wwood-bioruby 1.2.11

data/test/unit/bio/db/test_rebase.rb

@@ -0,0 +1,101 @@
+#
+# test/unit/bio/db/test_rebase.rb - Unit test for Bio::REBASE
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com)
+# License::   The Ruby License
+#
+#  $Id: test_rebase.rb,v 1.5 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/db/rebase'
+
+module Bio #:nodoc:
+  class TestREBASE < Test::Unit::TestCase #:nodoc:
+    
+    def setup
+      enzyme_data = <<END
+#
+# REBASE version 511                                              emboss_e.511
+#
+AarI  CACCTGC 7 2 0 11  15  0 0
+AasI  GACNNNNNNGTC  12  2 0 7 5 0 0
+AatI  AGGCCT  6 2 1 3 3 0 0
+END
+
+      reference_data = <<END
+#
+# REBASE version 511                                              emboss_r.511
+#
+#
+AarI
+Arthrobacter aurescens SS2-322
+
+
+A. Janulaitis
+F
+2
+Grigaite, R., Maneliene, Z., Janulaitis, A., (2002) Nucleic Acids Res., vol. 30.
+Maneliene, Z., Zakareviciene, L., Unpublished observations.
+//
+AasI
+Arthrobacter aurescens RFL3
+
+
+V. Butkus
+F
+1
+Kazlauskiene, R., Vaitkevicius, D., Maneliene, Z., Trinkunaite, L., Kiuduliene, L., Petrusyte, M., Butkus, V., Janulaitis, A., Unpublished observations.
+//
+AatI
+Acetobacter aceti
+
+
+IFO 3281
+O
+2
+Sato, H., Yamada, Y., (1990) J. Gen. Appl. Microbiol., vol. 36, pp. 273-277.
+Sugisaki, H., Maekawa, Y., Kanazawa, S., Takanami, M., (1982) Nucleic Acids Res., vol. 10, pp. 5747-5752.
+//
+END
+
+      supplier_data = <<END
+#
+# REBASE version 511                                              emboss_s.511
+#
+A GE Healthcare
+B Invitrogen Corporation
+C Minotech Biotechnology
+E Stratagene
+F Fermentas International Inc.
+G Qbiogene
+O Toyobo Biochemicals
+END
+
+      @obj = Bio::REBASE.new(enzyme_data, reference_data, supplier_data)
+    end
+
+    def test_methods
+      a = @obj
+      assert_equal(a['AarI'].organism, 'Arthrobacter aurescens SS2-322')
+      assert_equal(a['AarI'].references.size, 2)
+      assert_equal(a['AarI'].supplier_names, ['Fermentas International Inc.'])
+      assert_equal(a['AarI'].pattern, 'CACCTGC')
+
+      assert_equal(a['AatI'].supplier_names, ['Toyobo Biochemicals'])
+      assert_equal(a['AatI'].suppliers, ['O'])
+      
+      assert_equal(a.enzyme_name?('aasi'), true)
+      assert_equal(a.enzyme_name?('AarI'), true)
+      assert_equal(a.enzyme_name?('Aari'), true)
+      assert_equal(a.enzyme_name?('AbrI'), false)
+    end
+
+  end
+
+end

data/test/unit/bio/db/test_soft.rb

@@ -0,0 +1,138 @@
+#
+# test/unit/bio/db/test_rebase.rb - Unit test for Bio::REBASE
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com)
+# License::   The Ruby License
+#
+#  $Id: test_soft.rb,v 1.3 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/db/soft'
+
+module Bio #:nodoc:
+  class TestSOFT < Test::Unit::TestCase #:nodoc:
+    
+    def setup
+      bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4)).cleanpath.to_s
+      test_data_path = Pathname.new(File.join(bioruby_root, 'test', 'data', 'soft')).cleanpath.to_s
+      series_filename = File.join(test_data_path, 'GSE3457_family_partial.soft')
+      dataset_filename = File.join(test_data_path, 'GDS100_partial.soft')
+
+      @obj_series = Bio::SOFT.new( IO.readlines(series_filename))
+      @obj_dataset = Bio::SOFT.new( IO.readlines(dataset_filename))
+    end
+
+    def test_series
+      assert_equal( @obj_series.platform[:geo_accession], 'GPL2092')
+      assert_equal( @obj_series.platform[:organism], 'Populus')
+      assert_equal( @obj_series.platform[:contributor], ["Jingyi,,Li", "Olga,,Shevchenko", "Steve,H,Strauss", "Amy,M,Brunner"])
+      assert_equal( @obj_series.platform[:data_row_count], '240')
+      assert_equal( @obj_series.platform.keys.sort {|a,b| a.to_s <=> b.to_s}[0..2], [:contact_address, :contact_city, :contact_country])
+      assert_equal( @obj_series.platform[:"contact_zip/postal_code"], '97331')
+      assert_equal( @obj_series.platform[:table].header, ["ID", "GB_ACC", "SPOT_ID", "Function/Family", "ORGANISM", "SEQUENCE"])             
+      assert_equal( @obj_series.platform[:table].header_description, {"ORGANISM"=>"sequence sources",
+       "SEQUENCE"=>"oligo sequence used",
+       "Function/Family"=>"gene functions and family",
+       "ID"=>"",
+       "SPOT_ID"=>"",
+       "GB_ACC"=>"Gene bank accession number"}) 
+      assert_equal( @obj_series.platform[:table].rows.size, 240)          
+      assert_equal( @obj_series.platform[:table].rows[5], ["A039P68U",
+       "AI163321",
+       "",
+       "TF, flowering protein CONSTANS",
+       "P. tremula x P. tremuloides",
+       "AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC"])            
+      assert_equal( @obj_series.platform[:table].rows[5][4], 'P. tremula x P. tremuloides')         
+      assert_equal( @obj_series.platform[:table].rows[5][:organism], 'P. tremula x P. tremuloides') 
+      assert_equal( @obj_series.platform[:table].rows[5]['ORGANISM'], 'P. tremula x P. tremuloides')
+      
+      assert_equal( @obj_series.series[:geo_accession], 'GSE3457')           
+      assert_equal( @obj_series.series[:contributor], ["Jingyi,,Li",
+       "Olga,,Shevchenko",
+       "Ove,,Nilsson",
+       "Steve,H,Strauss",
+       "Amy,M,Brunner"])             
+      assert_equal( @obj_series.series[:platform_id], 'GPL2092')             
+      assert_equal( @obj_series.series[:sample_id].size, 74)          
+      assert_equal( @obj_series.series[:sample_id][0..4], ["GSM77557", "GSM77558", "GSM77559", "GSM77560", "GSM77561"])         
+                                                                 
+      assert_equal( @obj_series.database[:name], 'Gene Expression Omnibus (GEO)')                  
+      assert_equal( @obj_series.database[:ref], 'Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6')                   
+      assert_equal( @obj_series.database[:institute], 'NCBI NLM NIH')             
+                                                                 
+      assert_equal( @obj_series.samples.size, 2)                     
+      assert_equal( @obj_series.samples[:GSM77557][:series_id], 'GSE3457')   
+      assert_equal( @obj_series.samples['GSM77557'][:series_id], 'GSE3457')  
+      assert_equal( @obj_series.samples[:GSM77557][:platform_id], 'GPL2092') 
+      assert_equal( @obj_series.samples[:GSM77557][:type], 'RNA')        
+      assert_equal( @obj_series.samples[:GSM77557][:title], 'fb6a1')       
+      assert_equal( @obj_series.samples[:GSM77557][:table].header, ["ID_REF", "VALUE"])
+      assert_equal( @obj_series.samples[:GSM77557][:table].header_description, {"ID_REF"=>"", "VALUE"=>"normalized signal intensities"})
+      assert_equal( @obj_series.samples[:GSM77557][:table].rows.size, 217)
+      assert_equal( @obj_series.samples[:GSM77557][:table].rows[5], ["A039P68U", "5.36"])  
+      assert_equal( @obj_series.samples[:GSM77557][:table].rows[5][0], 'A039P68U')        
+      assert_equal( @obj_series.samples[:GSM77557][:table].rows[5][:id_ref], 'A039P68U')  
+      assert_equal( @obj_series.samples[:GSM77557][:table].rows[5]['ID_REF'], 'A039P68U')
+    end
+    
+    def test_dataset
+      assert_equal( @obj_dataset.database[:name], 'Gene Expression Omnibus (GEO)')
+
+      assert_equal( @obj_dataset.database[:ref], 'Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6')
+      assert_equal( @obj_dataset.database[:institute], 'NCBI NLM NIH')
+
+      assert_equal( @obj_dataset.subsets.size, 8)
+      assert_equal( @obj_dataset.subsets.keys, ["GDS100_1",
+       "GDS100_2",
+       "GDS100_3",
+       "GDS100_4",
+       "GDS100_5",
+       "GDS100_6",
+       "GDS100_7",
+       "GDS100_8"])
+      assert_equal( @obj_dataset.subsets[:GDS100_7],  {:sample_id=>"GSM548,GSM543",
+       :dataset_id=>"GDS100",
+       :description=>"60 minute",
+       :type=>"time"})
+      assert_equal( @obj_dataset.subsets['GDS100_7'][:sample_id], 'GSM548,GSM543')
+      assert_equal( @obj_dataset.subsets[:GDS100_7][:sample_id], 'GSM548,GSM543')
+      assert_equal( @obj_dataset.subsets[:GDS100_7][:dataset_id], 'GDS100')
+                                                                 
+      assert_equal( @obj_dataset.dataset[:order], 'none')
+      assert_equal( @obj_dataset.dataset[:sample_organism], 'Escherichia coli')
+      assert_equal( @obj_dataset.dataset[:table].header, ["ID_REF",
+       "IDENTIFIER",
+       "GSM549",
+       "GSM542",
+       "GSM543",
+       "GSM547",
+       "GSM544",
+       "GSM545",
+       "GSM546",
+       "GSM548"])
+      assert_equal( @obj_dataset.dataset[:table].rows.size, 15)
+      assert_equal( @obj_dataset.dataset[:table].rows[5], ["6",
+       "EMPTY",
+       "0.097",
+       "0.217",
+       "0.242",
+       "0.067",
+       "0.104",
+       "0.162",
+       "0.104",
+       "0.154"])
+      assert_equal( @obj_dataset.dataset[:table].rows[5][4], '0.242')
+      assert_equal( @obj_dataset.dataset[:table].rows[5][:gsm549], '0.097')
+      assert_equal( @obj_dataset.dataset[:table].rows[5][:GSM549], '0.097')
+      assert_equal( @obj_dataset.dataset[:table].rows[5]['GSM549'], '0.097')
+    end
+  end
+
+end

data/test/unit/bio/db/test_url.rb

@@ -0,0 +1,36 @@
+
+
+$:.unshift File.join(File.dirname(__FILE__),['..'] * 4,'lib')
+
+require 'test/unit'
+require 'bio'
+
+module Bio
+  # Test the static methods work correctly
+  class UrlTest < Test::Unit::TestCase
+    def test_hhmi_pfam_family_url
+      assert_equal "http://pfam.janelia.org/family?entry=PF00001&type=Family",
+        Bio::URL.hhmi_pfam_family_url('PF00001')
+    end
+    
+    def test_pantherdb_panther_family_url
+      assert_equal "http://www.pantherdb.org/panther/family.do?clsAccession=PTHR10003",
+        Bio::URL.pantherdb_panther_family_url('PTHR10003')
+    end
+    
+    def test_plasmodb_gene_url
+      assert_equal "http://plasmodb.org/gene/PfCRT",
+        Bio::URL.plasmodb_gene_url('PfCRT')
+    end
+  end
+  
+  # Test that inclusion of the module works correctly
+  class UrlGeneratorsTest < Test::Unit::TestCase
+    include Bio::URLGenerators
+    
+    def test_module_include
+      assert_equal "http://www.pantherdb.org/panther/family.do?clsAccession=PTHR10003",
+        pantherdb_panther_family_url('PTHR10003')
+    end
+  end
+end

data/test/unit/bio/io/flatfile/test_autodetection.rb

@@ -0,0 +1,375 @@
+#
+# = test/unit/bio/io/flatfile/test_autodetection.rb - unit test for Bio::FlatFile::AutoDetect
+#
+#   Copyright (C) 2006 Naohisa Goto <ng@bioruby.org>
+#
+# License:: The Ruby License
+#
+#  $Id: test_flatfile.rb,v 1.2 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio'
+
+module Bio::TestFlatFile
+
+  # testing default AutoDetect's behavior
+  class TestDefaultAutoDetect < Test::Unit::TestCase
+    
+    bioruby_root = Pathname.new(File.join(File.dirname(__FILE__),
+                                          ['..'] * 5)).cleanpath.to_s
+    TestDataPath = Pathname.new(File.join(bioruby_root,
+                                          'test', 'data')).cleanpath.to_s
+
+    def setup
+      @ad = Bio::FlatFile::AutoDetect.default
+    end
+
+    def test_genbank
+      # modified from GenBank AB009803.1
+      # (E-mail and telephone/FAX numbers are removed from original entry)
+      text = <<__END_OF_TEXT__
+LOCUS       AB009803                  81 bp    DNA     linear   PRI 14-APR-2000
+DEFINITION  Homo sapiens gene for osteonidogen, intron 4.
+ACCESSION   AB009803
+VERSION     AB009803.1  GI:2749808
+KEYWORDS    osteonidogen.
+SOURCE      Homo sapiens (human)
+  ORGANISM  Homo sapiens
+            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
+            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
+            Catarrhini; Hominidae; Homo.
+REFERENCE   1
+  AUTHORS   Ohno,I., Okubo,K. and Matsubara,K.
+  TITLE     Human osteonidogen gene: intron-exon junctions and chromosomal
+            localization
+  JOURNAL   Published Only in Database (1998)
+REFERENCE   2  (bases 1 to 81)
+  AUTHORS   Ohno,I., Okubo,K. and Matsubara,K.
+  TITLE     Direct Submission
+  JOURNAL   Submitted (13-DEC-1997) Ikko Ohno, Institute for Molecular and
+            Cellular Biology, Osaka University, Molecular Genetics; 1-3
+            Yamada-oka, Suita, Osaka 565, Japan
+FEATURES             Location/Qualifiers
+     source          1..81
+                     /organism="Homo sapiens"
+                     /mol_type="genomic DNA"
+                     /db_xref="taxon:9606"
+                     /chromosome="14"
+                     /map="14q21-22"
+                     /clone_lib="Lambda FIX II STRATAGENE"
+     intron          1..81
+                     /number=4
+ORIGIN
+        1 gtaggatctc ccctccagat tctgatctgt cctccccctt gcatccaaca cctacttatt
+       61 ggccattcta tcctgaaaca g
+//
+__END_OF_TEXT__
+      assert_equal(Bio::GenBank, @ad.autodetect(text))
+    end
+
+    def test_genpept
+      # modified from: NCBI: P04637.2 GI:129369
+      # (to shorten data, many elements are omitted)
+      text = <<__END_OF_TEXT__
+LOCUS       P04637                   393 aa            linear   PRI 01-JUL-2008
+DEFINITION  Cellular tumor antigen p53 (Tumor suppressor p53) (Phosphoprotein
+            p53) (Antigen NY-CO-13).
+ACCESSION   P04637
+VERSION     P04637.2  GI:129369
+KEYWORDS    3D-structure; Acetylation; Activator; Alternative splicing;
+            Anti-oncogene; Apoptosis; Cell cycle; Covalent protein-RNA linkage;
+            Cytoplasm; Disease mutation; DNA-binding; Endoplasmic reticulum;
+            Glycoprotein; Host-virus interaction; Li-Fraumeni syndrome;
+            Metal-binding; Methylation; Nucleus; Phosphoprotein; Polymorphism;
+            Transcription; Transcription regulation; Ubl conjugation; Zinc.
+SOURCE      Homo sapiens (human)
+  ORGANISM  Homo sapiens
+            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
+            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
+            Catarrhini; Hominidae; Homo.
+REFERENCE   1  (residues 1 to 393)
+  AUTHORS   Zakut-Houri,R., Bienz-Tadmor,B., Givol,D. and Oren,M.
+  TITLE     Human p53 cellular tumor antigen: cDNA sequence and expression in
+            COS cells
+  JOURNAL   EMBO J. 4 (5), 1251-1255 (1985)
+   PUBMED   4006916
+  REMARK    NUCLEOTIDE SEQUENCE [MRNA].
+FEATURES             Location/Qualifiers
+     source          1..393
+                     /organism="Homo sapiens"
+                     /db_xref="taxon:9606"
+     gene            1..393
+                     /gene="TP53"
+                     /note="synonym: P53"
+     Protein         1..393
+                     /gene="TP53"
+                     /product="Cellular tumor antigen p53"
+ORIGIN
+        1 meepqsdpsv epplsqetfs dlwkllpenn vlsplpsqam ddlmlspddi eqwftedpgp
+       61 deaprmpeaa ppvapapaap tpaapapaps wplsssvpsq ktyqgsygfr lgflhsgtak
+      121 svtctyspal nkmfcqlakt cpvqlwvdst pppgtrvram aiykqsqhmt evvrrcphhe
+      181 rcsdsdglap pqhlirvegn lrveylddrn tfrhsvvvpy eppevgsdct tihynymcns
+      241 scmggmnrrp iltiitleds sgnllgrnsf evrvcacpgr drrteeenlr kkgephhelp
+      301 pgstkralpn ntssspqpkk kpldgeyftl qirgrerfem frelnealel kdaqagkepg
+      361 gsrahsshlk skkgqstsrh kklmfktegp dsd
+//
+__END_OF_TEXT__
+
+      assert_equal(Bio::GenPept, @ad.autodetect(text))
+    end
+
+    def test_medline
+      # PMID: 13054692
+      text = <<__END_OF_TEXT__
+PMID- 13054692
+OWN - NLM
+STAT- MEDLINE
+DA  - 19531201
+DCOM- 20030501
+LR  - 20061115
+PUBM- Print
+IS  - 0028-0836 (Print)
+VI  - 171
+IP  - 4356
+DP  - 1953 Apr 25
+TI  - Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid.
+PG  - 737-8
+FAU - WATSON, J D
+AU  - WATSON JD
+FAU - CRICK, F H
+AU  - CRICK FH
+LA  - eng
+PT  - Journal Article
+PL  - Not Available
+TA  - Nature
+JT  - Nature
+JID - 0410462
+RN  - 0 (Nucleic Acids)
+SB  - OM
+MH  - *Nucleic Acids
+OID - CLML: 5324:25254:447
+OTO - NLM
+OT  - *NUCLEIC ACIDS
+EDAT- 1953/04/25
+MHDA- 1953/04/25 00:01
+PST - ppublish
+SO  - Nature. 1953 Apr 25;171(4356):737-8.
+__END_OF_TEXT__
+
+      assert_equal(Bio::MEDLINE, @ad.autodetect(text))
+    end
+
+    def test_embl_oldrelease
+      fn = File.join(TestDataPath, 'embl', 'AB090716.embl')
+      text = File.read(fn)
+      assert_equal(Bio::EMBL, @ad.autodetect(text))
+    end
+
+    def test_embl
+      fn = File.join(TestDataPath, 'embl', 'AB090716.embl.rel89')
+      text = File.read(fn)
+      assert_equal(Bio::EMBL, @ad.autodetect(text))
+    end
+
+    def test_sptr
+      fn = File.join(TestDataPath, 'uniprot', 'p53_human.uniprot')
+      text = File.read(fn)
+      assert_equal(Bio::SPTR, @ad.autodetect(text))
+    end
+
+    def test_prosite
+      fn = File.join(TestDataPath, 'prosite', 'prosite.dat')
+      text = File.read(fn)
+      assert_equal(Bio::PROSITE, @ad.autodetect(text))
+    end
+
+    def test_transfac
+      # Dummy data; Generated from random data
+      text = <<__END_OF_TEXT__
+AC  M99999
+XX
+ID  V$XXXX_99
+XX
+DT  13.01.98 (created); ewi.
+DT  31.12.99 (updated); ewi.
+XX
+NA  XXXX
+XX
+DE  example gene protein
+XX
+BF  T99998; XXXX; Species: human, Homo sapiens.
+BF  T99999; XXXX; Species: mouse, Mus musculus.
+XX
+P0      A      C      G      T
+01      1      2      2      2      N
+02      0      2      2      3      N
+03      1      1      5      0      G
+04      3      1      1      2      N
+05      7      0      0      0      A
+06      2      0      1      4      W
+07      0      1      6      0      G
+08      0      3      0      4      Y
+09      6      1      0      0      A
+10      1      1      0      5      T
+XX
+BA  7 functional elements in 3 genes
+XX
+CC  compiled sequences
+XX
+RN  [1]
+RA  Anonymou S., Whoam I.
+RT  Example article title for XXXX
+RL  J. Example. 99:990-999 (1999).
+__END_OF_TEXT__
+
+      assert_equal(Bio::TRANSFAC, @ad.autodetect(text))
+    end
+
+    def test_aaindex1
+      fn = File.join(TestDataPath, 'aaindex', 'PRAM900102')
+      text = File.read(fn)
+      assert_equal(Bio::AAindex1, @ad.autodetect(text))
+    end
+
+    def test_aaindex2
+      fn = File.join(TestDataPath, 'aaindex', 'DAYM780301')
+      text = File.read(fn)
+      assert_equal(Bio::AAindex2, @ad.autodetect(text))
+    end
+
+#    def test_litdb
+#    end
+
+#    def test_brite
+#    end
+
+#    def test_orthology
+#    end
+
+#    def test_drug
+#    end
+
+#    def test_glycan
+#    end
+
+#    def test_enzyme
+#    end
+
+#    def test_compound
+#    end
+
+#    def test_reaction
+#    end
+
+#    def test_genes
+#    end
+
+#    def test_genome
+#    end
+
+    def test_maxml_cluster
+      # dummy empty data
+      text = <<__END_OF_TEXT__
+<?xml version="1.0"?>
+<!DOCTYPE maxml-clusters SYSTEM "http://fantom.gsc.riken.go.jp/maxml/maxml.dtd"><maxml-clusters>
+</maxml-clusters>
+__END_OF_TEXT__
+      assert_equal(Bio::FANTOM::MaXML::Cluster, @ad.autodetect(text))
+    end
+
+    def test_maxml_sequence
+      # dummy empty data
+      text = <<__END_OF_TEXT__
+<?xml version="1.0"?>
+<!DOCTYPE maxml-sequences SYSTEM "http://fantom.gsc.riken.go.jp/maxml/maxml.dtd">
+<maxml-sequences>
+</maxml-sequences>
+__END_OF_TEXT__
+      assert_equal(Bio::FANTOM::MaXML::Sequence, @ad.autodetect(text))
+    end
+
+#    def test_pdb
+#    end
+
+#    def test_chemicalcomponent
+#    end
+
+#    def test_clustal
+#    end
+
+#    def test_gcg_msf
+#    end
+
+#    def test_gcg_seq
+#    end
+
+    def test_blastxml
+      fn = File.join(TestDataPath, 'blast', '2.2.15.blastp.m7')
+      text = File.read(fn)
+      assert_equal(Bio::Blast::Report, @ad.autodetect(text))
+    end
+
+#    def test_wublast
+#    end
+
+#    def test_wutblast
+#    end
+
+    def test_blast
+      fn = File.join(TestDataPath, 'blast', 'b0002.faa.m0')
+      text = File.read(fn)
+      assert_equal(Bio::Blast::Default::Report, @ad.autodetect(text))
+    end
+
+#    def test_tblast
+#    end
+
+#    def test_blat
+#    end
+
+#    def test_spidey
+#    end
+
+    def test_hmmer
+      fn = File.join(TestDataPath, 'HMMER', 'hmmpfam.out')
+      text = File.read(fn)
+      assert_equal(Bio::HMMER::Report, @ad.autodetect(text))
+
+      fn = File.join(TestDataPath, 'HMMER', 'hmmsearch.out')
+      text = File.read(fn)
+      assert_equal(Bio::HMMER::Report, @ad.autodetect(text))
+    end
+
+#    def test_sim4
+#    end
+
+    def test_fastaformat
+      fn = File.join(TestDataPath, 'fasta', 'example1.txt')
+      text = File.read(fn)
+      assert_equal(Bio::FastaFormat, @ad.autodetect(text))
+
+      fn = File.join(TestDataPath, 'fasta', 'example2.txt')
+      text = File.read(fn)
+      assert_equal(Bio::FastaFormat, @ad.autodetect(text))
+    end
+
+    def test_fastanumericformat
+      text = <<__END_OF_TEXT__
+>sample
+30 21 16 11 8 6 3 34 28 34 28 28 35 28 28 37 33 15 27 28 28 
+27 37 33 17 27 27 28 28 33 26 33 26 28 27 37 33 15 27 26 27 
+28 37 33 16 34 26 27 33 26 28 33 25 28 28 38 34 23 13 2
+__END_OF_TEXT__
+
+      assert_equal(Bio::FastaNumericFormat, @ad.autodetect(text))
+    end
+
+  end #class TestDefaultAutoDetect
+
+end #module Bio::TestFlatFile
+