wwood-bioruby 1.2.11

data/lib/bio/io/ebisoap.rb

@@ -0,0 +1,158 @@
+#
+# = bio/io/emblsoap.rb - EBI SOAP server access class
+#
+# Copyright::  Copyright (C) 2006
+#              Toshiaki Katayama <k@bioruby.org>
+# License::    The Ruby License
+#
+# $Id: ebisoap.rb,v 1.3 2007/04/05 23:35:41 trevor Exp $
+#
+
+require 'bio/io/soapwsdl'
+
+module Bio
+class EBI
+
+class SOAP < Bio::SOAPWSDL
+
+  BASE_URI = "http://www.ebi.ac.uk/Tools/webservices/wsdl/"
+
+  # set default to Dbfetch
+  SERVER_URI = BASE_URI + "WSDbfetch.wsdl"
+
+  def initialize(wsdl = nil)
+    super(wsdl || self.class::SERVER_URI)
+  end
+
+  # * fetchData
+  # * getSupportedDBs
+  # * getSupportedFormats
+  # * getSupportedStyles
+  class Dbfetch < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSDbfetch.wsdl"
+  end
+
+  # * checkStatus
+  # * doIprscan
+  # * getResults
+  # * poll
+  # * polljob
+  # * runInterProScan
+  # * test
+  class InterProScan < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSInterProScan.wsdl"
+  end
+
+  # * checkStatus
+  # * getInfo
+  # * getResults
+  # * getTools
+  # * poll
+  # * run
+  # * test
+  class Emboss < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSEmboss.wsdl"
+  end
+
+  # * checkStatus
+  # * getResults
+  # * poll
+  # * runClustalW
+  # * test
+  class ClustalW < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSClustalW.wsdl"
+  end
+
+  # * checkStatus
+  # * getResults
+  # * poll
+  # * runTCoffee
+  class TCoffee < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSTCoffee.wsdl"
+  end
+
+  # * checkStatus
+  # * getResults
+  # * poll
+  # * runMuscle
+  # * test
+  class Muscle < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSMuscle.wsdl"
+  end
+
+  # * checkStatus
+  # * doFasta
+  # * getResults
+  # * poll
+  # * polljob
+  # * runFasta
+  class Fasta < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSFasta.wsdl"
+  end
+
+  # * checkStatus
+  # * doWUBlast
+  # * getIds
+  # * getResults
+  # * poll
+  # * polljob
+  # * runWUBlast
+  # * test
+  class WUBlast < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSWUBlast.wsdl"
+  end
+
+  # * checkStatus
+  # * getResults
+  # * poll
+  # * runMPsrch
+  # * test
+  class MPsrch < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSMPsrch.wsdl"
+  end
+
+  # * checkStatus
+  # * getResults
+  # * poll
+  # * runScanPS
+  # * test
+  class ScanPS < Bio::EBI::SOAP
+    SERVER_URI = BASE_URI + "WSScanPS.wsdl"
+  end
+
+  class MSD < Bio::EBI::SOAP
+    SERVER_URI = "http://www.ebi.ac.uk/msd-srv/docs/api/msd_soap_service.wsdl"
+  end
+
+  class Ontology < Bio::EBI::SOAP
+    SERVER_URI = "http://www.ebi.ac.uk/ontology-lookup/OntologyQuery.wsdl"
+  end
+
+  class Citation < Bio::EBI::SOAP
+    SERVER_URI = "http://www.ebi.ac.uk/citations/webservices/wsdl"
+  end
+
+end # SOAP
+
+end # EBI
+end # Bio
+
+
+
+if __FILE__ == $0
+  serv = Bio::EBI::SOAP::Dbfetch.new
+  p serv.getSupportedDBs
+
+  require 'base64'
+
+  serv = Bio::EBI::SOAP::Emboss.new
+  hash = {"tool" => "water",
+          "asequence" => "uniprot:alk1_human",
+          "bsequence" => "uniprot:alk1_mouse",
+          "email" => "ebisoap@example.org"}
+  poll = serv.run(hash, [])
+  puts poll
+  base = serv.poll(poll, "tooloutput")
+  puts Base64.decode64(base)  
+end
+

data/lib/bio/io/ensembl.rb

@@ -0,0 +1,229 @@
+#
+# = bio/io/ensembl.rb - An Ensembl Genome Browser client.
+#
+# Copyright::   Copyright (C) 2006
+#               Mitsuteru C. Nakao <n@bioruby.org>
+# License::     The Ruby License
+#
+# $Id:$
+#
+# == Description
+#
+# Client classes for Ensembl Genome Browser.
+#
+# == Examples
+#
+#  human = Bio::Ensembl.new('Homo_sapiens')
+#  seq = human.exportview(1, 1000, 100000)
+#  gff = human.exportview(1, 1000, 100000, ['gene', 'variation', 'genscan'])
+#
+#  human = Bio::Ensembl.human
+#  seq = human.exportview(1, 1000, 100000)
+#  gff = human.exportview(1, 1000, 100000, ['gene'])
+#
+#  seq = Bio::Ensembl.human.exportview(1, 1000, 100000)
+#  gff = Bio::Ensembl.human.exportview(1, 1000, 100000, ['gene', 'variation', 'genscan'])
+#
+#  
+# == References
+#
+# * Ensembl
+#   http:/www.ensembl.org/
+#
+
+require 'bio/command'
+
+module Bio
+
+# == Description
+#
+# An Ensembl Genome Browser client class.
+#
+# == Examples
+#
+#  human = Bio::Ensembl.new('Homo_sapiens')
+#  seq = human.exportview(1, 1000, 100000)
+#  gff = human.exportview(1, 1000, 100000, ['gene'])
+#
+#  mouse = Bio::Ensembl.new('Mus_musculus')
+#  seq = mouse.exportview(1, 1000, 100000)
+#  gff = mouse.exportview(1, 1000, 100000, ['gene', 'variation', 'genscan'])
+#
+#  rice = Bio::Enesmbl.new('Oryza_sativa', 'http://www.gramene.org')
+#  seq = rice.exportview(1, 1000, 100000)
+#
+# == References
+#
+# * Ensembl
+#   http:/www.ensembl.org/
+#
+# * GRAMENE
+#   http://www.gramene.org/
+#
+class Ensembl
+  
+  ENSEMBL_URL = 'http://www.ensembl.org'
+
+  # Server URL (ex. 'http://www.ensembl.org')
+  attr_reader :server
+
+  # Organism name. (ex. 'Homo_sapiens').
+  attr_reader :organism
+
+  def initialize(organism, server = nil)
+    @server = server || ENSEMBL_URL
+    @organism = organism
+    @uri = [ @server.chomp('/'), @organism ].join('/')
+  end
+
+  def self.human
+    self.new("Homo_sapiens")
+  end
+
+  def self.mouse
+    self.new("Mus_musculus")
+  end
+
+  # Ensembl ExportView Client.
+  #
+  # Retrieve genomic sequence/features from Ensembl ExportView in plain text.
+  # Ensembl ExportView exports genomic data (sequence and features) in 
+  # several file formats including fasta, GFF and tab.
+  #
+  # * ExportViwe (http://www.ensembl.org/Homo_sapiens/exportview).
+  #
+  # == Examples
+  #
+  #   human = Bio::Ensembl.new('Homo_sapiens')
+  #     or
+  #   human = Bio::Ensembl.human
+  #
+  #   # Genomic sequence in Fasta format
+  #   human.exportview(:seq_region_name => 1, 
+  #                    :anchor1 => 1149206, :anchor2 => 1149229)
+  #   human.exportview(1, 1149206, 1149229)
+  #
+  #   # Feature in GFF
+  #   human.exportview(:seq_region_name => 1, 
+  #                    :anchor1 => 1149206, :anchor2 => 1150000, 
+  #                    :options => ['similarity', 'repeat', 
+  #                                 'genscan', 'variation', 'gene'])
+  #   human.exportview(1, 1149206, 1150000, ['variation', 'gene'])
+  #   
+  # Feature in TAB
+  #   human.exportview(:seq_region_name => 1, 
+  #                    :anchor1 => 1149206, :anchor2 => 1150000, 
+  #                    :options => ['similarity', 'repeat', 
+  #                                 'genscan', 'variation', 'gene'],
+  #                    :format => 'tab')
+  #
+  # == Arguments
+  #
+  # Bio::Ensembl#exportview method allow both orderd arguments and 
+  # named arguments. (Note: mandatory arguments are marked by '*').
+  #
+  # === Orderd Arguments
+  #
+  # 1. seq_region_name - Chromosome number (*)
+  # 2. anchor1         - From coordination (*)
+  # 3. anchor2         - To coordination (*)
+  # 4. options         - Features to export (in :format => 'gff' or 'tab')
+  #                      ['similarity', 'repeat', 'genscan', 'variation', 
+  #                       'gene']
+  #
+  # === Named Arguments
+  # 
+  # * :seq_region_name - Chromosome number (*)
+  # * :anchor1         - From coordination (*)
+  # * :anchor2         - To coordination (*)
+  # * :type1           - From coordination type ['bp', ]
+  # * :type2           - To coordination type ['bp', ]
+  # * :upstream        - Bp upstream
+  # * :downstream      - Bp downstream
+  # * :format          - File format ['fasta', 'gff', 'tab']
+  # * :options         - Features to export (for :format => 'gff' or 'tab')
+  #                      ['similarity', 'repeat', 'genscan', 'variation', 
+  #                       'gene']
+  # 
+  def exportview(*args)
+    defaults = {
+      :type1 => 'bp', 
+      :type2 => 'bp', 
+      :downstream => '', 
+      :upstream => '', 
+      :format => 'fasta',
+      :options => [],
+      :action => 'export', 
+      :_format => 'Text', 
+      :output => 'txt', 
+      :submit => 'Continue >>'
+    }
+
+    if args.first.class == Hash
+      options = args.first
+      if options[:options] and options[:format] != 'fasta' and options[:format] != 'tab' 
+        options.update({:format => 'gff'}) 
+      end
+    else
+      options = {
+        :seq_region_name => args[0], 
+        :anchor1 => args[1], 
+        :anchor2 => args[2],
+      }
+
+      case args[3]
+      when Array
+        options.update({:format => 'gff', :options => args[3]}) 
+      when Hash
+        options.update(args[3])
+      end
+
+      if args[4].class == Hash
+        options.update(args[4])
+      end
+    end
+
+    params = defaults.update(options)
+
+    result = Bio::Command.post_form("#{@uri}/exportview", params)
+
+    return result.body
+  end
+
+end # class Ensembl
+
+end # module Bio
+
+
+
+# Codes for backward-compatibility.
+#
+class Bio::Ensembl
+  EBIServerURI = ENSEMBL_URL
+
+  def self.server_uri(uri = nil)
+    if uri
+      @uri = uri
+    else
+      @uri || EBIServerURI
+    end
+  end
+    
+  class Base
+    def self.exportview(*args)
+      Bio::Ensembl.new(Organism).exportview(*args)
+    end
+  end
+  
+  class Human < Base
+    Organism = Bio::Ensembl.human.organism
+  end
+  
+  class Mouse < Base
+    Organism = Bio::Ensembl.mouse.organism
+  end
+end # class Bio::Ensembl
+
+
+
+

data/lib/bio/io/fastacmd.rb

@@ -0,0 +1,163 @@
+#
+# = bio/io/fastacmd.rb - NCBI fastacmd wrapper class
+#
+# Copyright::  Copyright (C) 2005, 2006
+#              Shuji SHIGENOBU <shige@nibb.ac.jp>,
+#              Toshiaki Katayama <k@bioruby.org>,
+#              Mitsuteru C. Nakao <n@bioruby.org>,
+#              Jan Aerts <jan.aerts@bbsrc.ac.uk>
+# License::    The Ruby License
+#
+# $Id: fastacmd.rb,v 1.16 2007/04/05 23:35:41 trevor Exp $
+#
+
+require 'bio/db/fasta'
+require 'bio/io/flatfile'
+require 'bio/command'
+
+module Bio
+class Blast
+
+# = DESCRIPTION
+#
+# Retrieves FASTA formatted sequences from a blast database using 
+# NCBI fastacmd command.
+# 
+# This class requires 'fastacmd' command and a blast database  
+# (formatted using the '-o' option of 'formatdb').
+#
+# = USAGE
+#  require 'bio'
+#  
+#  fastacmd = Bio::Blast::Fastacmd.new("/db/myblastdb")
+#
+#  entry = fastacmd.get_by_id("sp:128U_DROME")
+#  fastacmd.fetch("sp:128U_DROME")
+#  fastacmd.fetch(["sp:1433_SPIOL", "sp:1432_MAIZE"])
+#
+#  fastacmd.fetch(["sp:1433_SPIOL", "sp:1432_MAIZE"]).each do |fasta|
+#    puts fasta
+#  end
+#
+# = REFERENCES
+#
+# * NCBI tool
+#   ftp://ftp.ncbi.nih.gov/blast/executables/LATEST/ncbi.tar.gz
+#
+# * fastacmd.html
+#   http://biowulf.nih.gov/apps/blast/doc/fastacmd.html
+#
+class Fastacmd
+
+  include Enumerable
+
+  # Database file path.
+  attr_accessor :database
+
+  # fastacmd command file path.
+  attr_accessor :fastacmd
+
+  # This method provides a handle to a BLASTable database, which you can then
+  # use to retrieve sequences.
+  # 
+  # Prerequisites:
+  # * You have created a BLASTable database with the '-o T' option.
+  # * You have the NCBI fastacmd tool installed.
+  #
+  # For example, suppose the original input file looks like:
+  #  >my_seq_1
+  #  ACCGACCTCCGGAACGGATAGCCCGACCTACG
+  #  >my_seq_2
+  #  TCCGACCTTTCCTACCGCACACCTACGCCATCAC
+  #  ...
+  # and you've created a BLASTable database from that with the command
+  #  cd /my_dir/
+  #  formatdb -i my_input_file -t Test -n Test -o T
+  # then you can get a handle to this database with the command
+  #  fastacmd = Bio::Blast::Fastacmd.new("/my_dir/Test")
+  # ---
+  # *Arguments*:
+  # * _database_:: path and name of BLASTable database
+  def initialize(blast_database_file_path)
+    @database = blast_database_file_path
+    @fastacmd = 'fastacmd'
+  end
+
+
+  # Get the sequence of a specific entry in the BLASTable database.
+  # For example:
+  #  entry = fastacmd.get_by_id("sp:128U_DROME")
+  # ---
+  # *Arguments*:
+  # * _id_: id of an entry in the BLAST database
+  # *Returns*:: a Bio::FastaFormat object
+  def get_by_id(entry_id)
+    fetch(entry_id).shift
+  end
+
+  # Get the sequence for a _list_ of IDs in the database.
+  #
+  # For example:
+  #  p fastacmd.fetch(["sp:1433_SPIOL", "sp:1432_MAIZE"])
+  #
+  # This method always returns an array of Bio::FastaFormat objects, even when 
+  # the result is a single entry.
+  # ---
+  # *Arguments*:
+  # * _ids_: list of IDs to retrieve from the database
+  # *Returns*:: array of Bio::FastaFormat objects
+  def fetch(list)
+    if list.respond_to?(:join)
+      entry_id = list.join(",")
+    else
+      entry_id = list
+    end
+
+    cmd = [ @fastacmd, '-d', @database, '-s', entry_id ]
+    Bio::Command.call_command(cmd) do |io|
+      io.close_write
+      Bio::FlatFile.new(Bio::FastaFormat, io).to_a
+    end
+  end
+
+  # Iterates over _all_ sequences in the database.
+  #
+  #  fastacmd.each_entry do |fasta|
+  #    p [ fasta.definition[0..30], fasta.seq.size ]
+  #  end
+  # ---
+  # *Returns*:: a Bio::FastaFormat object for each iteration
+  def each_entry
+    cmd = [ @fastacmd, '-d', @database, '-D', '1' ]
+    Bio::Command.call_command(cmd) do |io|
+      io.close_write
+      Bio::FlatFile.open(Bio::FastaFormat, io) do |f|
+        f.each_entry do |entry|
+          yield entry
+        end
+      end
+    end
+    self
+  end
+  alias each each_entry
+
+end # class Fastacmd
+
+end # class Blast
+end # module Bio
+
+if $0 == __FILE__
+  fastacmd = Bio::Blast::Fastacmd.new("/path_to_my_db/db_name")
+  seq = fastacmd.get_by_id('id_of_entry1')
+  puts seq.class
+  puts seq
+  
+  seqs = fastacmd.fetch(['id_of_entry1','id_of_entry2'])
+  seqs.each do |seq|
+    puts seq
+  end
+
+  fastacmd.each_entry do |fasta|
+    puts fasta.seq.size.to_s + "\t" + fasta.definition
+  end
+end