_when_the_bioroebe_project_was_last_updated
+    result = 'The Bioroebe-Project was last updated on: '+
+              slateblue(LAST_UPDATE)+rev
+    result = result.dup
+    n_days_difference = ((Time.now - Time.parse(LAST_UPDATE))/60/60/24).round(2).to_s
+    result << ' (~'+n_days_difference.to_s+' days ago)'
+    erev result
+  end
+
+  # ========================================================================= #
+  # === show_information_about_the_gff_format
+  # ========================================================================= #
+  def show_information_about_the_gff_format
+    erev 'Fields must be tab-separated in the .gff format.'
+    e
+    erev 'All but the final field in each feature line must'
+    erev 'contain a value; "empty" columns should be denoted with a "."'
+    e
+    egold 'seqname:'
+    erev 'This is the name of the chromosome or scaffold; chromosome names'
+    erev 'can be given with or without the "chr" prefix.'
+    erev 'Important note: the seqname must be one used within Ensembl, '
+    erev 'i.e. a standard chromosome name or an Ensembl identifier such as a'
+    erev 'scaffold ID, without any additional content such as species or'
+    erev 'assembly. See the example GFF output below.'
+    e
+    egold 'source:'
+    erev 'Name of the program that generated this feature, or '
+    erev 'the data source (database or project name)'
+    e
+    egold 'feature:'
+    erev 'feature type name, e.g. Gene, Variation, Similarity'
+    e
+    egold 'start:'
+    erev 'Start position of the feature, with sequence numbering starting at 1.'
+    e
+    egold 'end:'
+    erev 'End position of the feature, with sequence numbering '\
+         'starting at 1.'
+    e
+    egold 'score:'
+    erev 'A floating point value.'
+    e
+    egold 'strand:'
+    erev 'defined as + (forward) or - (reverse).'
+    e
+    egold "frame:"
+    erev " - One of '0', '1' or '2'. '0' indicates that the first base "
+    erev "of the feature is the first base of a codon, '1' that the second "
+    erev "base is the first base of a codon, and so on."
+    e
+    egold 'attribute:'
+    erev 'A semicolon-separated list of tag-value pairs, providing '
+    erev 'additional information about each feature.'
+    e
+  end
+
+  # ========================================================================= #
+  # === show_header_of_this_pdb_file
+  # ========================================================================= #
+  def show_header_of_this_pdb_file(i)
+    lines  = File.readlines(i)
+    first  = lines.first.split(' ')[1..-1].join(' ').strip
+    second = lines[1].split(' ')[1..-1].join(' ').strip
+    erev first
+    erev '  '+second
+  end
+
+  # ========================================================================= #
+  # === show_useful_URLs
+  #
+  # This method will simply show some important, bioinformatics related
+  # URLs. In particular URLs that may be important for bioinformatics
+  # related tasks, e. g. NCBI, GeneBank and so forth.
+  # ========================================================================= #
+  def show_useful_URLs
+    e
+    erev 'NCBI:    '+sfancy(obtain_url_for(:ncbi))
+    erev 'GenBank: '+sfancy(obtain_url_for(:genbank))
+    erev 'PDB:     '+sfancy(obtain_url_for(:pdb))
+    erev 'Prosite: '+sfancy(obtain_url_for(:prosite))
+    e
+  end
+
+  # ========================================================================= #
+  # === show_header_of
+  # ========================================================================= #
+  def show_header_of(i)
+    if i.is_a? Array
+      i.each {|entry| show_header_of(entry) }
+    else
+      unless File.exist? i
+        erev "No file exists at `#{sfile(i)}#{rev}`."
+        return
+      end
+      case i
+      # ===================================================================== #
+      # === .pdb
+      # ===================================================================== #
+      when /\.pdb$/
+        show_header_of_this_pdb_file(i)
+      end
+    end
+  end
+
+  # ========================================================================= #
+  # === show_GFP_sequence                                           (gfp tag)
+  #
+  # This method will show the GFP sequence, on the DNA level.
+  # ========================================================================= #
+  def show_GFP_sequence
+    erev return_five_prime_header+
+         return_default_GFP_sequence
+  end
+
+  # ========================================================================= #
+  # === return_default_GFP_sequence
+  # ========================================================================= #
+  def return_default_GFP_sequence(
+      path_to_the_file = FILE_GFP_SEQUENCE
+    )
+    Fasta.new(path_to_the_file) { :be_quiet }.return_sequence
+  end
+
+  # ========================================================================= #
+  # === try_to_show_the_configuration
+  # ========================================================================= #
+  def try_to_show_the_configuration
+    @config.show_config if @config.respond_to? :show_config
+    _ = verbose_truth(use_expand_cd_aliases?)
+    colourized_yes_or_no = simp(_.to_s)
+    erev 'Will we use class Rcfiles::DirectoryAliases: '+
+         colourized_yes_or_no
+  end
+
+  require 'bioroebe/aminoacids/aminoacids_mass_table.rb'
+  # ========================================================================= #
+  # === show_aminoacids_mass_table
+  #
+  # This shows the weight of the aminoacids, in a table-layout.
+  # ========================================================================= #
+  def show_aminoacids_mass_table
+    AminoacidsMassTable.report_which_file_is_used
+    AminoacidsMassTable.show(padding?) # bl aminoacids_mass_table.rb
+  end; alias aminoacid_table_overview show_aminoacids_mass_table # === show_aminoacids_mass_table
+
+  require 'bioroebe/utility_scripts/pathways.rb'
+  # ========================================================================= #
+  # === show_all_pathways
+  #
+  # Simply show all Pathways.
+  # ========================================================================= #
+  def show_all_pathways
+    ::Bioroebe::Pathways.show_all_pathways
+  end
+
+  # ========================================================================= #
+  # === show_sequence_in_splitted_form
+  #
+  # We will show the main DNA sequence in a three-letter splitted form.
+  #
+  # You can optionally use an argument, the first argument, a number. By
+  # default this is 3, so we will split into chunks of 3.
+  #
+  # The second argument says which token we will use for rejoining. It
+  # defaults to ' ' so the nucleotides will be rejoined via ' ', but
+  # you can also use another token such as '-', which may lead to a
+  # String such as 'ATG-CGA-ACC' and so forth.
+  # ========================================================================= #
+  def show_sequence_in_splitted_form(
+      how_many                     = 3,
+      use_this_token_for_rejoining = ' ' # <- Which token to use for the re-joining action.
+    )
+    case how_many
+    when nil, :default # Use a default value here.
+      how_many = 3
+    end
+    result = '.' * how_many.to_i
+    use_this_regex = /#{result}/
+    if string?.empty?
+      erev 'Please first "assign" a sequence.'
+    else
+      if block_given?
+        yielded = yield
+        if yielded.is_a? Hash
+          # ================================================================= #
+          # === :use_this_token
+          # ================================================================= #
+          if yielded.has_key? :use_this_token
+            use_this_token_for_rejoining = yielded.delete(:use_this_token)
+          end
+        end
+      end
+      string = string?.to_s
+      scanned = string.scan(use_this_regex)
+      scanned.map! {|entry|
+        # =================================================================== #
+        # Colourize start codons next.
+        # =================================================================== #
+        if is_this_a_start_codon? entry
+          entry = mediumseagreen(entry)+
+                  return_colour_for_nucleotides
+        elsif is_this_a_stop_codon? entry
+          entry = mediumorchid(entry)+
+                  return_colour_for_nucleotides
+        end
+        entry
+      }
+      _ = scanned.join(use_this_token_for_rejoining)
+      # ===================================================================== #
+      # Finally show the sequence.
+      # ===================================================================== #
+      erev left_padding?+
+           five_prime+
+           return_colour_for_nucleotides+
+           _+
+           rev+
+           three_prime
+    end
+  end
+
+  # ========================================================================= #
+  # === show_disulfides
+  #
+  # Show the (possible) disulfide positions in a protein.
+  # ========================================================================= #
+  def show_disulfides
+    _ = aminoacid_sequence?
+    if _.include? 'C'
+      n_cytosines = _.count('C')
+      erev "This aminoacid sequence has #{steelblue(n_cytosines.to_s)}#{rev} cysteines."
+      if n_cytosines > 1
+        erev 'Thus, there could be disulfide bonds. '+
+             gold(cheerful_person)+rev
+        show_sequence_with_a_ruler(:default, _)
+        erev 'The positions of cysteines are at:'
+        _.chars.each_with_index {|aminoacid, index|
+          if aminoacid == 'C'
+            erev 'Position: '+steelblue((index+1).to_s.rjust(3))
+          end
+        }
+      end
+    else
+      e 'This aminoacid sequence has no cystein. Thus, '\
+        'there can not be any disulfide bonds.'
+    end
+  end
+
+  # ========================================================================= #
+  # === show_aminoacids_residues
+  # ========================================================================= #
+  def show_aminoacids_residues
+    erev 'The aminoacid residues are:'; e
+    ENGLISH_LONG_NAMES_FOR_THE_AMINO_ACIDS.each {|this_aminoacid|
+      erev this_aminoacid.ljust(14)+': '+
+           simp(AMINO_ACIDS_RESTE[this_aminoacid.downcase]) # Must downcase.
+    }; e
+  end
+
+  # ========================================================================= #
+  # === show_hint_how_to_use_the_local_sequences
+  #
+  # Show a hint for the user.
+  # ========================================================================= #
+  def show_hint_how_to_use_the_local_sequences
+    unless return_fasta_files_in_the_log_directory.empty?
+      erev 'You can load up any of these sequences by issuing:'
+      e
+      erev '  use_this_fasta 1 # for file number 1'
+      e
+    end
+  end
+
+  # ========================================================================= #
+  # === colour_for_stop_codon
+  # ========================================================================= #
+  def colour_for_stop_codon(i)
+    orange(i)
+  end
+
+  # ========================================================================= #
+  # === colour_for_nucleotide
+  # ========================================================================= #
+  def colour_for_nucleotide(i = '')
+    royalblue(i)
+  end; alias colour_for_nucleotides colour_for_nucleotide # === colour_for_nucleotides
+
+  # ========================================================================= #
+  # === report_this_dna_sequence_with_proper_trailer_and_leader
+  # ========================================================================= #
+  def report_this_dna_sequence_with_proper_trailer_and_leader(i)
+    i = i.to_s
+    if block_given?
+      yielded = yield
+      case yielded
+      when :try_to_colourize_start_codon
+        # =================================================================== #
+        # We will try to colourize the start codon here.
+        # =================================================================== #
+        if i.start_with? start_codon?
+          i[0,3] = cyan(i[0,3])+return_colour_for_nucleotides
+        end
+      end
+    end
+    colourized_dna_sequence = colourize_this_dna_sequence(i)
+    colourized_dna_sequence = remove_trailing_escape_code(
+      colourized_dna_sequence
+    )
+    erev left_pad?+
+         leading_5_prime+
+         colourized_dna_sequence+
+         rev+
+         trailing_3_prime
+  end
+
+  # ========================================================================= #
+  # === show_hydropathy_table
+  #
+  # Show the hydropathy table.
+  # ========================================================================= #
+  def show_hydropathy_table
+    e
+    HYDROPATHY_TABLE.each_pair {|aminoacid_one_letter, hydropathy_value|
+      e '  '+sfancy(aminoacid_one_letter)+'  | '+
+        simp(hydropathy_value.to_s.rjust(4))
+    }; e
+  end
+
+  # ========================================================================= #
+  # === show_known_nls_sequences
+  #
+  # This Wikipedia page may be useful:
+  #   http://en.wikipedia.org/wiki/Nuclear_localization_sequence
+  # ========================================================================= #
+  def show_known_nls_sequences
+    erev 'These NLS sequences are known:'+N+N
+    padding = 36
+    NUCLEAR_LOCALIZATION_SEQUENCES.each_pair {|key, value|
+      e sfancy(key.ljust(padding))+' '+value
+    }
+  end
+
+  # ========================================================================= #
+  # === report_mode
+  # ========================================================================= #
+  def report_mode
+    erev mode?
+  end
+
+  # ========================================================================= #
+  # === show_reste
+  #
+  # This will show the residues of the various amino acids.
+  # ========================================================================= #
+  def show_reste
+    e; AMINO_ACIDS_RESTE.each_pair {|key, value|
+      erev '  '+key.ljust(14)+' -> '+sfancy(value)
+    }; e
+  end
+
+  require 'bioroebe/string_matching/simple_string_comparer.rb'
+  # ========================================================================= #
+  # === show_sixpack_alignment
+  #
+  # We will feed some input to class Bioroebe::SimpleStringComparer.
+  # ========================================================================= #
+  def show_sixpack_alignment(
+      i = dna_sequence_object?
+    )
+    erev 'Input sequence 1:'
+    string1 = $stdin.gets.chomp
+    erev 'Input sequence 2:'
+    string2 = $stdin.gets.chomp
+    # ======================================================================= #
+    # Delegate into class SimpleStringComparer next.
+    # ======================================================================= #
+    _ = ::Bioroebe::SimpleStringComparer.new(:dont_run_yet) # bl $BIOROEBE/string_matching/simple_string_comparer.rb
+    _.set_main_alignment_token_to '|'
+    _.string1 = string1
+    _.string2 = string2
+    _.compare
+  end
+
+  # ========================================================================= #
+  # === show_average_weight_of_a_nucleotide
+  #
+  # The formulat was obtained from the following website:
+  #
+  #   http://www.biophp.org/minitools/useful_formulas/demo.php
+  #
+  # ========================================================================= #
+  def show_average_weight_of_a_nucleotide
+    erev 'The average molecular weight (MW) of dsDNA is '+sfancy('660')+' Da.'
+    erev 'The average molecular weight (MW) of ssDNA is '+sfancy('330')+' Da.'
+  end
+
+  # ========================================================================= #
+  # === show_config_dir
+  #
+  # This method will show the configuration directory.
+  # ========================================================================= #
+  def show_config_dir
+    config_dir = File.dirname(__FILE__)+'/configuration/'
+    erev 'The configuration directory for the Bioroebe::Shell is at:'
+    erev '  `'+sfile(config_dir)+rev+'`'
+  end
+
+  # ========================================================================= #
+  # === show_last_downloaded_file
+  # ========================================================================= #
+  def show_last_downloaded_file
+    if @array_all_downloads.empty?
+      erev 'We have not yet downloaded any file.'
+    else
+      erev 'The last downloaded data was: '+
+            sfancy(@array_all_downloads.last)
+    end
+  end
+
+  # ========================================================================= #
+  # === show_jumper_directories
+  # ========================================================================= #
+  def show_jumper_directories
+    if @internal_hash[:array_jumper_directories].empty?
+      erev 'No jumper directory has been assigned yet.'
+    else
+      erev 'The available jumper directories are:'
+      pp @internal_hash[:array_jumper_directories]
+    end
+  end
+
+  # ========================================================================= #
+  # === show_save_file
+  # ========================================================================= #
+  def show_save_file
+    erev 'We will store into the file '+sfile(save_file?)+rev+'.'
+    erev 'If you wish to instead store into the current directory,'
+    erev 'input "save_here".'
+  end
+
+  # ========================================================================= #
+  # === show_sigma_tutorial
+  #
+  # This method tells the user a bit about the sigma factors.
+  # ========================================================================= #
+  def show_sigma_tutorial
+    erev 'This subsection contains some information about Sigmafactors.'
+    e
+    erev 'A sigma factor a protein needed for initiation of RNA synthesis.'
+    e
+    erev 'It is a bacterial transcription initiation factor.'
+    e
+    erev 'It will enable the specific binding of RNA polymerase to gene promoters.'
+    e
+    erev 'Sigma factors vary, which allows the bacterial cell to respond to'
+    erev 'different environmental signals.'
+    e
+    erev 'Every molecule of RNA polymerase holoenzyme will contain only one '\
+         'sigma factor.'
+    e
+    erev 'The number of sigma factors varies between bacterial species.'
+    e
+    erev 'E. coli has seven sigma factors.'
+    e
+    erev 'Sigma factors are distinguished by their characteristic molecular '\
+         'weights.'
+    e
+    erev 'For instance, sigma-70 refers to the sigma factor with a molecular '\
+         'weight of 70 kDa.'
+    e
+    erev 'Once initiation of RNA transcription is complete, the sigma'
+    erev 'factor can leave the complex.'
+    e
+    erev 'Sigmafactor rpoD 70 can be found here:'
+    e '  '+simp('http://www.ncbi.nlm.nih.gov/gene/947567')
+  end
+
+  # ========================================================================= #
+  # === show_last_input
+  #
+  # sli can be used as command to access this method.
+  # ========================================================================= #
+  def show_last_input
+    if readline_is_available?
+      e sfancy(Readline::HISTORY[-1])
+      Readline::HISTORY.pop
+    end
+    e "The last user input was: #{sfancy(@user_input)}"
+  end
+
+  # ========================================================================= #
+  # === show_mnemo
+  #
+  # A little helper-method to memorize things.
+  # ========================================================================= #
+  def show_mnemo
+    e
+    erev 'Amino Acids with negatively charged side groups: -'
+    e sfancy('  D E')
+    erev 'Amino Acids with positive charged side groups: +'
+    e sfancy('  K R H')
+    e
+    e sfancy('Oxidoreduktasen:')+rev+' Oxidations-Reduktions-Reaktionen'
+    e sfancy('Transferasen:')+rev+'    Übertragung funktioneller Gruppen'
+    e sfancy('Hydrolasen:')+rev+'      Hydrolasereaktionen'
+    e sfancy('Lyasen:')+rev+'          Eliminierung von Gruppen unter '\
+      'Ausbildung von Doppelbindungen'
+    e sfancy('Isomerasen:')+rev+'      Isomerisierungen'
+    e sfancy('Ligasen:')+rev+'         ATP-hydrolytic formation of bonds'
+    e
+  end
+
+  # ========================================================================= #
+  # === show_histone_table
+  # ========================================================================= #
+  def show_histone_table
+    erev 'The following table will show Calf Thymus Histones:'
+    e
+    erev 'Histone | number of residues | mass in kDa | n% Arginine | n% Lysine'
+    erev '  H1             215               23.0          1             29'
+    erev '  H2A            129               14.0          9             11'
+    erev '  H2B            125               13.8          6             16'
+    erev '  H3             135               15.3         13             10'
+    erev '  H4             102               11.3         14             11'
+    e
+  end
+
+  # ========================================================================= #
+  # === show_average_weight_of_an_aminoacid
+  #
+  # Show the average weight for an aminoacid that is part of a protein.
+  # ========================================================================= #
+  def show_average_weight_of_an_aminoacid
+    erev 'The average molecular weight (MW) of an amino '\
+         'acid is '+sfancy('110')+' Da.'
+  end
+
+  # ========================================================================= #
+  # === show_first_orf
+  #
+  # This will show the first ORF.
+  #
+  # Invocation example:
+  #
+  #   show_first_orf
+  #
+  # ========================================================================= #
+  def show_first_orf(
+      of_this_sequence = dna_sequence_object?
+    )
+    _ = of_this_sequence
+    return_all_possible_start_codons.each {|this_codon|
+      if _.include? this_codon
+        index = _.index(this_codon)
+        sequence = _[index..-1]
+        e rev+padding?+leading_5_prime+sfancy(sequence)+
+          rev+trailing_3_prime+' (Start position at nucleotide: '+
+          orange((index+1).to_s)+rev+')'
+      else
+        erev 'Not found the codon '+simp(this_codon)+rev+'.'
+      end
+    }
+  end
+
+  # ========================================================================= #
+  # === show_available_vectors
+  # ========================================================================= #
+  def show_available_vectors
+    erev 'We will next try to show the available vectors.'
+    erev 'For now, these are all file names that start with the '\
+         'the prefix '+orange('vector_')+rev+'.'
+    _ = return_available_vectors # Defined in bioroebe/shell.rb
+    if _.empty?
+      erev 'No vector-sequence was found.'
+    else
+      erev 'We found at the least one entry.'
+      print '  '
+      pp _
+      erev 'Assigning the first one to the second sequence.'
+      set_sequence_2(Bioroebe::Sequence.sequence_from_file(_.first))
+      erev 'You can feedback this sequence via:'
+      e
+      erev '  seq2?'
+      e
+    end
+  end
+
+  # ========================================================================= #
+  # === report_current_genbank_version
+  #
+  # You can use this method to report the current genbank version.
+  # ========================================================================= #
+  def report_current_genbank_version(
+      optional_arguments = nil
+    )
+    remote_url = 'https://www.ncbi.nlm.nih.gov/genbank/statistics/'
+    if optional_arguments
+      case optional_arguments
+      when :also_report_the_URL
+        erev 'We will obtain the latest Genbank version from the URL:'
+        e
+        erev "  #{simp(remote_url)}"
+        e
+      end
+    end
+    remote_dataset = URI.open(remote_url).read.split(N)
+    # ======================================================================= #
+    # For the following Regex, see this link:
+    #
+    #   https://rubular.com/r/XC97c7i6sR
+    #
+    # ======================================================================= #
+    regex_to_use =
+      /<td>(\d{1,3})<\/td><td>(.{1,3}\s{1,3}\d{4})<\/td><td>\d+<\/td><td>\d+<\/td><td>\d+<\/td><td>\d+<\/td><\/tr><\/tbody><\/table>$/
+    _ = ''.dup
+    is_open = false
+    remote_dataset.each {|line|
+      if line.include? '<table id="stats_table" summary="GENBANK AND WGS'
+        _ << line
+        is_open = true
+      else
+        _ << line if is_open
+        if line.include? '</table>'
+          is_open = false
+        end
+      end
+    }
+    _ =~ regex_to_use # Match the regex against the substring assigned to _.
+    version        = $1.to_s.dup
+    month_and_year = $2.to_s.dup
+    erev 'The current Genbank version is: '+simp(version)+
+         rev+' (released on '+simp(month_and_year)+rev+')'
+  end
+
+  # ========================================================================= #
+  # === show_copyright_clause
+  #
+  # This method will simply show the licence used for the project.
+  #
+  # This has to be updated manually, though; and since the licence
+  # may change one day, I will keep track when this method has been
+  # last modified, which is on the 28.04.2020 (28th April, 2020).
+  # ========================================================================= #
+  def show_copyright_clause
+    e
+    erev 'This project is free software, licensed under the LGPL-2.0 license.'
+    erev 'No "any later clause"; LGPL-2.0 applies to it.'
+    e
+    erev '  Copyright: Robert A. Heiler (2010-2020 and later)'
+    e
+    erev 'The biomart component is licensed under the MIT license and is'
+    erev 'written by Darren Oakley. The MIT license is retained for the'
+    erev 'Biomart component.'
+    e
+    erev '(Note that the bioroebe project used to be under the GPL licence'
+    erev 'before some time; see the homepage of this gem for the explanation'
+    erev 'as to why a switch occurred towards LGPL.)'
+  end
+
+  # ========================================================================= #
+  # === report_n_proteins_registered_in_swiss_prot
+  #
+  # This method will report how many proteins are registered in swiss-prot.
+  #
+  # Invoke this method like so:
+  #
+  #   swiss-prot?
+  #
+  # ========================================================================= #
+  def report_n_proteins_registered_in_swiss_prot
+    regex_to_use = /contains (\d+) sequence entries/ # See: http://rubular.com/r/Bl9tHfheEx
+    url = 'https://web.expasy.org/docs/relnotes/relstat.html'
+    dataset = open(url).read
+    dataset =~ regex_to_use
+    n_registered_proteins = $1.to_s.dup
+    erev 'There are '+simp(n_registered_proteins)+rev+' registered '\
+         'proteins in the Swiss-Prot database.'
+    erev "The URL used to determine this was: "\
+         "#{simp(url)}"
+  end
+
+
+  # ========================================================================= #
+  # === report_whether_readline_is_available
+  # ========================================================================= #
+  def report_whether_readline_is_available
+    erev 'Is readline available? '+
+      slateblue(
+        verbose_truth(
+          (Object.const_defined? :Readline)
+        )
+      )
+  end
+
+  require 'bioroebe/dotplots/advanced_dotplot.rb'
+  # ========================================================================= #
+  # === show_2D_dotplot
+  # ========================================================================= #
+  def show_2D_dotplot(
+      string1 = nil, string2 = nil
+    )
+    if string1.nil? and string2.nil?
+      erev 'You want to use a dotplot.'
+      erev 'Please provide the first string, which will be on the left side:'
+      string1 = $stdin.gets.chomp
+      erev 'Please provide the second string, which will be on the top side:'
+      string2 = $stdin.gets.chomp
+    end
+    ::Bioroebe::AdvancedDotplot.new(string1, string2)
+  end
+
+  # ========================================================================= #
+  # === show_reverse_dna_string
+  #
+  # This method will simply show the DNA sequence reversed.
+  # ========================================================================= #
+  def show_reverse_dna_string
+    erev padding?+
+         leading_five_prime+
+         sfancy(return_reverse_dna_string)+
+         rev+
+         trailing_three_prime
+  end
+
+  # ========================================================================= #
+  # === show_download_dir
+  # ========================================================================= #
+  def show_download_dir
+    erev ::Bioroebe.download_directory?
+  end
+
+  # ========================================================================= #
+  # === show_this_sequence_padded
+  #
+  # Usage example:
+  #
+  #   show_this_sequence_padded ATGACTTAGCCACAACTGCATGCATATGCATGACTGACT
+  #
+  # ========================================================================= #
+  def show_this_sequence_padded(
+      i = dna_sequence_object?
+    )
+    if i.is_a? Array and i.empty?
+      i << dna_sequence_object?
+    end
+    if i.is_a? Array
+      i = i.join
+    end
+    # ======================================================================= #
+    # First, split it into an array of 80 characters each.
+    # ======================================================================= #
+    array = i.scan(/.{,80}/).reject {|entry| entry.empty? }
+    array.each {|entry|
+      erev entry
+    }
+  end
+
+  require 'bioroebe/enzymes/restriction_enzymes_file.rb'
+  # ========================================================================= #
+  # === show_all_yaml_files
+  #
+  # We show which yaml files we will use here.
+  # ========================================================================= #
+  def show_all_yaml_files
+    erev 'The file that holds our restriction enzymes can be found here:'
+    e
+    erev "  #{sfile(::Bioroebe.restriction_enzymes_file)}"
+    e
+  end
+
+  # ========================================================================= #
+  # === show_resources_about_the_horseradish_peroxidase
+  # ========================================================================= #
+  def show_resources_about_the_horseradish_peroxidase
+    e 'https://www.ncbi.nlm.nih.gov/gene/?term=%22Horseradish+Peroxidase%22'
+    e 'https://www.ncbi.nlm.nih.gov/gene/836533'
+    e 'Fasta: https://www.ncbi.nlm.nih.gov/nuccore/NC_003076.8?report=fasta&from=25659257&to=25661007&strand=true'
+  end
+
+  # ========================================================================= #
+  # === report_whether_we_will_make_use_of_expand_cd_aliases
+  # ========================================================================= #
+  def report_whether_we_will_make_use_of_expand_cd_aliases
+    erev Bioroebe::VerboseTruth[use_expand_cd_aliases?]
+  end
+
+  # ========================================================================= #
+  # === report_useful_packages_installed
+  #
+  # This aggregate method can be used to report versions that may be
+  # installed on the given system, e. g. science-based projects and
+  # similar variants.
+  # ========================================================================= #
+  def report_useful_packages_installed
+    try_to_report_the_version_of_viennarna
+    try_to_report_the_version_of_bedtools
+  end
+
+  # ========================================================================= #
+  # === try_to_report_the_version_of_viennarna
+  #
+  # This method can be used to see the version of ViennaRNA, if it is
+  # installed at all.
+  # ========================================================================= #
+  def try_to_report_the_version_of_viennarna
+    result = `RNAplfold --version 2>&1`
+    if result.include? 'command not found'
+      e
+      erev 'ViennaRNA does not appear to be installed / available.'
+      e
+      if is_on_roebe?
+        erev 'You may be able to install it via:'
+        e
+        erev '  rbt viennarna'
+        e
+      end
+    else
+      version = result.sub(/RNAplfold/,'').strip.to_s
+      erev 'The version of ViennaRNA is: '+
+         orange(version)+rev
+    end
+  end
+
+  # ========================================================================= #
+  # === report_current_working_directory
+  # ========================================================================= #
+  def report_current_working_directory
+    erev 'We are in the directory:'
+    erev "  #{sdir(return_working_directory)}"
+  end
+
+  # ========================================================================= #
+  # === report_which_yaml_engine_is_in_use
+  # ========================================================================= #
+  def report_which_yaml_engine_is_in_use
+    erev 'The yaml engine in use is: '+
+         sfancy(::Bioroebe.use_which_yaml_engine?)+
+         rev
+  end
+
+  begin
+    require 'directory_paradise'
+  rescue LoadError; end
+  # ========================================================================= #
+  # === show_file_listing
+  #
+  # Make use of DirectoryContent to show the content of a file.
+  #
+  # To invoke this method from within the Bioroebe::Shell, do:
+  #
+  #   ll
+  #
+  # ========================================================================= #
+  def show_file_listing(
+      from_this_directory = Dir.pwd
+    )
+    _ = DirectoryParadise::Report.new(from_this_directory, :dont_run_yet)
+    _.dont_report_total_filesize
+    _.disable_colours unless use_colours?
+    _.run
+  end
+
+  # ========================================================================= #
+  # === try_to_report_the_version_of_bedtools
+  # ========================================================================= #
+  def try_to_report_the_version_of_bedtools
+    result = `bedtools --version 2>&1`
+    if result.include? 'command not found'
+      e
+      erev 'The bedtools do not appear to be installed / available.'
+      e
+      if is_on_roebe?
+        erev 'You may be able to install it via:'
+        e
+        erev '  rbt bedtools'
+        e
+      end
+    else
+      version = result.sub(/bedtools/,'').strip.to_s.delete('v')
+      erev "The version of bedtools is: "\
+           "#{orange(version)}#{rev}"
+    end
+  end
+
+  # ========================================================================= #
+  # === three_to_one
+  #
+  # This method will translate, and output, a three-letter aminoacid
+  # into the corresponding single-letter code.
+  #
+  # Invocation example:
+  #
+  #   three_to_one Thr Thr Glu Ala Val Glu Ser Thr Val Ala Thr Leu Glu Asp Ser # => T T E A V E S T V A T L E D S
+  #   3to1 ARG-ALA-SER-LEU-PHE-TRP-LYS-HIS-ASN-SER-VAL-LEU-ILE-VAL-PRO
+  #
+  # ========================================================================= #
+  def three_to_one(i)
+    if i.is_a? Array
+      i = i.join('-').strip
+    end
+    e ::Bioroebe.three_to_one(i).strip
+  end
+
+  require 'bioroebe/codons/codons.rb'
+  # ========================================================================= #
+  # === show_codons_of_this_aminoacid_or_show_kazusa_codon
+  #
+  # This method can be used to output which codon codes for a specific
+  # aminoacid.
+  #
+  # The input to this method should be a specific codon, such as ATG or
+  # GGC and so forth.
+  #
+  # If no input is provided, we will instead show the webpage of
+  # kazusa.
+  #
+  # Invocation examples:
+  #
+  #   codon? ATG # => M
+  #   codon? AUG # => M
+  #
+  # ========================================================================= #
+  def show_codons_of_this_aminoacid_or_show_kazusa_codon(i = nil)
+    if i.is_a? Array
+      i = i.first
+    end
+    if i # If the user provided input, we check it.
+      # ===================================================================== #
+      # Next, find all codons for the given aminoacid.
+      # ===================================================================== #
+      e ::Bioroebe.codon_to_aminoacid(i)
+    else
+      erev "The URL is at: "\
+           "#{simp('http://www.kazusa.or.jp/codon/')}"
+    end
+  end
+
+  # ========================================================================= #
+  # === return_reverse_dna_string
+  # ========================================================================= #
+  def return_reverse_dna_string
+    complement_sequence?.reverse
+  end
+
+  # ========================================================================= #
+  # === showorf                                                 (showorf tag)
+  #
+  # Use this method to show the open reading frame of a given sequence.
+  #
+  # We can also use it to selectively show a certain frame, such as
+  # frame2. See class Bioroebe::ShowOrf for this.
+  #
+  # Note that in May 2020 (10.05.2020) class Bioroebe::ShowOrf here
+  # was replaced with 
+  # ========================================================================= #
+  def showorf(
+      i                    = dna_sequence_object?,
+      show_how_many_frames = :show_three_frames
+    )
+    i = dna_sequence_object? if i.nil?
+    i = dna_sequence_object? if i.is_a?(Array) and i.empty?
+    display_open_reading_frames(i) { show_how_many_frames }
+  end
+
+  # ========================================================================= #
+  # === display_open_reading_frames
+  #
+  # Invocation example:
+  #
+  #   display_open_reading_frames ATGAGCAAGGCCGACTACGAGAAG
+  #
+  # ========================================================================= #
+  def display_open_reading_frames(
+      i = dna_sequence_object?, &block
+    )
+    i = i.first if i.is_a? Array
+    i = dna_sequence_object? if i.nil?
+    i = dna_sequence_object? if i.empty?
+    require 'bioroebe/utility_scripts/display_open_reading_frames/display_open_reading_frames.rb'
+    ::Bioroebe::DisplayOpenReadingFrames.new(i, &block)
+  end
+
+  require 'bioroebe/fasta_and_fastq/show_fasta_headers.rb'
+  # ========================================================================= #
+  # === show_fasta_headers
+  #
+  # Just show the fasta headers.
+  # ========================================================================= #
+  def show_fasta_headers(i)
+    ::Bioroebe::ShowFastaHeaders.new(i) # Delegate into class Bioroebe::ShowFastaHeaders.
+  end
+
+  # ========================================================================= #
+  # === show_commandline_options
+  #
+  # Show the available commandline options.
+  #
+  # To invoke this method from the commandline, do:
+  #
+  #   bioroebe --help
+  #
+  # ========================================================================= #
+  def show_commandline_options
+    e
+    ecomment('  --silent               # perform a silent startup')
+    ecomment('  --sequence             # use this nucleotide sequence on '\
+             'startup; can be a number too such as 150')
+    ecomment('  --n_fasta_entries      # report how many fasta '\
+             'entries are in this directory')
+    ecomment('  --disable-opn          # permanently disable opn')
+    ecomment('  --random-aminoacids=33 # "generate" 33 random amino acids and display them')
+    ecomment('  --n-aminoacids=33      # an alias to the ^^^ above')
+    ecomment('  --protein-to-dna       # convert protein-aminoacid '\
+             'sequence back to DNA')
+    e
+    exit
+  end
+
+  # ========================================================================= #
+  # === show_codon_table
+  # ========================================================================= #
+  def show_codon_table(i = nil)
+    if i and i.is_a?(Array) and i.empty?
+      i << 1 # Default to the vertebrate codon table in this case.
+    end
+    ShowThisCodonTable.new(i)
+  end
+
+  # ========================================================================= #
+  # === show_rna_sequence
+  #
+  # Use this method to convert a given sequence to RNA.
+  # ========================================================================= #
+  def show_rna_sequence(
+      i = sequence_object?.to_rna
+    )
+    i = sequence_object?.to_rna if i.nil?
+    i = i.to_str if i.respond_to? :to_str
+    if i.include? 'T'
+      i.tr!('T','U')
+    end
+    display_nucleotide_object?.display(i) {{ use_this_as_padding: lpad? }}
+  end
+
+  # ========================================================================= #
+  # === report_size_of
+  # ========================================================================= #
+  def report_size_of(
+      i = nil
+    )
+    if i.nil?
+      i = dna_sequence_object?
+    end
+    if i
+      erev "This sequence contains #{sfancy(i.size.to_s)}#{rev} nucleotides."
+    else
+      report_size_of_main_string
+    end
+  end
+
+  # ========================================================================= #
+  # === display_glycolysis_pathway
+  #
+  # This method will show the glycolysis Pathway.
+  # ========================================================================= #
+  def display_glycolysis_pathway
+    array = Pathways.glycolysis_pathway # Obtain the glyclosis pathway, as Array.
+    if Object.const_defined? :Display
+      Display.display(array, ')')
+    else
+      array.each {|entry| e ' - '+entry }
+    end
+  end
+
+  # ========================================================================= #
+  # === show_the_weight_of_some_common_proteins
+  # ========================================================================= #
+  def show_the_weight_of_some_common_proteins(
+      use_this_file = FILE_WEIGHT_OF_COMMON_PROTEINS
+    )
+    erev 'Showing the weight of some common proteins next (in kDa):'
+    e
+    dataset = File.readlines(use_this_file).select {|line|
+      line.include? ' # '
+    }
+    dataset.each {|line|
+      splitted = line.split(':')
+      key = splitted[0]
+      value = splitted[1 .. -1].join(' ').strip
+      erev "  #{(key+':').ljust(25)} "\
+           "#{lightblue((value.to_s+' kDa').rjust(12))}"
+    }
+    e
+  end
+
+  # ========================================================================= #
+  # === show_protein_composition
+  #
+  # Delegate towards class CountAmountOfAminoacids
+  # ========================================================================= #
+  def show_protein_composition(i)
+    ::Bioroebe::CountAmountOfAminoacids.new(i) # bl $BIOROEBE/count_amount_of_aminoacids.rb
+  end
+
+  # ========================================================================= #
+  # === show_all_deducible_aminoacid_sequences
+  #
+  # Note that if the string is too short, we won't display the other frames.
+  #
+  # If the third argument, `show_translations_aligned`, is set to
+  # true then we will additionally display all 3 frames aligned
+  # one to another.
+  #
+  # Usage example:
+  #
+  #   toproteins AUG
+  #   toproteins AUGAUGUUGAAU
+  #   toproteins AUG-AUG-UUG-AAA-GGU-CGC-AAU-STOP
+  #
+  # ========================================================================= #
+  def show_all_deducible_aminoacid_sequences(
+      i                         = dna_sequence_as_string?,
+      also_show_numbers         = true,
+      show_translations_aligned = true
+    )
+    if i and i.is_a?(Array) and i.empty?
+      i = dna_sequence_as_string?
+    end
+    i = dna_sequence_as_string? if i.nil?
+    i = i.join(' ').strip if i.is_a? Array
+    i = i.to_s.dup # To avoid nil-operations.
+    i.delete!('-') if i.include? '-'
+    if i.empty? # This means that the user has not yet assigned a DNA sequence.
+      erev 'Please assign some DNA sequence. You can also randomly generate'
+      erev 'a new sequence via "random".'
+      return
+    end
+    cliner
+    erev N+'The amino acid sequence for '+sfancy('Frame 1')+rev+' is: '
+    e
+    converted_sequence_for_frame_1 = translate_dna_into_aminoacid(i).to_s
+    erev '  '+converted_sequence_for_frame_1+N+N
+    # ======================================================================= #
+    # === Also show numbers
+    # ======================================================================= #
+    if also_show_numbers
+      verbose_report_numbered_amino_acid_sequence(converted_sequence_for_frame_1)
+    end
+    cliner
+    if i && i.size > 2
+      erev N+N+'The amino acid sequence for '+sfancy('Frame 2')+rev+' is: '
+      e
+      converted_sequence_for_frame_2 = translate_dna_into_aminoacid_frame2(i)
+      erev '  '+converted_sequence_for_frame_2+N+N
+      if also_show_numbers
+        verbose_report_numbered_amino_acid_sequence(converted_sequence_for_frame_2, '2')
+      end
+      cliner
+      e
+      erev N+N+'The amino acid sequence for '+sfancy('Frame 3')+rev+' is: '
+      e
+      converted_sequence_for_frame_3 = translate_dna_into_aminoacid_frame3(i)
+      erev '  '+converted_sequence_for_frame_3+N+N
+      if also_show_numbers
+        verbose_report_numbered_amino_acid_sequence(converted_sequence_for_frame_3, '3')
+      end
+      e
+      cliner
+      if show_translations_aligned
+        showorf(i) # Delegate into class Showorf here.
+      end
+    end
+  end
+
+  # ========================================================================= #
+  # === show_blosum_matrix
+  #
+  # Delegate towards bioroebe here, and invoke the .blosum() method.
+  # ========================================================================= #
+  def show_blosum_matrix
+    erev 'Showing the blosum matrix next:'
+    require 'bioroebe/blosum/blosum.rb'
+    Bioroebe::Blosum.show_matrix
+  end
+
+end; end