wwood-bioruby 1.2.11

data/lib/bio/db/kegg/taxonomy.rb

@@ -0,0 +1,331 @@
+#
+# = bio/db/kegg/taxonomy.rb - KEGG taxonomy parser class
+#
+# Copyright::  Copyright (C) 2007 Toshiaki Katayama <k@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: taxonomy.rb,v 1.2 2007/07/09 10:29:16 k Exp $
+#
+
+module Bio
+class KEGG
+
+# == Description
+#
+# Parse the KEGG 'taxonomy' file which describes taxonomic classification
+# of organisms.
+#
+# == References
+#
+# The KEGG 'taxonomy' file is available at
+#
+# * ftp://ftp.genome.jp/pub/kegg/genes/taxonomy
+#
+class Taxonomy
+
+  def initialize(filename, orgs = [])
+    # Stores the taxonomic tree as a linked list (implemented in Hash), so
+    # every node need to have unique name (key) to work correctly
+    @tree = Hash.new
+
+    # Also stores the taxonomic tree as a list of arrays (full path)
+    @path = Array.new
+
+    # Also stores all leaf nodes (organism codes) of every intermediate nodes
+    @leaves = Hash.new
+
+    # tentative name for the root node (use accessor to change)
+    @root = 'Genes'
+
+    hier = Array.new
+    level = 0
+    label = nil
+
+    File.open(filename).each do |line|
+      next if line.strip.empty?
+
+      # line for taxonomic hierarchy (indent according to the number of # marks)
+      if line[/^#/]
+	level = line[/^#+/].length
+	label = line[/[A-z].*/]
+	hier[level] = sanitize(label)
+
+      # line for organims name (unify different strains of a species)
+      else
+	tax, org, name, desc = line.chomp.split("\t")
+        if orgs.nil? or orgs.empty? or orgs.include?(org)
+          species, strain, = name.split('_')
+          # (0) Grouping of the strains of the same species.
+          #  If the name of species is the same as the previous line,
+          #  add the species to the same species group.
+          #   ex. Gamma/enterobacteria has a large number of organisms,
+          #       so sub grouping of strains is needed for E.coli strains etc.
+          #
+          # However, if the species name is already used, need to avoid
+          # collision of species name as the current implementation stores
+          # the tree as a Hash, which may cause the infinite loop.
+          #
+          # (1) If species name == the intermediate node of other lineage
+          #  Add '_sp' to the species name to avoid the conflict (1-1), and if
+          #  'species_sp' is already taken, use 'species_strain' instead (1-2).
+          #   ex. Bacteria/Proteobacteria/Beta/T.denitrificans/tbd
+          #       Bacteria/Proteobacteria/Epsilon/T.denitrificans_ATCC33889/tdn
+          #    -> Bacteria/Proteobacteria/Beta/T.denitrificans/tbd
+          #       Bacteria/Proteobacteria/Epsilon/T.denitrificans_sp/tdn
+          #
+          # (2) If species name == the intermediate node of the same lineage
+          #  Add '_sp' to the species name to avoid the conflict.
+          #   ex. Bacteria/Cyanobacgteria/Cyanobacteria_CYA/cya
+          #       Bacteria/Cyanobacgteria/Cyanobacteria_CYB/cya
+          #       Bacteria/Proteobacteria/Magnetococcus/Magnetococcus_MC1/mgm
+          #    -> Bacteria/Cyanobacgteria/Cyanobacteria_sp/cya
+          #       Bacteria/Cyanobacgteria/Cyanobacteria_sp/cya
+          #       Bacteria/Proteobacteria/Magnetococcus/Magnetococcus_sp/mgm
+          sp_group = "#{species}_sp"
+          if @tree[species]
+            if hier[level+1] == species
+              # case (0)
+            else
+              # case (1-1)
+              species = sp_group
+              # case (1-2)
+              if @tree[sp_group] and hier[level+1] != species
+                species = name
+              end
+            end
+          else
+            if hier[level] == species
+              # case (2)
+              species = sp_group
+            end
+          end
+          # 'hier' is an array of the taxonomic tree + species and strain name.
+          #  ex. [nil, Eukaryotes, Fungi, Ascomycetes, Saccharomycetes] +
+          #      [S_cerevisiae, sce]
+          hier[level+1] = species	# sanitize(species)
+          hier[level+2] = org
+          ary = hier[1, level+2]
+          warn ary.inspect if $DEBUG
+          add_to_tree(ary)
+          add_to_leaves(ary)
+          add_to_path(ary)
+        end
+      end
+    end
+    return tree
+  end
+
+  attr_reader :tree
+  attr_reader :path
+  attr_reader :leaves
+  attr_accessor :root
+
+  def organisms(group)
+    @leaves[group]
+  end
+
+  # Add a new path [node, subnode, subsubnode, ..., leaf] under the root node
+  # and every intermediate nodes stores their child nodes as a Hash.
+  def add_to_tree(ary)
+    parent = @root
+    ary.each do |node|
+      @tree[parent] ||= Hash.new
+      @tree[parent][node] = nil
+      parent = node
+    end
+  end
+
+  # Add a new path [node, subnode, subsubnode, ..., leaf] under the root node
+  # and stores leaf nodes to the every intermediate nodes as an Array.
+  def add_to_leaves(ary)
+    leaf = ary.last
+    ary.each do |node|
+      @leaves[node] ||= Array.new
+      @leaves[node] << leaf
+    end
+  end
+
+  # Add a new path [node, subnode, subsubnode, ..., leaf] under the root node
+  # and stores the path itself in an Array.
+  def add_to_path(ary)
+    @path << ary
+  end
+
+  # Compaction of intermediate nodes of the resulted taxonomic tree.
+  #  - If child node has only one child node (grandchild), make the child of
+  #    grandchild as a grandchild.
+  #  ex.
+  #    Plants / Monocotyledons / grass family / osa
+  #    --> Plants / Monocotyledons / osa
+  #
+  def compact(node = root)
+    # if the node has children
+    if subnodes = @tree[node]
+      # obtain grandchildren for each child
+      subnodes.keys.each do |subnode|
+        if subsubnodes = @tree[subnode]
+          # if the number of grandchild node is 1
+          if subsubnodes.keys.size == 1
+            # obtain the name of the grandchild node
+            subsubnode = subsubnodes.keys.first
+            # obtain the child of the grandchlid node
+            if subsubsubnodes = @tree[subsubnode]
+              # make the child of grandchild node as a chlid of child node
+              @tree[subnode] = subsubsubnodes
+              # delete grandchild node
+              @tree[subnode].delete(subsubnode)
+              warn "--- compact: #{subsubnode} is replaced by #{subsubsubnodes}" if $DEBUG
+              # retry until new grandchild also needed to be compacted.
+              retry
+            end
+          end
+        end
+        # repeat recurseively
+        compact(subnode)
+      end
+    end
+  end
+
+  # Reduction of the leaf node of the resulted taxonomic tree.
+  #  - If the parent node have only one leaf node, replace parent node
+  #    with the leaf node.
+  #  ex.
+  #   Plants / Monocotyledons / osa
+  #   --> Plants / osa
+  #
+  def reduce(node = root)
+    # if the node has children
+    if subnodes = @tree[node]
+      # obtain grandchildren for each child
+      subnodes.keys.each do |subnode|
+        if subsubnodes = @tree[subnode]
+          # if the number of grandchild node is 1
+          if subsubnodes.keys.size == 1
+            # obtain the name of the grandchild node
+            subsubnode = subsubnodes.keys.first
+            # if the grandchild node is a leaf node
+            unless @tree[subsubnode]
+              # make the grandchild node as a child node
+              @tree[node].update(subsubnodes)
+              # delete child node
+              @tree[node].delete(subnode)
+              warn "--- reduce: #{subnode} is replaced by #{subsubnode}" if $DEBUG
+            end
+          end
+        end
+        # repeat recursively
+        reduce(subnode)
+      end
+    end
+  end
+
+  # Traverse the taxonomic tree by the depth first search method
+  # under the given (root or intermediate) node.
+  def dfs(parent, &block)
+    if children = @tree[parent]
+      yield parent, children
+      children.keys.each do |child|
+        dfs(child, &block)
+      end
+    end
+  end
+
+  # Similar to the dfs method but also passes the current level of the nest
+  # to the iterator.
+  def dfs_with_level(parent, &block)
+    @level ||= 0
+    if children = @tree[parent]
+      yield parent, children, @level
+      @level += 1
+      children.keys.each do |child|
+        dfs_with_level(child, &block)
+      end
+      @level -= 1
+    end
+  end
+
+  # Convert the taxonomic tree structure to a simple ascii art.
+  def to_s
+    result = "#{@root}\n"
+    @tree[@root].keys.each do |node|
+      result += ascii_tree(node, "  ")
+    end
+    return result
+  end
+
+  private
+
+  # Helper method for the to_s method.
+  def ascii_tree(node, indent)
+    result = "#{indent}+- #{node}\n"
+    indent += "  "
+    @tree[node].keys.each do |child|
+      if @tree[child]
+        result += ascii_tree(child, indent)
+      else
+        result += "#{indent}+- #{child}\n"
+      end
+    end
+    return result
+  end
+
+  def sanitize(str)
+    str.gsub(/[^A-z0-9]/, '_')
+  end
+
+end # Taxonomy
+
+end # KEGG
+end # Bio
+
+
+
+if __FILE__ == $0
+
+  # Usage:
+  # % wget ftp://ftp.genome.jp/pub/kegg/genes/taxonomy
+  # % ruby taxonomy.rb taxonomy | less -S
+
+  taxonomy = ARGV.shift
+  org_list = ARGV.shift || nil
+
+  if org_list
+    orgs = File.readlines(org_list).map{|x| x.strip}
+  else
+    orgs = nil
+  end
+
+  tree = Bio::KEGG::Taxonomy.new(taxonomy, orgs)
+
+  puts ">>> tree - original"
+  puts tree
+
+  puts ">>> tree - after compact"
+  tree.compact
+  puts tree
+
+  puts ">>> tree - after reduce"
+  tree.reduce
+  puts tree
+
+  puts ">>> path - sorted"
+  tree.path.sort.each do |path|
+    puts path.join("/")
+  end
+
+  puts ">>> group : orgs"
+  tree.dfs(tree.root) do |parent, children|
+    if orgs = tree.organisms(parent)
+      puts "#{parent.ljust(30)} (#{orgs.size})\t#{orgs.join(', ')}"
+    end
+  end
+
+  puts ">>> group : subgroups"
+  tree.dfs_with_level(tree.root) do |parent, children, level|
+    subgroups = children.keys.sort
+    indent = " " * level
+    label  = "#{indent} #{level} #{parent}"
+    puts "#{label.ljust(35)}\t#{subgroups.join(', ')}"
+  end
+
+end

data/lib/bio/db/lasergene.rb

@@ -0,0 +1,209 @@
+#
+# bio/db/lasergene.rb - Interface for DNAStar Lasergene sequence file format
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2007 Center for Biomedical Research Informatics, University of Minnesota (http://cbri.umn.edu)
+# License::   The Ruby License
+#
+#  $Id: lasergene.rb,v 1.3 2007/04/05 23:35:40 trevor Exp $
+#
+
+module Bio #:nodoc:
+
+#
+# bio/db/lasergene.rb - Interface for DNAStar Lasergene sequence file format
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2007 Center for Biomedical Research Informatics, University of Minnesota (http://cbri.umn.edu)
+# License::   The Ruby License
+#
+# = Description
+#
+# Bio::Lasergene reads DNAStar Lasergene formatted sequence files, or +.seq+ 
+# files.  It only expects to find one sequence per file.
+#
+# = Usage
+#
+#   require 'bio'
+#   filename = 'MyFile.seq'
+#   lseq = Bio::Lasergene.new( IO.readlines(filename) )
+#   lseq.entry_id  # => "Contig 1"
+#   lseq.seq  # => ATGACGTATCCAAAGAGGCGTTACC
+#
+# = Comments
+# 
+# I'm only aware of the following three kinds of Lasergene file formats.  Feel
+# free to send me other examples that may not currently be accounted for.
+#
+# File format 1:
+# 
+#   ## begin ##
+#   "Contig 1" (1,934)
+#     Contig Length:                  934 bases
+#     Average Length/Sequence:        467 bases
+#     Total Sequence Length:         1869 bases
+#     Top Strand:                       2 sequences
+#     Bottom Strand:                    2 sequences
+#     Total:                            4 sequences
+#   ^^
+#   ATGACGTATCCAAAGAGGCGTTACCGGAGAAGAAGACACCGCCCCCGCAGTCCTCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCGTCCACCCCCGCCACAGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAWCACCCGCCTATCCCGCAYCTTCGGAWRTACTATCAAGCGAACCACAGTCAGAACGCCCTCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAATGGGCTCCAGTGCTGWTATTCTAGMTGATRRCTTKGTAACAAAGRCCACAGCCCTCACCTATGACCCCTATGTAAACTTCTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCRCTCCCGYTACTTTACCCCCAAACCTGTCCTWGATKCCACTATKGATKACTKCCAACCAAACAACAAAAGAAACCAGCTGTGGSTGAGACTACAWACTGCTGGAAATGTAGACCWCGTAGGCCTSGGCACTGCGTKCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTMACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCRCTTMACCCKTAATGAATAATAAMAACCATTACGAAGTGATAAAAWAGWCTCAGTAATTTATTYCATATGGAAATTCWSGGCATGGGGGGGAAAGGGTGACGAACKKGCCCCCTTCCTCCSTSGMYTKTTCYGTAGCATTCYTCCAMAAYACCWAGGCAGYAMTCCTCCSATCAAGAGcYTSYACAGCTGGGACAGCAGTTGAGGAGGACCATTCAAAGGGGGTCGGATTGCTGGTAATCAGA
+#   ## end ##
+# 
+# 
+# File format 2:
+# 
+#   ## begin ##
+#   ^^:                                  350,935
+#   Contig 1 (1,935)
+#     Contig Length:                  935 bases
+#     Average Length/Sequence:        580 bases
+#     Total Sequence Length:         2323 bases
+#     Top Strand:                       2 sequences
+#     Bottom Strand:                    2 sequences
+#     Total:                            4 sequences
+#   ^^
+#   ATGTCGGGGAAATGCTTGACCGCGGGCTACTGCTCATCATTGCTTTCTTTGTGGTATATCGTGCCGTTCTGTTTTGCTGTGCTCGTCAACGCCAGCGGCGACAGCAGCTCTCATTTTCAGTCGATTTATAACTTGACGTTATGTGAGCTGAATGGCACGAACTGGCTGGCAGACAACTTTAACTGGGCTGTGGAGACTTTTGTCATCTTCCCCGTGTTGACTCACATTGTTTCCTATGGTGCACTCACTACCAGTCATTTTCTTGACACAGTTGGTCTAGTTACTGTGTCTACCGCCGGGTTTTATCACGGGCGGTACGTCTTGAGTAGCATCTACGCGGTCTGTGCTCTGGCTGCGTTGATTTGCTTCGCCATCAGGTTTGCGAAGAACTGCATGTCCTGGCGCTACTCTTGCACTAGATACACCAACTTCCTCCTGGACACCAAGGGCAGACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAAAGGGGGTAAGGTTGAGGTCGAAGGTCATCTGATCGATCTCAAAAGAGTTGTGCTTGATGGCTCTGTGGCGACACCTTTAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCCTAGACGACTTTTGCCATGATAGTACAGCCCCACAGAAGGTGCTCTTGGCGTTTTCCATCACCTACACGCCAGTGATGATATATGCCCTAAAGGTAAGCCGCGGCCGACTTTTGGGGCTTCTGCACCTTTTGATTTTTTTGAACTGTGCCTTTACTTTCGGGTACATGACATTCGTGCACTTTCGGAGCACGAACAAGGTCGCGCTCACTATGGGAGCAGTAGTCGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTG
+#   ## end ##
+# 
+# File format 3 (non-standard Lasergene header):
+# 
+#   ## begin ##
+#   LOCUS       PRU87392               15411 bp    RNA     linear   VRL 17-NOV-2000
+#   DEFINITION  Porcine reproductive and respiratory syndrome virus strain VR-2332,
+#               complete genome.
+#   ACCESSION   U87392 AF030244 U00153
+#   VERSION     U87392.3  GI:11192298
+#   [...cut...]
+#        3'UTR           15261..15411
+#        polyA_site      15409
+#   ORIGIN      
+#   ^^
+#   atgacgtataggtgttggctctatgccttggcatttgtattgtcaggagctgtgaccattggcacagcccaaaacttgctgcacagaaacacccttctgtgatagcctccttcaggggagcttagggtttgtccctagcaccttgcttccggagttgcactgctttacggtctctccacccctttaaccatgtctgggatacttgatcggtgcacgtgtacccccaatgccagggtgtttatggcggagggccaagtctactgcacacgatgcctcagtgcacggtctctccttcccctgaacctccaagtttctgagctcggggtgctaggcctattctacaggcccgaagagccactccggtggacgttgccacgtgcattccccactgttgagtgctcccccgccggggcctgctggctttctgcaatctttccaatcgcacgaatgaccagtggaaacctgaacttccaacaaagaatggtacgggtcgcagctgagctttacagagccggccagctcacccctgcagtcttgaaggctctacaagtttatgaacggggttgccgctggtaccccattgttggacctgtccctggagtggccgttttcgccaattccctacatgtgagtgataaacctttcccgggagcaactcacgtgttgaccaacctgccgctcccgcagagacccaagcctgaagacttttgcccctttgagtgtgctatggctactgtctatgacattggtcatgacgccgtcatgtatgtggccgaaaggaaagtctcctgggcccctcgtggcggggatgaagtgaaatttgaagctgtccccggggagttgaagttgattgcgaaccggctccgcacctccttcccgccccaccacacagtggacatgtctaagttcgccttcacagcccctgggtgtggtgtttctatgcgggtcgaacgccaacacggctgccttcccgctgacactgtccctgaaggcaactgctggtggagcttgtttgacttgcttccactggaagttcagaacaaagaaattcgccatgctaaccaatttggctaccagaccaagcatggtgtctctggcaagtacctacagcggaggctgca[...cut...]
+#   ## end ##
+#
+class Lasergene
+  # Entire header before the sequence
+  attr_reader :comments
+  
+  # Sequence
+  # 
+  # Bio::Sequence::NA or Bio::Sequence::AA object
+  attr_reader :sequence
+  
+  # Name of sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :name
+  
+  # Contig length, length of present sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :contig_length
+  
+  # Average length per sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :average_length
+  
+  # Length of parent sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :total_length
+  
+  # Number of top strand sequences
+  # * Parsed from standard Lasergene header
+  attr_reader :top_strand_sequences
+  
+  # Number of bottom strand sequences
+  # * Parsed from standard Lasergene header
+  attr_reader :bottom_strand_sequences
+  
+  # Number of sequences
+  # * Parsed from standard Lasergene header
+  attr_reader :total_sequences
+
+  DELIMITER_1 = '^\^\^:' # Match '^^:' at the beginning of a line
+  DELIMITER_2 = '^\^\^'  # Match '^^' at the beginning of a line
+
+  def initialize(lines)
+    process(lines)
+  end  
+  
+  # Is the comment header recognized as standard Lasergene format?
+  #
+  # ---
+  # *Arguments*
+  # * _none_
+  # *Returns*:: +true+ _or_ +false+
+  def standard_comment?
+    @standard_comment
+  end
+  
+  # Sequence
+  # 
+  # Bio::Sequence::NA or Bio::Sequence::AA object
+  def seq
+    @sequence
+  end
+  
+  # Name of sequence
+  # * Parsed from standard Lasergene header
+  def entry_id
+    @name
+  end
+  
+  #########
+  protected
+  #########
+  
+  def process(lines)
+    delimiter_1_indices = []
+    delimiter_2_indices = []
+    
+    # If the data from the file is passed as one big String instead of
+    # broken into an Array, convert lines to an Array
+    if lines.kind_of? String
+      lines = lines.tr("\r", '').split("\n")
+    end
+
+    lines.each_with_index do |line, index|
+      if line.match DELIMITER_1
+        delimiter_1_indices << index
+      elsif line.match DELIMITER_2
+        delimiter_2_indices << index
+      end
+    end
+
+    raise InputError, "More than one delimiter of type '#{DELIMITER_1}'" if delimiter_1_indices.size > 1
+    raise InputError, "More than one delimiter of type '#{DELIMITER_2}'" if delimiter_2_indices.size > 1
+    raise InputError, "No comment to data separator of type '#{DELIMITER_2}'" if delimiter_2_indices.size < 1
+
+    if !delimiter_1_indices.empty?
+      # toss out DELIMETER_1 and anything preceding it
+      @comments = lines[ (delimiter_1_indices[0] + 1) .. (delimiter_2_indices[0] - 1) ]
+    else
+      @comments = lines[ 0 .. (delimiter_2_indices[0] - 1) ]
+    end
+
+    @standard_comment = false
+    if @comments[0] =~ %r{(.+)\s+\(\d+,\d+\)} # if we have a standard Lasergene comment
+      @standard_comment = true
+      @name = $1
+      comments.each do |comment|
+        if comment.match('Contig Length:\s+(\d+)')
+          @contig_length = $1.to_i
+        elsif comment.match('Average Length/Sequence:\s+(\d+)')
+          @average_length = $1.to_i
+        elsif comment.match('Total Sequence Length:\s+(\d+)')
+          @total_length = $1.to_i
+        elsif comment.match('Top Strand:\s+(\d+)')
+          @top_strand_sequences = $1.to_i
+        elsif comment.match('Bottom Strand:\s+(\d+)')
+          @bottom_strand_sequences = $1.to_i
+        elsif comment.match('Total:\s+(\d+)')
+          @total_sequences = $1.to_i
+        end
+      end
+    end
+
+    @comments = @comments.join('')
+    @sequence = Bio::Sequence.auto( lines[ (delimiter_2_indices[0] + 1) .. -1 ].join('') )
+  end
+end # Lasergene
+end # Bio