wwood-bioruby 1.2.11

data/test/unit/bio/sequence/test_compat.rb

@@ -0,0 +1,69 @@
+#
+# test/unit/bio/sequence/test_compat.rb - Unit test for Bio::Sequencce::Compat
+#
+# Copyright::   Copyright (C) 2006 Mitsuteru C. Nakao <n@bioruby.org>
+# License::     The Ruby License
+#
+#  $Id:$
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/sequence'
+require 'bio/sequence/compat'
+
+module Bio; module TestSequenceCompat
+  
+  class TSequence < String
+    include Bio::Sequence::Common
+  end
+
+
+  class TestSequenceCompat < Test::Unit::TestCase
+
+    def setup
+      @obj  = TSequence.new('atgcatgcatgcatgcaaaa')
+    end
+
+    def test_to_s
+      str = 'atgcatgcatgcatgcaaaa'
+      assert_equal(str, @obj.to_s)
+    end
+  end
+
+
+  class TestSequenceCommonCompat < Test::Unit::TestCase
+
+    # Test Sequence#to_fasta    
+    def test_to_fasta
+      sequence = TSequence.new("agtc" * 10)
+      header = "the header"
+      str = ">the header\n" + ("agtc" * 5) + "\n" + ("agtc" * 5) + "\n"
+      assert_equal(str, sequence.to_fasta(header, 20))
+    end
+
+  end
+
+
+  require 'bio/sequence/na'
+
+  class TestSequenceNACompat < Test::Unit::TestCase
+    def test_na_self_randomize
+      composition = Bio::Sequence::NA.new("acgtacgt").composition
+      assert(Bio::Sequence::NA.randomize(composition))
+    end
+  end 
+
+  require 'bio/sequence/aa'  
+
+  class TestSequenceNACompat < Test::Unit::TestCase
+    def test_aa_self_randomize
+      composition = Bio::Sequence::AA.new("WWDTGAK").composition
+      assert(Bio::Sequence::AA.randomize(composition))
+    end
+  end
+
+end; end #module Bio; module TestSequenceCompat

data/test/unit/bio/sequence/test_dblink.rb

@@ -0,0 +1,58 @@
+#
+# test/unit/bio/sequence/test_dblink.rb - Unit test for Bio::Sequencce::DBLink
+#
+# Copyright::  Copyright (C) 2008 Naohisa Goto <ng@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_dblink.rb,v 1.1.2.1 2008/06/17 15:44:22 ngoto Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/sequence'
+require 'bio/sequence/dblink'
+
+module Bio
+  class TestSequenceDBLink < Test::Unit::TestCase
+    def setup
+      @xref = Bio::Sequence::DBLink.new('EMBL', 'Z14088', 'CAA78466.1',
+                                        '-', 'mRNA')
+    end
+
+    def test_database
+      assert_equal('EMBL', @xref.database)
+    end
+
+    def test_id
+      assert_equal('Z14088', @xref.id)
+    end
+
+    def test_secondary_ids
+      assert_equal([ 'CAA78466.1', '-', 'mRNA' ],
+                   @xref.secondary_ids)
+    end
+  end #class
+
+  class TestSequenceDBLinkClassMethods < Test::Unit::TestCase
+    def test_parse_embl_DR_line
+      str = 'DR   EPD; EP07077; HS_HBG1.'
+      xref = Bio::Sequence::DBLink.parse_embl_DR_line(str)
+      assert_equal('EPD', xref.database)
+      assert_equal('EP07077', xref.id)
+      assert_equal([ 'HS_HBG1' ], xref.secondary_ids)
+    end
+
+    def test_parse_uniprot_DR_line
+      str = 'DR   EMBL; Z14088; CAA78466.1; -; mRNA.'
+      xref = Bio::Sequence::DBLink.parse_uniprot_DR_line(str)
+      assert_equal('EMBL', xref.database)
+      assert_equal('Z14088', xref.id)
+      assert_equal([ 'CAA78466.1', '-', 'mRNA' ],
+                   xref.secondary_ids)
+      end
+  end #class
+
+end #module Bio

data/test/unit/bio/sequence/test_na.rb

@@ -0,0 +1,330 @@
+#
+# = test/unit/bio/sequence/test_na.rb - Unit test for Bio::Sequencce::NA
+#
+# Copyright::   Copyright (C) 2006 
+#               Mitsuteru C. Nakao <n@bioruby.org>
+# License::     The Ruby License
+#
+# $Id:$
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/sequence'
+require 'bio/sequence/na'  
+
+module Bio
+
+  class TestSequenceNANew < Test::Unit::TestCase
+    def test_new
+      str = 'atgcatgcatgcatgcaaaa'
+      assert(Bio::Sequence::NA.new(str))
+    end
+
+    def test_new_t
+      str = "atgcatgcatgcatgcaaaa"
+      str_t = "atgcatgcat\tgca\ttgcaaaa"
+      assert_equal(str, Bio::Sequence::NA.new(str_t))
+    end
+
+    def test_new_n
+      str = "atgcatgcatgcatgcaaaa"
+      str_n = "atgcatgcat\ngca\ntgcaaaa"
+      assert_equal(str, Bio::Sequence::NA.new(str_n))
+    end
+
+    def test_new_r
+      str = "atgcatgcatgcatgcaaaa"
+      str_r = "atgcatgcat\n\rgca\n\rtgcaaaa"
+      assert_equal(str, Bio::Sequence::NA.new(str_r))
+    end
+
+  end
+  
+  class TestSequenceNA < Test::Unit::TestCase
+
+    def setup
+      @obj = Bio::Sequence::NA.new('atgcatgcatgcatgcaaaa')
+    end
+
+    def test_splicing
+      #     'atgcatgcatgcatgcaaaa'
+      #      12345678901234567890
+      str = 'atgca  catgcatg'.gsub(' ','')
+      assert_equal(str, @obj.splicing("join(1..5,8..15)"))
+    end
+
+    def test_forward_complement
+      str       = 'atgcatgcatgcatgcaaaa'
+      str_fcomp = 'tacgtacgtacgtacgtttt'
+      fcomp = @obj.forward_complement
+      assert_equal(str_fcomp, @obj.forward_complement)
+      assert_equal(str, @obj)
+      assert_equal(str_fcomp, @obj.forward_complement!)
+      assert_equal(str_fcomp, @obj)
+    end
+
+    def test_reverse_complement
+      str       = 'atgcatgcatgcatgcaaaa'
+      str_rcomp = 'tacgtacgtacgtacgtttt'.reverse
+      rcomp = @obj.forward_complement
+      assert_equal(str_rcomp, @obj.reverse_complement)
+      assert_equal(str, @obj)
+      assert_equal(str_rcomp, @obj.reverse_complement!)
+      assert_equal(str_rcomp, @obj)
+    end
+
+    def test_complement
+      assert(@obj.complement)
+      assert(@obj.complement!)
+    end
+
+    def test_to_s
+      str = 'atgcatgcatgcatgcaaaa'
+      assert_equal(str, @obj.to_s)
+    end
+
+    def test_codon_usage
+      usage = {"cat"=>1, "caa"=>1, "tgc"=>1, "gca"=>1, "atg"=>2}
+      assert_equal(usage, @obj.codon_usage)
+    end
+
+    def test_gc_percent
+      assert_equal(40, @obj.gc_percent)
+      @obj[0, 1] = 'g'
+      assert_equal(45, @obj.gc_percent)
+    end
+
+    def test_gc_content
+      assert_in_delta(0.4, @obj.gc_content, Float::EPSILON)
+      @obj[0, 1] = 'g'
+      assert_in_delta(0.45, @obj.gc_content, Float::EPSILON)
+    end
+
+    def test_at_content
+      assert_in_delta(0.6, @obj.at_content, Float::EPSILON)
+      @obj[0, 1] = 'g'
+      assert_in_delta(0.55, @obj.at_content, Float::EPSILON)
+    end
+
+    def test_gc_skew
+      assert_in_delta(0.0, @obj.gc_skew, Float::EPSILON)
+      @obj[0, 1] = 'g'
+      assert_in_delta(1.0/9.0, @obj.gc_skew, Float::EPSILON)
+      @obj.gsub!(/a/, 'c')
+      assert_in_delta(-3.0/8.0, @obj.gc_skew, Float::EPSILON)
+    end
+
+    def test_at_skew
+      assert_in_delta(1.0/3.0, @obj.at_skew, Float::EPSILON)
+      @obj[0, 1] = 'g'
+      assert_in_delta(3.0/11.0, @obj.at_skew, Float::EPSILON)
+    end
+
+    def test_iliegal_bases
+      @obj[0, 1] = 'n'
+      @obj[1, 1] = 'y'
+      assert_equal(['n', 'y'], @obj.illegal_bases)
+    end
+
+    def test_molecular_weight
+      assert_in_delta(6174.3974, @obj.molecular_weight, 1e-4)
+    end
+
+    def test_to_re
+      assert_equal(/atgcatgcatgcatgcaaaa/, @obj.to_re)
+      @obj[1,1] = 'n'
+      @obj[2,1] = 'r'
+      @obj[3,1] = 's'
+      @obj[4,1] = 'y'
+      @obj[5,1] = 'w'
+      assert_equal(/a[atgcyrwskmbdhvn][agr][gcw][tcy][atw]gcatgcatgcaaaa/, @obj.to_re)
+    end
+
+    def test_names
+      ary = ["Adenine", "Thymine", "Guanine"]
+      assert_equal(ary , @obj.splice("1..3").names)
+    end
+
+    def test_dna
+      @obj[0,1] = 'u'
+      assert_equal('utgcatgcatgcatgcaaaa', @obj)
+      assert_equal('ttgcatgcatgcatgcaaaa', @obj.dna)
+    end
+
+    def test_dna!
+      @obj[0,1] = 'u'
+      assert_equal('utgcatgcatgcatgcaaaa', @obj)
+      @obj.dna!
+      assert_equal('ttgcatgcatgcatgcaaaa', @obj)
+    end
+
+    def test_rna
+      assert_equal('atgcatgcatgcatgcaaaa', @obj)
+      assert_equal('augcaugcaugcaugcaaaa', @obj.rna)
+    end
+
+    def test_rna!
+      assert_equal('atgcatgcatgcatgcaaaa', @obj)
+      @obj.rna!
+      assert_equal('augcaugcaugcaugcaaaa', @obj)
+    end
+
+  end
+
+  class TestSequenceNACommon < Test::Unit::TestCase
+
+    def setup
+      @obj  = Bio::Sequence::NA.new('atgcatgcatgcatgcaaaa')
+    end
+
+    def test_to_s
+      assert_equal('atgcatgcatgcatgcaaaa', @obj.to_s)
+    end
+
+    def test_to_str
+      assert_equal('atgcatgcatgcatgcaaaa', @obj.to_str)
+    end
+
+    def test_seq
+      str = "atgcatgcatgcatgcaaaa"
+      assert_equal(str, @obj.seq)
+    end
+
+    # <<(*arg)
+    def test_push
+      str = "atgcatgcatgcatgcaaaaa"
+      assert_equal(str, @obj << "A")
+    end
+
+    # concat(*arg)
+    def test_concat
+      str = "atgcatgcatgcatgcaaaaa"
+      assert_equal(str, @obj.concat("A"))
+    end
+
+    # +(*arg)
+    def test_sum 
+      str = "atgcatgcatgcatgcaaaaatgcatgcatgcatgcaaaa"
+      assert_equal(str, @obj + @obj)
+    end
+
+    # window_search(window_size, step_size = 1)
+    def test_window_search
+      @obj.window_search(4) do |subseq|
+        assert_equal(20, @obj.size)
+      end
+    end
+
+    #total(hash)
+    def test_total
+      hash = {'a' => 1, 'c' => 2, 'g' => 4, 't' => 3}
+      assert_equal(44.0, @obj.total(hash))
+    end
+
+    def test_composition
+      composition = {"a"=>8, "c"=>4, "g"=>4, "t"=>4}
+      assert_equal(composition, @obj.composition)
+    end
+    
+    def test_splicing
+      #(position)
+      assert_equal("atgcatgc", @obj.splicing("join(1..4, 13..16)"))
+    end
+  end
+
+
+  class TestSequenceNATranslation < Test::Unit::TestCase
+    def setup
+
+      str = "aaacccgggttttaa"
+      #      K>>P>>G>>F>>*>>
+      #       N>>P>>G>>F>>
+      #        T>>R>>V>>L>>
+      #         P>>G>>F>>*>>
+      #     "tttgggcccaaaatt"
+      #      <<F<<G<<P<<K<<L
+      #        <<G<<P<<N<<*
+      #       <<V<<R<<T<<K            
+      @obj = Bio::Sequence::NA.new(str)
+    end
+
+    def test_translate
+      assert_equal("KPGF*", @obj.translate)
+    end
+
+    def test_translate_1
+      assert_equal("KPGF*", @obj.translate(1))
+    end
+
+    def test_translate_2
+      assert_equal("NPGF", @obj.translate(2))
+    end
+
+    def test_translate_3
+      assert_equal("TRVL", @obj.translate(3))
+    end
+
+    def test_translate_4
+      assert_equal("LKPGF", @obj.translate(4))
+    end
+
+    def test_translate_5
+      assert_equal("*NPG", @obj.translate(5))
+    end
+
+    def test_translate_6
+      assert_equal("KTRV", @obj.translate(6))
+    end
+
+    def test_translate_7
+      assert_equal("KPGF*", @obj.translate(7))
+      assert_equal(@obj.translate, @obj.translate(7))
+    end
+
+    def test_translate_n1
+      assert_equal("LKPGF", @obj.translate(-1))
+      assert_equal(@obj.translate(4), @obj.translate(-1))
+    end
+
+    def test_translate_n2
+      assert_equal("*NPG", @obj.translate(-2))
+      assert_equal(@obj.translate(5), @obj.translate(-2))
+    end
+
+    def test_translate_n3
+      assert_equal("KTRV", @obj.translate(-3))
+      assert_equal(@obj.translate(6), @obj.translate(-3))
+    end
+
+    def test_translate_0
+      assert_equal("KPGF*", @obj.translate(0))
+      assert_equal(@obj.translate, @obj.translate(0))
+      assert_equal(@obj.translate(7), @obj.translate(0))
+    end
+
+    def test_translate_unknown_x
+      @obj[3, 1] = 'N'
+      assert_equal("KXGF*", @obj.translate)
+    end
+
+    def test_translate_unknown_o
+      @obj[3, 1] = 'N'
+      assert_equal("KOGF*", @obj.translate(1, 1, 'O'))
+    end
+
+    def test_translate_given_codon_table
+      @obj[0, 1] = 't'
+      @obj[1, 1] = 'g'
+      @obj[2, 1] = 'a'
+      seleno_ct = Bio::CodonTable.copy(1)
+      seleno_ct['tga']  = 'U'
+      assert_equal("UPGF*", @obj.translate(1, seleno_ct))
+    end
+
+  end
+
+end