wwood-bioruby 1.2.11

data/test/unit/bio/io/flatfile/test_buffer.rb

@@ -0,0 +1,251 @@
+#
+# = test/unit/bio/io/flatfile/test_buffer.rb - unit test for Bio::FlatFile::BufferedInputStream
+#
+#   Copyright (C) 2006 Naohisa Goto <ng@bioruby.org>
+#
+# License:: The Ruby License
+#
+#  $Id:$
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio'
+require 'stringio'
+
+module Bio::TestFlatFileBufferedInputStream
+
+  bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5)).cleanpath.to_s
+  TestDataPath = Pathname.new(File.join(bioruby_root, 'test', 'data')).cleanpath.to_s
+  TestDataFastaFormat01 = File.join(TestDataPath, 'fasta', 'example1.txt')
+
+  class TestBufferedInputStreamClassMethod < Test::Unit::TestCase
+
+    def test_self_for_io
+      io = File.open(TestDataFastaFormat01)
+      obj = Bio::FlatFile::BufferedInputStream.for_io(io)
+      assert_instance_of(Bio::FlatFile::BufferedInputStream, obj)
+      assert_equal(TestDataFastaFormat01, obj.path)
+    end
+
+    def test_self_open_file
+      obj = Bio::FlatFile::BufferedInputStream.open_file(TestDataFastaFormat01)
+      assert_instance_of(Bio::FlatFile::BufferedInputStream, obj)
+      assert_equal(TestDataFastaFormat01, obj.path)
+    end
+
+    def test_self_open_file_with_block
+      obj2 = nil
+      Bio::FlatFile::BufferedInputStream.open_file(TestDataFastaFormat01) do |obj|
+        assert_instance_of(Bio::FlatFile::BufferedInputStream, obj)
+        assert_equal(TestDataFastaFormat01, obj.path)
+        obj2 = obj
+      end
+      assert_raise(IOError) { obj2.close }
+    end
+  end #class TestBufferedInputStreamClassMethod
+
+  class TestBufferedInputStream < Test::Unit::TestCase
+    def setup
+      io = File.open(TestDataFastaFormat01)
+      path = TestDataFastaFormat01
+      @obj = Bio::FlatFile::BufferedInputStream.new(io, path)
+    end
+
+    def test_to_io
+      assert_kind_of(IO, @obj.to_io)
+    end
+
+    def test_close
+      assert_nil(@obj.close)
+    end
+
+    def test_rewind
+      @obj.prefetch_gets
+      @obj.rewind
+      assert_equal('', @obj.prefetch_buffer)
+    end
+
+    def test_pos
+      @obj.gets
+      @obj.gets
+      @obj.prefetch_gets
+      assert_equal(117, @obj.pos) #the number depends on original data
+    end
+
+    def test_pos=()
+      str = @obj.gets
+      assert_equal(0, @obj.pos = 0)
+    end
+      
+    def test_eof_false_first
+      assert_equal(false, @obj.eof?)
+    end
+
+    def test_eof_false_after_prefetch
+      while @obj.prefetch_gets; nil; end
+      assert_equal(false, @obj.eof?)
+    end
+
+    def test_eof_true
+      while @obj.gets; nil; end
+      assert_equal(true, @obj.eof?)
+    end
+
+    def test_gets
+      @obj.gets
+      @obj.gets
+      assert_equal("gagcaaatcgaaaaggagagatttctgcatatcaagagaaaattcgagctgagatacattccaagtgtggctactc", @obj.gets.chomp)
+    end
+
+    def test_gets_equal_prefetch_gets
+      @obj.prefetch_gets
+      str = @obj.prefetch_gets
+      @obj.prefetch_gets
+      @obj.gets
+      assert_equal(@obj.gets, str)
+    end
+
+    def test_gets_rs
+      rs = 'tggtg'
+      str = <<__END_OF_STR__
+aggcactagaattgagcagtgaa
+gaagatgaggaagatgaagaagaagatgaggaagaaatcaagaaagaaaaatgcgaattttctgaagatgtagacc
+gatttatatggacggttgggcaggactatggtttggatgatctggtcgtgcggcgtgctctcgccaagtacctcga
+agtggatgtttcggacatattggaaagatacaatgaactcaagcttaagaatgatggaactgctggtg
+__END_OF_STR__
+      @obj.gets(rs)
+      @obj.gets(rs)
+      assert_equal(str.chomp, @obj.gets(rs))
+    end
+
+    def test_gets_rs_equal_prefetch_gets
+      rs = 'tggtg'
+      @obj.prefetch_gets(rs)
+      str = @obj.prefetch_gets(rs)
+      @obj.prefetch_gets(rs)
+      @obj.gets(rs)
+      assert_equal(@obj.gets(rs), str)
+    end
+
+    def test_gets_rs_within_buffer
+      rs = 'tggtg'
+      a = []
+      20.times {a.push @obj.gets }
+      @obj.ungets(a.join(''))
+      
+      assert_equal(">At1g02580 mRNA (2291 bp) UTR's and CDS\naggcgagtggttaatggagaaggaaaaccatgaggacgatggtg", @obj.gets(rs))
+
+      assert_equal('ggctgaaagtgattctgtgattggtaagagacaaatctattatttgaatggtg',
+                   @obj.gets(rs).split(/\n/)[-1])
+
+      assert_equal('aggcactagaattgagcagtgaa',
+                   @obj.gets(rs).split(/\n/)[0])
+
+      assert_equal('aggcttct', @obj.gets(rs).split(/\n/)[0])
+
+      assert_equal('agacacc', @obj.gets(rs).split(/\n/)[0])
+    end
+
+    def test_gets_paragraph_mode
+      @obj.gets('')
+      @obj.gets('')
+      assert_equal('>At1g65300: mRNA 837bp (shortened at end)',
+                   @obj.gets('').split(/\n/)[0])
+    end
+
+    def test_gets_paragraph_mode_equal_prefetch_gets
+      rs = ''
+      @obj.prefetch_gets(rs)
+      str = @obj.prefetch_gets(rs)
+      @obj.prefetch_gets(rs)
+      @obj.gets(rs)
+      assert_equal(@obj.gets(rs), str)
+    end
+
+    def test_gets_paragraph_mode_within_buffer
+      @obj.gets('')
+      a = []
+      20.times {a.push @obj.gets }
+      @obj.ungets(a.join(''))
+     
+      assert_equal('>At1g65300: mRNA 837bp',
+                   @obj.gets('').split(/\n/)[0])
+
+      assert_equal('>At1g65300: mRNA 837bp (shortened at end)',
+                   @obj.gets('').split(/\n/)[0])
+
+      assert_equal('>At1g65300: mRNA 837bp (shortened from start)',
+                   @obj.gets('').split(/\n/)[0])
+    end
+
+    def test_ungets
+      @obj.gets
+      @obj.gets
+      str1 = @obj.gets
+      str2 = @obj.gets
+      assert_nil(@obj.ungets(str2))
+      assert_nil(@obj.ungets(str1))
+      assert_equal(str1, @obj.gets)
+      assert_equal(str2, @obj.gets)
+    end
+
+    def test_getc
+      assert_equal(?>, @obj.getc)
+    end
+
+    def test_getc_after_prefetch
+      @obj.prefetch_gets
+      assert_equal(?>, @obj.getc)
+    end
+
+    def test_ungetc
+      c = @obj.getc
+      assert_nil(@obj.ungetc(c))
+      assert_equal(c, @obj.getc)
+    end
+
+    def test_ungetc_after_prefetch
+      str = @obj.prefetch_gets
+      c = @obj.getc
+      assert_nil(@obj.ungetc(c))
+      assert_equal(str, @obj.gets)
+    end
+
+    def test_prefetch_buffer
+      str = @obj.prefetch_gets
+      str += @obj.prefetch_gets
+      assert_equal(str, @obj.prefetch_buffer)
+    end
+
+    def test_prefetch_gets
+      @obj.prefetch_gets
+      @obj.prefetch_gets
+      @obj.gets
+      str = @obj.prefetch_gets
+      @obj.gets
+      assert_equal(str, @obj.gets)
+    end
+
+    def test_prefetch_gets_with_arg
+      # test @obj.gets
+      str = @obj.prefetch_gets("\n>")
+      assert_equal(str, @obj.gets("\n>"))
+      # test using IO object
+      io = @obj.to_io
+      io.rewind
+      assert_equal(str, io.gets("\n>"))
+    end
+
+    def test_skip_spaces
+      @obj.gets('CDS')
+      assert_nil(@obj.skip_spaces)
+      assert_equal(?a, @obj.getc)
+    end
+                   
+  end #class TestBufferedInputStream
+end #module Bio::TestFlatFile
+

data/test/unit/bio/io/flatfile/test_splitter.rb

@@ -0,0 +1,369 @@
+#
+# = test/unit/bio/io/flatfile/test_splitter.rb - unit test for Bio::FlatFile::Splitter
+#
+#   Copyright (C) 2008 Naohisa Goto <ng@bioruby.org>
+#
+# License:: The Ruby License
+#
+#  $Id:$
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'stringio'
+
+require 'bio'
+require 'bio/io/flatfile/splitter'
+require 'bio/io/flatfile/buffer'
+
+module Bio::TestFlatFileSplitter
+
+  class TestDataClass
+    # Fake fasta format
+    DELIMITER = RS = "\n>"
+    DELIMITER_OVERRUN = 1 # '>'.length
+    FLATFILE_HEADER = '>'
+    def initialize(str)
+      @str = str
+    end
+    attr_reader :str
+    protected :str
+
+    def ==(other)
+      self.str == other.str
+    end
+  end #class TestDataClass
+
+  TestData01 = <<__END_OF_TESTDATA__
+
+        # This is test
+
+>test1
+aaagggtttcccaaagggtttccc
+>testC
+cccccccccccccccccccccccc
+>testG
+gggggggggggggggggggggggg
+>test2
+tttttttttttttttttttttttt
+tttttttttttttttttttttttt
+
+>test3
+atatatatatatatatatatatat
+__END_OF_TESTDATA__
+  TestData01.chomp!
+  # workaround for Windows
+  TestData01.gsub!(/\r\n/, "\n")
+
+  class TestTemplate < Test::Unit::TestCase
+    def setup
+      @stream = Bio::FlatFile::BufferedInputStream.new(StringIO.new(TestData01), 'TestData01')
+      @obj = Bio::FlatFile::Splitter::Template.new(TestDataClass, @stream)
+    end
+
+    def test_skip_leader
+      assert_raise(NotImplementedError) { @obj.skip_leader }
+    end
+
+    def test_get_entry
+      assert_raise(NotImplementedError) { @obj.get_entry }
+    end
+
+    def test_entry
+      assert_nothing_raised {
+        @obj.instance_eval { self.entry = 'test' } }
+      assert_equal('test', @obj.entry)
+    end
+
+    def test_entry_pos_flag
+      # default is nil or false
+      assert(!@obj.entry_pos_flag)
+
+      # set a value
+      assert_equal(true, @obj.entry_pos_flag = true)
+      assert_equal(true, @obj.entry_pos_flag)
+    end
+
+    def test_entry_start_pos
+      assert_nothing_raised {
+        @obj.instance_eval { self.entry_start_pos = 123 } }
+      assert_equal(123, @obj.entry_start_pos)
+    end
+
+    def test_entry_ended_pos
+      assert_nothing_raised {
+        @obj.instance_eval { self.entry_ended_pos = 456 } }
+      assert_equal(456, @obj.entry_ended_pos)
+    end
+
+    def test_stream
+      assert_equal(@stream, @obj.instance_eval { stream })
+    end
+
+    def test_dbclass
+      assert_equal(TestDataClass, @obj.instance_eval { dbclass })
+    end
+
+    def test_stream_pos
+      assert_nil(@obj.instance_eval { stream_pos })
+      @obj.entry_pos_flag = true
+      assert_equal(0, @obj.instance_eval { stream_pos })
+      @stream.gets
+      assert_not_equal(0, @obj.instance_eval { stream.pos })
+    end
+
+    def test_rewind
+      @obj.entry_pos_flag = true
+      @stream.gets
+      assert_not_equal(0, @stream.pos)
+      @obj.rewind
+      assert_equal(0, @stream.pos)
+    end
+
+  end #class TestTemplate
+
+  class TestDefault < TestTemplate # < Test::Unit::TestCase
+    def setup
+      @stream = Bio::FlatFile::BufferedInputStream.new(StringIO.new(TestData01), 'TestData01')
+      @obj = Bio::FlatFile::Splitter::Default.new(TestDataClass, @stream)
+    end
+
+    def test_delimiter
+      assert_equal("\n>", @obj.delimiter)
+    end
+
+    def test_header
+      assert_equal('>', @obj.header)
+    end
+
+    def test_delimiter_overrun
+      assert_equal(1, @obj.delimiter_overrun)
+    end
+
+    def test_skip_leader
+      assert_nothing_raised { @obj.skip_leader }
+      assert(@stream.pos > 0)
+      assert_equal('>test1', @stream.gets.chomp)
+    end
+
+    def test_skip_leader_without_header
+      @obj.header = nil
+      assert_nothing_raised { @obj.skip_leader }
+      assert(@stream.pos > 0)
+      assert_equal('# This is test', @stream.gets.chomp)
+    end
+
+    def test_get_entry
+      str0 = "\n        # This is test\n\n"
+      str1 = ">test1\naaagggtttcccaaagggtttccc\n"
+      str2 = ">testC\ncccccccccccccccccccccccc\n"
+      str3 = ">testG\ngggggggggggggggggggggggg\n"
+      str4 = ">test2\ntttttttttttttttttttttttt\ntttttttttttttttttttttttt\n\n"
+      str5 = ">test3\natatatatatatatatatatatat"
+      assert_equal(str0, @obj.get_entry)
+      assert_equal(str1, @obj.get_entry)
+      assert_equal(str2, @obj.get_entry)
+      assert_equal(str3, @obj.get_entry)
+      assert_equal(str4, @obj.get_entry)
+      assert_equal(str5, @obj.get_entry)
+      assert(@stream.eof?)
+    end
+
+    def test_get_parsed_entry
+      str1 = ">test1\naaagggtttcccaaagggtttccc\n"
+      str2 = ">testC\ncccccccccccccccccccccccc\n"
+      str3 = ">testG\ngggggggggggggggggggggggg\n"
+      str4 = ">test2\ntttttttttttttttttttttttt\ntttttttttttttttttttttttt\n\n"
+      str5 = ">test3\natatatatatatatatatatatat"
+
+      @obj.skip_leader
+      assert_equal(TestDataClass.new(str1), @obj.get_parsed_entry)
+      assert_equal(TestDataClass.new(str2), @obj.get_parsed_entry)
+      assert_equal(TestDataClass.new(str3), @obj.get_parsed_entry)
+      assert_equal(TestDataClass.new(str4), @obj.get_parsed_entry)
+      assert_equal(TestDataClass.new(str5), @obj.get_parsed_entry)
+      assert(@stream.eof?)
+    end
+
+    def test_entry
+      str1 = ">test1\naaagggtttcccaaagggtttccc\n"
+      @obj.skip_leader
+      @obj.get_entry
+      assert_equal(str1, @obj.entry)
+    end
+
+    def test_entry_start_pos_default_nil
+      @obj.skip_leader
+      @obj.get_entry
+      assert_nil(@obj.entry_start_pos)
+    end
+
+    def test_entry_ended_pos_default_nil
+      @obj.skip_leader
+      @obj.get_entry
+      assert_nil(@obj.entry_ended_pos)
+    end
+
+    def test_entry_start_pos
+      @obj.entry_pos_flag = true
+      @obj.skip_leader
+      @obj.get_entry
+      assert_equal(25, @obj.entry_start_pos)
+    end
+
+    def test_entry_ended_pos
+      @obj.entry_pos_flag = true
+      @obj.skip_leader
+      @obj.get_entry
+      assert_equal(57, @obj.entry_ended_pos)
+    end
+
+  end #class TestDefault
+
+  class TestLineOriented < TestTemplate # < Test::Unit::TestCase
+    testdata02 = <<__END_OF_DATA__
+#this is header line 1
+#this is header line 2
+test01 1 2 3
+test02 4 5 6
+test02 7 8 9
+test02 10 11 12
+test03 13 14 15
+
+test03 16 17 18
+__END_OF_DATA__
+    TestData02 = testdata02.gsub(/\r\n/, "\n")
+
+    class TestData02Class
+      FLATFILE_SPLITTER = Bio::FlatFile::Splitter::LineOriented
+
+      LineData = Struct.new(:name, :data)
+
+      def initialize(str = '')
+        @headers = []
+        @lines = []
+        flag_header = true
+        str.each_line do |line|
+          if flag_header then
+            flag_header = add_header_line(line)
+          end
+          unless flag_header then
+            r = add_line(line)
+          end
+        end
+      end
+
+      attr_reader :headers
+      attr_reader :lines
+
+      def ==(other)
+        self.headers == other.headers and
+          self.lines == other.lines ? true : false
+      end
+
+      def add_header_line(line)
+        #puts "add_header_line: #{@headers.inspect} #{line.inspect}"
+        case line
+        when /\A\#/
+          @headers.push line
+          return self
+        else
+          return false
+        end
+      end
+
+      def add_line(line)
+        #puts "add_line: #{@lines.inspect} #{line.inspect}"
+        if /\A\s*\z/ =~ line then
+          return @lines.empty? ? self : false
+        end
+        parsed = parse_line(line)
+        if @lines.empty? or @lines.first.name == parsed.name then
+          @lines.push parsed
+          return self
+        else
+          return false
+        end
+      end
+
+      def parse_line(line)
+        LineData.new(*(line.chomp.split(/\s+/, 2)))
+      end
+      private :parse_line
+
+    end #class TestData02Class
+
+    def setup
+      @stream = Bio::FlatFile::BufferedInputStream.new(StringIO.new(TestData02), 'TestData02')
+      @obj = Bio::FlatFile::Splitter::LineOriented.new(TestData02Class, @stream)
+      @raw_entries =
+        [
+         "#this is header line 1\n#this is header line 2\ntest01 1 2 3\n",
+         "test02 4 5 6\ntest02 7 8 9\ntest02 10 11 12\n",
+         "test03 13 14 15\n",
+         "\ntest03 16 17 18\n",
+        ]
+      @entries = @raw_entries.collect do |str|
+        TestData02Class.new(str)
+      end
+    end
+
+    def test_get_parsed_entry
+      @entries.each do |ent|
+        assert_equal(ent, @obj.get_parsed_entry)
+      end
+      assert_nil(@obj.get_parsed_entry)
+    end
+
+    def test_get_entry
+      @raw_entries.each do |raw|
+        assert_equal(raw, @obj.get_entry)
+      end
+      assert_nil(@obj.get_entry)
+    end
+
+    def test_rewind
+      while @obj.get_parsed_entry; end
+      assert_equal(0, @obj.rewind)
+    end
+
+    def test_flag_to_fetch_header
+      assert(@obj.instance_eval { flag_to_fetch_header })
+      @obj.get_parsed_entry
+      assert(!@obj.instance_eval { flag_to_fetch_header })
+      @obj.rewind
+      assert(@obj.instance_eval { flag_to_fetch_header })
+    end
+
+    def test_skip_leader
+      assert_nil(@obj.skip_leader)
+    end
+
+    def test_dbclass
+      assert_equal(TestData02Class, @obj.instance_eval { dbclass })
+    end
+
+    def test_entry_start_pos
+      @obj.entry_pos_flag = true
+      @obj.skip_leader
+      @obj.get_entry
+      assert_equal(0, @obj.entry_start_pos)
+      @obj.get_entry
+      assert_equal(59, @obj.entry_start_pos)
+    end
+
+    def test_entry_ended_pos
+      @obj.entry_pos_flag = true
+      @obj.skip_leader
+      @obj.get_entry
+      assert_equal(59, @obj.entry_ended_pos)
+      @obj.get_entry
+      assert_equal(101, @obj.entry_ended_pos)
+    end
+
+  end #class TestLineOriented
+
+end