wwood-bioruby 1.2.11

data/test/unit/bio/db/test_gff.rb

@@ -0,0 +1,1190 @@
+#
+# test/unit/bio/db/test_gff.rb - Unit test for Bio::GFF
+#
+# Copyright::   Copyright (C) 2005, 2008
+#               Mitsuteru Nakao <n@bioruby.org>
+#               Naohisa Goto <ng@bioruby.org>
+# License::     The Ruby License
+#
+#  $Id:$
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'digest/sha1'
+require 'bio/db/gff'
+
+module Bio
+  class TestGFF < Test::Unit::TestCase
+    
+    def setup
+      data = <<END_OF_DATA
+I	sgd	CEN	151453	151591	.	+	.	CEN "CEN1" ; Note "CEN1\; Chromosome I Centromere"
+I	sgd	gene	147591	151163	.	-	.	Gene "TFC3" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene "FUN24" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene "TSV115" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	ORF	147591	151163	.	-	.	ORF "YAL001C" ; Note "TFC3\; transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	143998	147528	.	+	.	Gene "VPS8" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene "FUN15" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene "VPT8" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+END_OF_DATA
+      @obj = Bio::GFF.new(data)
+    end
+
+    def test_records
+      assert_equal(8, @obj.records.size)
+    end
+
+    def test_record_class
+      assert_equal(Bio::GFF::Record, @obj.records[0].class)
+    end
+
+  end # class TestGFF
+
+  class TestGFFRecord < Test::Unit::TestCase
+    
+    def setup
+      data =<<END_OF_DATA
+I	sgd	gene	151453	151591	.	+	.	Gene "CEN1" ; Note "Chromosome I Centromere"
+END_OF_DATA
+      @obj = Bio::GFF::Record.new(data)
+    end
+
+    def test_seqname
+      assert_equal('I', @obj.seqname)
+    end
+
+    def test_source
+      assert_equal('sgd', @obj.source)
+    end
+
+    def test_feature
+      assert_equal('gene', @obj.feature)
+    end
+
+    def test_start
+      assert_equal('151453', @obj.start)
+    end
+
+    def test_end
+      assert_equal('151591', @obj.end)
+    end
+
+    def test_score
+      assert_equal('.', @obj.score)
+    end
+
+    def test_strand
+      assert_equal('+', @obj.strand)
+    end
+
+    def test_frame
+      assert_equal('.', @obj.frame)
+    end
+
+    def test_attributes
+      at = {"Note"=>'"Chromosome I Centromere"', "Gene"=>'"CEN1"'}
+      assert_equal(at, @obj.attributes)
+    end
+
+    def test_comment
+      assert_equal(nil, @obj.comment)
+    end
+
+  end # class TestGFFRecord
+  
+  class TestGFFRecordConstruct < Test::Unit::TestCase
+
+    def setup
+      @obj = Bio::GFF.new
+    end
+
+    def test_add_seqname
+      name = "test"
+      record = Bio::GFF::Record.new("")
+      record.seqname = name
+      @obj.records << record
+      assert_equal(name, @obj.records[0].seqname)
+    end
+
+  end # class TestGFFRecordConstruct
+
+  class TestGFF2 < Test::Unit::TestCase
+    def setup
+      data = <<END_OF_DATA
+##gff-version 2
+##date 2008-09-22
+I	sgd	CEN	151453	151591	.	+	.	CEN "CEN1" ; Note "CEN1; Chromosome I Centromere"
+I	sgd	gene	147591	151163	.	-	.	Gene "TFC3" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene "FUN24" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene "TSV115" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	ORF	147591	151163	.	-	.	ORF "YAL001C" ; Note "TFC3; transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	143998	147528	.	+	.	Gene "VPS8" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene "FUN15" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene "VPT8" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+END_OF_DATA
+      @obj = Bio::GFF::GFF2.new(data)
+    end
+
+    def test_const_version
+      assert_equal(2, Bio::GFF::GFF2::VERSION)
+    end
+
+    def test_gff_version
+      assert_equal('2', @obj.gff_version)
+    end
+
+    def test_metadata_size
+      assert_equal(1, @obj.metadata.size)
+    end
+
+    def test_metadata
+      assert_equal(Bio::GFF::GFF2::MetaData.new('date', '2008-09-22'),
+                   @obj.metadata[0])
+    end
+
+    def test_records_size
+      assert_equal(8, @obj.records.size)
+    end
+
+    def test_to_s
+      str = <<END_OF_DATA
+##gff-version 2
+##date 2008-09-22
+I	sgd	CEN	151453	151591	.	+	.	CEN CEN1 ; Note "CEN1; Chromosome I Centromere"
+I	sgd	gene	147591	151163	.	-	.	Gene TFC3 ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene FUN24 ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene TSV115 ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	ORF	147591	151163	.	-	.	ORF YAL001C ; Note "TFC3; transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	143998	147528	.	+	.	Gene VPS8 ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene FUN15 ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene VPT8 ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+END_OF_DATA
+      assert_equal(str, @obj.to_s)
+    end
+  end #class TestGFF2
+
+  class TestGFF2Record < Test::Unit::TestCase
+    def setup
+      str = "seq1\tBLASTX\tsimilarity\t101\t235\t87.1\t+\t0\tTarget \"HBA_HUMAN\" 11 55 ; E_value 0.0003 ; Align 101 11 ; Align 179 36 ; Comment \"Please ignore this \\\"Comment\\\" attribute; Escape \\x1a\\037 and \\\\\\t\\r\\n\\f\\b\\a\\e\\v; This is test.\" 123 4.56e-34 \"Test for freetext\" ; Note \"\"; Misc IdString; Misc \"free text\"; Misc 5678 "
+
+      @obj = Bio::GFF::GFF2::Record.new(str)
+    end
+
+    def test_to_s
+      str = "seq1\tBLASTX\tsimilarity\t101\t235\t87.1\t+\t0\tTarget HBA_HUMAN 11 55 ; E_value 0.0003 ; Align 101 11 ; Align 179 36 ; Comment \"Please ignore this \\\"Comment\\\" attribute; Escape \\032\\037 and \\\\\\t\\r\\n\\f\\b\\a\\e\\v; This is test.\" 123 4.56e-34 \"Test for freetext\" ; Note \"\" ; Misc IdString ; Misc \"free text\" ; Misc 5678\n"
+
+      assert_equal(str, @obj.to_s)
+    end
+
+    def test_eqeq
+      obj2 = Bio::GFF::GFF2::Record.new(@obj.to_s)
+      assert_equal(true, @obj == obj2)
+    end
+
+    def test_eqeq_false
+      obj2 = Bio::GFF::GFF2::Record.new(@obj.to_s)
+      obj2.seqname = 'seq2'
+      assert_equal(false, @obj == obj2)
+    end
+
+    def test_comment_only?
+      assert_equal(false, @obj.comment_only?)
+    end
+
+    def test_seqname
+      assert_equal('seq1', @obj.seqname)
+    end
+
+    def test_source
+      assert_equal('BLASTX', @obj.source)
+    end
+
+    def test_feature
+      assert_equal('similarity', @obj.feature)
+    end
+
+    def test_start
+      assert_equal(101, @obj.start)
+    end
+
+    def test_end
+      assert_equal(235, @obj.end)
+    end
+
+    def test_score
+      assert_equal(87.1, @obj.score)
+    end
+
+    def test_strand
+      assert_equal('+', @obj.strand)
+    end
+
+    def test_frame
+      assert_equal(0, @obj.frame)
+    end
+
+    def test_attributes_to_hash
+      hash = {
+        'Target' =>
+        Bio::GFF::GFF2::Record::Value.new(['HBA_HUMAN', '11', '55']),
+        'E_value' => '0.0003',
+        'Align' =>
+        Bio::GFF::GFF2::Record::Value.new(['101', '11']),
+        'Comment' =>
+        Bio::GFF::GFF2::Record::Value.new(["Please ignore this \"Comment\" attribute; Escape \x1a\037 and \\\t\r\n\f\b\a\e\v; This is test.", "123", "4.56e-34", "Test for freetext"]),
+        'Note' => '',
+        'Misc' => 'IdString'
+      }
+      assert_equal(hash, @obj.attributes_to_hash)
+    end
+
+    def test_attributes
+      attributes =
+        [ [ 'Target',
+            Bio::GFF::GFF2::Record::Value.new(['HBA_HUMAN', '11', '55']) ],
+          [ 'E_value', '0.0003' ],
+          [ 'Align',
+            Bio::GFF::GFF2::Record::Value.new(['101', '11']) ],
+          [ 'Align',
+            Bio::GFF::GFF2::Record::Value.new(['179', '36']) ],
+          [ 'Comment',
+            Bio::GFF::GFF2::Record::Value.new(["Please ignore this \"Comment\" attribute; Escape \x1a\037 and \\\t\r\n\f\b\a\e\v; This is test.", "123", "4.56e-34", "Test for freetext"]) ],
+          [ 'Note', '' ],
+          [ 'Misc', 'IdString' ],
+          [ 'Misc', 'free text' ],
+          [ 'Misc', '5678' ]
+        ]
+      assert_equal(attributes, @obj.attributes)
+    end
+
+    def test_attribute
+      val_Target = Bio::GFF::GFF2::Record::Value.new(['HBA_HUMAN', '11', '55'])
+      assert_equal(val_Target, @obj.attribute('Target'))
+      assert_equal('0.0003', @obj.attribute('E_value'))
+      val_Align0 = Bio::GFF::GFF2::Record::Value.new(['101', '11'])
+      val_Align1 = Bio::GFF::GFF2::Record::Value.new(['179', '36'])
+      assert_equal(val_Align0, @obj.attribute('Align'))
+      val_Comment = Bio::GFF::GFF2::Record::Value.new(["Please ignore this \"Comment\" attribute; Escape \x1a\037 and \\\t\r\n\f\b\a\e\v; This is test.", "123", "4.56e-34", "Test for freetext"])
+      assert_equal(val_Comment, @obj.attribute('Comment'))
+      assert_equal('', @obj.attribute('Note'))
+      assert_equal('IdString', @obj.attribute('Misc'))
+    end
+
+    def test_attribute_nonexistent
+      assert_equal(nil, @obj.attribute('NonExistent'))
+    end
+
+    def test_get_attribute
+      val_Target = Bio::GFF::GFF2::Record::Value.new(['HBA_HUMAN', '11', '55'])
+      assert_equal(val_Target, @obj.get_attribute('Target'))
+      assert_equal('0.0003', @obj.get_attribute('E_value'))
+      val_Align0 = Bio::GFF::GFF2::Record::Value.new(['101', '11'])
+      val_Align1 = Bio::GFF::GFF2::Record::Value.new(['179', '36'])
+      assert_equal(val_Align0, @obj.get_attribute('Align'))
+      val_Comment = Bio::GFF::GFF2::Record::Value.new(["Please ignore this \"Comment\" attribute; Escape \x1a\037 and \\\t\r\n\f\b\a\e\v; This is test.", "123", "4.56e-34", "Test for freetext"])
+      assert_equal(val_Comment, @obj.get_attribute('Comment'))
+      assert_equal('', @obj.get_attribute('Note'))
+      assert_equal('IdString', @obj.get_attribute('Misc'))
+    end
+
+    def test_get_attribute_nonexistent
+      assert_equal(nil, @obj.get_attribute('NonExistent'))
+    end
+
+    def test_get_attributes
+      val_Target = Bio::GFF::GFF2::Record::Value.new(['HBA_HUMAN', '11', '55'])
+      assert_equal([ val_Target ], @obj.get_attributes('Target'))
+      assert_equal([ '0.0003' ], @obj.get_attributes('E_value'))
+      val_Align0 = Bio::GFF::GFF2::Record::Value.new(['101', '11'])
+      val_Align1 = Bio::GFF::GFF2::Record::Value.new(['179', '36'])
+      assert_equal([ val_Align0, val_Align1 ],
+                   @obj.get_attributes('Align'))
+      val_Comment = Bio::GFF::GFF2::Record::Value.new(["Please ignore this \"Comment\" attribute; Escape \x1a\037 and \\\t\r\n\f\b\a\e\v; This is test.", "123", "4.56e-34", "Test for freetext"])
+      assert_equal([ val_Comment ], @obj.get_attributes('Comment'))
+      assert_equal([ '' ], @obj.get_attributes('Note'))
+      assert_equal([ 'IdString', 'free text', '5678' ], 
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_get_attributes_nonexistent
+      assert_equal([], @obj.get_attributes('NonExistent'))
+    end
+
+    def test_set_attribute
+      assert_equal('0.0003', @obj.attribute('E_value'))
+      assert_equal('1e-10', @obj.set_attribute('E_value', '1e-10'))
+      assert_equal('1e-10', @obj.attribute('E_value'))
+    end
+
+    def test_set_attribute_multiple
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal('Replaced',
+                   @obj.set_attribute('Misc', 'Replaced'))
+      assert_equal([ 'Replaced', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_set_attribute_nonexistent
+      assert_equal(nil, @obj.attribute('NonExistent'))
+      assert_equal('test', @obj.set_attribute('NonExistent', 'test'))
+      assert_equal('test', @obj.attribute('NonExistent'))
+    end
+
+    def test_replace_attributes
+      assert_equal([ '0.0003' ], @obj.get_attributes('E_value'))
+      assert_equal(@obj, @obj.replace_attributes('E_value', '1e-10'))
+      assert_equal([ '1e-10' ], @obj.get_attributes('E_value'))
+    end
+
+    def test_replace_attributes_single_multiple
+      assert_equal([ '0.0003' ], @obj.get_attributes('E_value'))
+      assert_equal(@obj, @obj.replace_attributes('E_value',
+                                                 '1e-10', '3.14', '2.718'))
+      assert_equal([ '1e-10', '3.14', '2.718' ],
+                   @obj.get_attributes('E_value'))
+    end
+
+    def test_replace_attributes_multiple_single
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal(@obj,
+                   @obj.replace_attributes('Misc', 'Replaced_All'))
+      assert_equal([ 'Replaced_All' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_replace_attributes_multiple_multiple_two
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal(@obj,
+                   @obj.replace_attributes('Misc',
+                                           'Replaced', 'test2'))
+      assert_equal([ 'Replaced', 'test2' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_replace_attributes_multiple_multiple_same
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal(@obj,
+                   @obj.replace_attributes('Misc',
+                                           'Replaced', 'test2', 'test3'))
+      assert_equal([ 'Replaced', 'test2', 'test3' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_replace_attributes_multiple_multiple_over
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal(@obj,
+                   @obj.replace_attributes('Misc',
+                                           'Replaced', 'test2', 'test3', '4'))
+      assert_equal([ 'Replaced', 'test2', 'test3', '4' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_replace_attributes_nonexistent
+      assert_equal(nil, @obj.attribute('NonExistent'))
+      assert_equal(@obj, @obj.replace_attributes('NonExistent', 'test'))
+      assert_equal([ 'test' ], @obj.get_attributes('NonExistent'))
+    end
+
+    def test_replace_attributes_nonexistent_multiple
+      assert_equal(nil, @obj.attribute('NonExistent'))
+      assert_equal(@obj,
+                   @obj.replace_attributes('NonExistent',
+                                           'test', 'gff2', 'attr'))
+      assert_equal([ 'test', 'gff2', 'attr' ],
+                   @obj.get_attributes('NonExistent'))
+    end
+
+    def test_delete_attribute
+      assert_equal('0.0003', @obj.attribute('E_value'))
+      assert_equal('0.0003', @obj.delete_attribute('E_value', '0.0003'))
+      assert_equal(nil, @obj.attribute('E_value'))
+    end
+
+    def test_delete_attribute_nil
+      assert_equal('0.0003', @obj.attribute('E_value'))
+      assert_equal(nil, @obj.delete_attribute('E_value', '3'))
+      assert_equal('0.0003', @obj.attribute('E_value'))
+    end
+
+    def test_delete_attribute_multiple
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal('free text',
+                   @obj.delete_attribute('Misc', 'free text'))
+      assert_equal([ 'IdString', '5678' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_delete_attribute_multiple2
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal('IdString',
+                   @obj.delete_attribute('Misc', 'IdString'))
+      assert_equal([ 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal('5678',
+                   @obj.delete_attribute('Misc', '5678'))
+      assert_equal([ 'free text' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_delete_attribute_multiple_nil
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal(nil,
+                   @obj.delete_attribute('Misc', 'test'))
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_delete_attribute_nonexistent
+      assert_equal(nil, @obj.attribute('NonExistent'))
+      assert_equal(nil, @obj.delete_attribute('NonExistent', 'test'))
+      assert_equal([], @obj.get_attributes('NonExistent'))
+    end
+
+    def test_delete_attributes
+      assert_equal('0.0003', @obj.attribute('E_value'))
+      assert_equal(@obj, @obj.delete_attributes('E_value'))
+      assert_equal(nil, @obj.attribute('E_value'))
+    end
+
+    def test_delete_attributes_multiple
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+      assert_equal(@obj, @obj.delete_attributes('Misc'))
+      assert_equal([], @obj.get_attributes('Misc'))
+    end
+
+    def test_delete_attributes_nonexistent
+      assert_equal(nil, @obj.attribute('NonExistent'))
+      assert_equal(nil, @obj.delete_attributes('NonExistent'))
+      assert_equal([], @obj.get_attributes('NonExistent'))
+    end
+
+    def test_sort_attributes_by_tag!
+      tags = %w( Comment Align E_value Note )
+      assert_equal(@obj, @obj.sort_attributes_by_tag!(tags))
+      assert_equal(%w( Comment Align Align E_value Note Target
+                       Misc Misc Misc ),
+                   @obj.attributes.collect { |x| x[0] })
+      # check if the order of 'Misc' is not changed
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_sort_attributes_by_tag_bang_test2
+      tags = %w( E_value Misc Note Target )
+      assert_equal(@obj, @obj.sort_attributes_by_tag!(tags))
+      assert_equal(%w( E_value Misc Misc Misc Note Target
+                       Align Align Comment ),
+                   @obj.attributes.collect { |x| x[0] })
+      # check if the order of 'Misc' is not changed
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+    end
+
+    def test_sort_attributes_by_tag_bang_with_block
+      assert_equal(@obj,
+                   @obj.sort_attributes_by_tag! { |x, y|
+                     x <=> y
+                   })
+      assert_equal(%w( Align Align Comment E_value Misc Misc Misc
+                       Note Target ),
+                   @obj.attributes.collect { |x| x[0] })
+      # check if the order of 'Misc' is not changed
+      assert_equal([ 'IdString', 'free text', '5678' ],
+                   @obj.get_attributes('Misc'))
+    end
+  end #class TestGFF2Record
+
+  class TestGFF2RecordEmpty < Test::Unit::TestCase
+    def setup
+      @obj = Bio::GFF::GFF2::Record.new('# test comment')
+    end
+
+    def test_comment_only?
+      assert_equal(true, @obj.comment_only?)
+    end
+
+    def test_comment_only_false
+      @obj.seqname = 'test'
+      assert_equal(false, @obj.comment_only?)
+    end
+
+    def test_to_s
+      assert_equal("# test comment\n", @obj.to_s)
+    end
+
+    def test_to_s_not_empty
+      @obj.seqname = 'test'
+      @obj.feature = 'region'
+      @obj.start = 1
+      @obj.end = 100
+      assert_equal("test\t.\tregion\t1\t100\t.\t.\t.\t\t# test comment\n",
+                   @obj.to_s)
+      @obj.add_attribute('Gene', 'unknown')
+      assert_equal("test\t.\tregion\t1\t100\t.\t.\t.\tGene unknown\t# test comment\n",
+                   @obj.to_s)
+    end
+
+    def test_comment
+      assert_equal(' test comment', @obj.comment)
+    end
+
+    def test_comment_eq
+      assert_equal('changed the comment',
+                   @obj.comment = 'changed the comment')
+    end
+  end #class TestGFF2RecordEmpty
+
+  class TestGFF2ComplexAttributes < Test::Unit::TestCase
+
+    # The test string comes from the Popular genome annotation from the JGI.
+    # ftp://ftp.jgi-psf.org/pub/JGI_data/Poplar/annotation/v1.1/Poptr1_1.JamboreeModels.gff.gz
+    # Thanks to Tomoaki NISHIYAMA who picks up the example line.
+    def test_attributes_case1
+      str = "LG_I\tJGI\tCDS\t11052\t11064\t.\t-\t0\tname \"grail3.0116000101\"; proteinId 639579; exonNumber 3\n"
+
+      attributes = [
+        [ "name",       "grail3.0116000101" ],
+        [ "proteinId",  "639579" ],
+        [ "exonNumber", "3" ]
+      ]
+      record = Bio::GFF::GFF2::Record.new(str)
+      assert_equal(attributes, record.attributes)
+    end
+
+    # The test string is modified from that of test_attributes_case1.
+    def test_attributes_case2
+      str = "LG_I\tJGI\tCDS\t11052\t11064\t.\t-\t0\tname \"grail3.0116000101\"; proteinId 639579; exonNumber 3; Note \"Semicolons ; and \;, and quote \\\" can be OK\"; Comment \"This is the \\\"comment\\\"\"\n"
+
+      attributes = [
+        [ "name", "grail3.0116000101" ],
+        [ "proteinId", "639579" ],
+        [ "exonNumber", "3" ],
+        [ "Note", "Semicolons ; and ;, and quote \" can be OK" ],
+        [ "Comment", "This is the \"comment\"" ]
+      ]
+      record = Bio::GFF::GFF2::Record.new(str)
+      assert_equal(attributes, record.attributes)
+    end
+
+    def test_attributes_incompatible_backslash_semicolon
+      # No special treatments for backslash-semicolon outside the free text.
+      str =<<END_OF_DATA
+I	sgd	gene	151453	151591	.	+	.	Gene "CEN1" ; Note "Chromosome I Centromere"; Semicolon a "b;c" d "e;f;g" h; Illegal a\\;b c d; Comment "a ; b"
+END_OF_DATA
+
+      attributes = [
+        [ 'Gene',      'CEN1' ],
+        [ 'Note',      'Chromosome I Centromere' ],
+        [ 'Semicolon',
+          Bio::GFF::GFF2::Record::Value.new(['a', 'b;c', 'd', 'e;f;g', 'h']) ],
+        [ 'Illegal',   "a\\" ],
+        [  'b', Bio::GFF::GFF2::Record::Value.new(['c', 'd']) ],
+        [ 'Comment',   'a ; b' ]
+      ]
+      record = Bio::GFF::GFF2::Record.new(str)
+      assert_equal(attributes, record.attributes)
+    end
+
+  end #class TestGFF2ComplexAttributes
+
+  class TestGFF2MetaData < Test::Unit::TestCase
+    def setup
+      @data =
+        Bio::GFF::GFF2::MetaData.new('date', '2008-09-22')
+    end
+
+    def test_parse
+      assert_equal(@data,
+                   Bio::GFF::GFF2::MetaData.parse('##date 2008-09-22'))
+    end
+
+    def test_directive
+      assert_equal('date', @data.directive)
+    end
+
+    def test_data
+      assert_equal('2008-09-22', @data.data)
+    end
+  end #class TestGFF2MetaData
+
+  class TestGFF3 < Test::Unit::TestCase
+    def setup
+      @data =<<END_OF_DATA
+##gff-version 3
+##sequence-region test01 1 400
+test01	RANDOM	contig	1	400	.	+	.	ID=test01;Note=this is test
+test01	.	mRNA	101	230	.	+	.	ID=mrna01;Name=testmRNA;Note=this is test mRNA
+test01	.	mRNA	101	280	.	+	.	ID=mrna01a;Name=testmRNAalterative;Note=test of alternative splicing variant
+test01	.	exon	101	160	.	+	.	ID=exon01;Name=exon01;Alias=exon 1;Parent=mrna01,mrna01a
+test01	.	exon	201	230	.	+	.	ID=exon02;Name=exon02;Alias=exon 2;Parent=mrna01
+test01	.	exon	251	280	.	+	.	ID=exon02a;Name=exon02a;Alias=exon 2a;Parent=mrna01a
+test01	.	Match	101	123	.	.	.	ID=match01;Name=match01;Target=EST101 1 21;Gap=M8 D3 M6 I1 M6
+##FASTA
+>test01
+ACGAAGATTTGTATGACTGATTTATCCTGGACAGGCATTGGTCAGATGTCTCCTTCCGTATCGTCGTTTA
+GTTGCAAATCCGAGTGTTCGGGGGTATTGCTATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACA
+CCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGAT
+AATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTAGT
+GCCCAAGAATGCGATCCCAGAAGTCTTGGTTCTAAAGTCGTCGGAAAGATTTGAGGAACTGCCATACAGC
+CCGTGGGTGAAACTGTCGACATCCATTGTGCGAATAGGCCTGCTAGTGAC
+END_OF_DATA
+      @gff3 = Bio::GFF::GFF3.new(@data)
+    end
+
+    def test_const_version
+      assert_equal(3, Bio::GFF::GFF3::VERSION)
+    end
+
+    def test_sequence_regions
+      region = Bio::GFF::GFF3::SequenceRegion.new('test01', 1, 400)
+      assert_equal([ region ], @gff3.sequence_regions)
+    end
+
+    def test_gff_version
+      assert_equal('3', @gff3.gff_version)
+    end
+
+    def test_records
+      assert_equal(7, @gff3.records.size)
+      r_test01 = Bio::GFF::GFF3::Record.new('test01',
+                                            'RANDOM',
+                                            'contig',
+                                            1, 400, nil, '+', nil,
+                                            [ ['ID', 'test01'],
+                                              ['Note', 'this is test'] ])
+      r_mrna01 = Bio::GFF::GFF3::Record.new('test01',
+                                            nil,
+                                            'mRNA',
+                                            101, 230, nil, '+', nil,
+                                            [ ['ID', 'mrna01'],
+                                              ['Name', 'testmRNA'],
+                                              ['Note', 'this is test mRNA'] ])
+      r_exon01 = Bio::GFF::GFF3::Record.new('test01',
+                                            nil,
+                                            'exon',
+                                            101, 160, nil, '+', nil,
+                                            [ ['ID', 'exon01'],
+                                              ['Name', 'exon01'],
+                                              ['Alias', 'exon 1'],
+                                              ['Parent', 'mrna01'],
+                                              ['Parent', 'mrna01a'] ])
+
+      target = Bio::GFF::GFF3::Record::Target.new('EST101', 1, 21)
+      gap = Bio::GFF::GFF3::Record::Gap.new('M8 D3 M6 I1 M6')
+      r_match01 =Bio::GFF::GFF3::Record.new('test01',
+                                            nil,
+                                            'Match',
+                                            101, 123, nil, nil, nil,
+                                            [ ['ID', 'match01'],
+                                              ['Name', 'match01'],
+                                              ['Target', target],
+                                              ['Gap', gap] ])
+      assert_equal(r_test01, @gff3.records[0])
+      assert_equal(r_mrna01, @gff3.records[1])
+      assert_equal(r_exon01, @gff3.records[3])
+      assert_equal(r_match01, @gff3.records[6])
+    end
+
+    def test_sequences
+      assert_equal(1, @gff3.sequences.size)
+      assert_equal('test01', @gff3.sequences[0].entry_id)
+      assert_equal('3510a3c4f66f9c2ab8d4d97446490aced7ed1fa4',
+                   Digest::SHA1.hexdigest(@gff3.sequences[0].seq.to_s))
+    end
+
+    def test_to_s
+      assert_equal(@data, @gff3.to_s)
+    end
+
+  end #class TestGFF3
+
+  class TestGFF3Record < Test::Unit::TestCase
+    
+    def setup
+      data =<<END_OF_DATA
+chrI	SGD	centromere	151467	151584	.	+	.	ID=CEN1;Name=CEN1;gene=CEN1;Alias=CEN1,test%3B0001;Note=Chromosome%20I%20centromere;dbxref=SGD:S000006463;Target=test%2002 123 456 -,test%2C03 159 314;memo%3Dtest%3Battr=99.9%25%09match
+END_OF_DATA
+      @obj = Bio::GFF::GFF3::Record.new(data)
+    end
+
+    def test_seqname
+      assert_equal('chrI', @obj.seqname)
+    end
+
+    def test_source
+      assert_equal('SGD', @obj.source)
+    end
+
+    def test_feature
+      assert_equal('centromere', @obj.feature)
+    end
+
+    def test_start
+      assert_equal(151467, @obj.start)
+    end
+
+    def test_end
+      assert_equal(151584, @obj.end)
+    end
+
+    def test_score
+      assert_equal(nil, @obj.score)
+    end
+
+    def test_strand
+      assert_equal('+', @obj.strand)
+    end
+
+    def test_frame
+      assert_equal(nil, @obj.frame)
+    end
+
+    def test_attributes
+      attr = [
+        ['ID',     'CEN1'],
+        ['Name',   'CEN1'],
+        ['gene',   'CEN1'],
+        ['Alias',  'CEN1'],
+        ['Alias',  'test;0001'],
+        ['Note',   'Chromosome I centromere'],
+        ['dbxref', 'SGD:S000006463'],
+        ['Target',
+         Bio::GFF::GFF3::Record::Target.new('test 02', 123, 456, '-')],
+        ['Target',
+         Bio::GFF::GFF3::Record::Target.new('test,03', 159, 314)],
+        ['memo=test;attr', "99.9%\tmatch"]
+      ]
+      assert_equal(attr, @obj.attributes)
+    end
+
+    def test_to_s
+      str =<<END_OF_DATA
+chrI	SGD	centromere	151467	151584	.	+	.	ID=CEN1;Name=CEN1;gene=CEN1;Alias=CEN1,test%3B0001;Note=Chromosome I centromere;dbxref=SGD:S000006463;Target=test%2002 123 456 -,test%2C03 159 314;memo%3Dtest%3Battr=99.9%25%09match
+END_OF_DATA
+      assert_equal(str, @obj.to_s)
+    end
+
+    def test_to_s_attr_order_changed
+      str = <<END_OF_STR
+chrI	SGD	centromere	151467	151584	.	+	.	ID=CEN1;Name=CEN1;Alias=CEN1,test%3B0001;Target=test%2002 123 456 -,test%2C03 159 314;Note=Chromosome I centromere;dbxref=SGD:S000006463;gene=CEN1;memo%3Dtest%3Battr=99.9%25%09match
+END_OF_STR
+
+      keys = [ 'ID', 'Name', 'Alias', 'Target', 'Note', 'dbxref', 'gene' ]
+      @obj.sort_attributes_by_tag!(keys)
+      assert_equal(str, @obj.to_s)
+    end
+  end #class TestGFF3Record
+
+  class TestGFF3RecordMisc < Test::Unit::TestCase
+    def test_attributes_none
+      # test blank with tab
+      data =<<END_OF_DATA
+I	sgd	gene	151453	151591	.	+	.	
+END_OF_DATA
+      obj = Bio::GFF::GFF3::Record.new(data)
+      assert_equal([], obj.attributes)
+      
+      # test blank with no tab at end
+      data =<<END_OF_DATA
+I	sgd	gene	151453	151591	.	+	.
+END_OF_DATA
+      obj = Bio::GFF::GFF3::Record.new(data)
+      assert_equal([], obj.attributes)
+    end
+    
+    def test_attributes_one
+      data =<<END_OF_DATA
+I	sgd	gene	151453	151591	.	+	.	ID=CEN1
+END_OF_DATA
+      obj = Bio::GFF::GFF3::Record.new(data)
+      at = [ ["ID", 'CEN1'] ]
+      assert_equal(at, obj.attributes)
+    end
+    
+    def test_attributes_with_escaping
+      data =<<END_OF_DATA
+I	sgd	gene	151453	151591	.	+	.	ID=CEN1;gene=CEN1%3Boh;Note=Chromosome I Centromere
+END_OF_DATA
+      obj = Bio::GFF::GFF3::Record.new(data)
+      at = [ ['ID',   'CEN1'],
+             ["gene", 'CEN1;oh'],
+             ["Note", 'Chromosome I Centromere']
+           ]
+      assert_equal(at, obj.attributes)      
+    end
+    
+    def test_score
+      data =<<END_OF_DATA
+ctg123	src	match	456	788	1e-10	-	.	ID=test01
+END_OF_DATA
+      obj = Bio::GFF::GFF3::Record.new(data)
+      assert_equal(1e-10, obj.score)
+      obj.score = 0.5
+      assert_equal(0.5, obj.score)
+    end
+
+    def test_phase
+      data =<<END_OF_DATA
+ctg123	src	CDS	456	788	.	-	2	ID=test02
+END_OF_DATA
+      obj = Bio::GFF::GFF3::Record.new(data)
+      assert_equal(2, obj.phase)
+      assert_equal(2, obj.frame)
+      obj.phase = 1
+      assert_equal(1, obj.phase)
+      assert_equal(1, obj.frame)
+    end
+
+    def test_initialize_9
+      obj = Bio::GFF::GFF3::Record.new('test01',
+                                       'testsrc',
+                                       'exon',
+                                       1, 400, nil, '+', nil,
+                                       [ ['ID',   'test01'],
+                                         ['Note', 'this is test'] ])
+      assert_equal('test01', obj.seqid)
+    end
+
+    def test_to_s_void
+      obj = Bio::GFF::GFF3::Record.new
+      assert_equal(".\t.\t.\t.\t.\t.\t.\t.\t.\n", obj.to_s)
+    end
+
+  end #class TestGFF3RecordMisc
+
+  class TestGFF3RecordEscape < Test::Unit::TestCase
+    def setup
+      @obj = Object.new.extend(Bio::GFF::GFF3::Escape)
+      @str = "A>B\tC=100%;d=e,f,g h"
+    end
+
+    def test_escape
+      str = @str
+      assert_equal('A>B%09C=100%25;d=e,f,g h',
+                   @obj.instance_eval { escape(str) })
+    end
+
+    def test_escape_attribute
+      str = @str
+      assert_equal('A>B%09C%3D100%25%3Bd%3De%2Cf%2Cg h',
+                   @obj.instance_eval { escape_attribute(str) })
+    end
+
+    def test_escape_seqid
+      str = @str
+      assert_equal('A%3EB%09C%3D100%25%3Bd%3De%2Cf%2Cg%20h',
+                   @obj.instance_eval { escape_seqid(str) })
+    end
+
+    def test_unescape
+      escaped_str = 'A%3EB%09C%3D100%25%3Bd%3De%2Cf%2Cg%20h'
+      assert_equal(@str,
+                   @obj.instance_eval {
+                     unescape(escaped_str) })
+    end
+  end #class TestGFF3RecordEscape
+
+  class TestGFF3RecordTarget < Test::Unit::TestCase
+
+    def setup
+      @target =
+        [ Bio::GFF::GFF3::Record::Target.new('ABCD1234', 123, 456, '+'),
+          Bio::GFF::GFF3::Record::Target.new(">X Y=Z;P%,Q\tR", 78, 90),
+          Bio::GFF::GFF3::Record::Target.new(nil, nil, nil),
+        ]
+    end
+
+    def test_parse
+      strings = 
+        [ 'ABCD1234 123 456 +',
+          '%3EX%20Y%3DZ%3BP%25%2CQ%09R 78 90',
+          ''
+        ]
+      @target.each do |target|
+        str = strings.shift
+        assert_equal(target, Bio::GFF::GFF3::Record::Target.parse(str))
+      end
+    end
+
+    def test_target_id
+      assert_equal('ABCD1234', @target[0].target_id)
+      assert_equal(">X Y=Z;P%,Q\tR", @target[1].target_id)
+      assert_equal(nil, @target[2].target_id)
+    end
+
+    def test_start
+      assert_equal(123, @target[0].start)
+      assert_equal(78, @target[1].start)
+      assert_nil(@target[2].start)
+    end
+
+    def test_end
+      assert_equal(456, @target[0].end)
+      assert_equal(90, @target[1].end)
+      assert_nil(@target[2].end)
+    end
+
+    def test_strand
+      assert_equal('+', @target[0].strand)
+      assert_nil(@target[1].strand)
+      assert_nil(@target[2].strand)
+    end
+
+    def test_to_s
+      assert_equal('ABCD1234 123 456 +', @target[0].to_s)
+      assert_equal('%3EX%20Y%3DZ%3BP%25%2CQ%09R 78 90', @target[1].to_s)
+      assert_equal('. . .', @target[2].to_s)
+    end
+
+  end #class TestGFF3RecordTarget
+
+  class TestGFF3RecordGap < Test::Unit::TestCase
+    def setup
+      # examples taken from http://song.sourceforge.net/gff3.shtml
+      @gaps_src = [ 'M8 D3 M6 I1 M6',
+                    'M3 I1 M2 F1 M4',
+                    'M3 I1 M2 R1 M4' ]
+      @gaps = @gaps_src.collect { |x| Bio::GFF::GFF3::Record::Gap.new(x) }
+    end
+
+    def test_to_s
+      @gaps_src.each do |src|
+        assert_equal(src, @gaps.shift.to_s)
+      end
+    end
+
+    def test_eqeq
+      gap = Bio::GFF::GFF3::Record::Gap.new('M8 D3 M6 I1 M6')
+      assert(gap == @gaps[0])
+      assert_equal(false, gap == @gaps[1])
+    end
+
+    def test_process_sequences_na
+      ref = 'CAAGACCTAAACTGGATTCCAAT'
+      tgt = 'CAAGACCTCTGGATATCCAAT'
+      ref_aligned = 'CAAGACCTAAACTGGAT-TCCAAT'
+      tgt_aligned = 'CAAGACCT---CTGGATATCCAAT'
+      assert_equal([ ref_aligned, tgt_aligned ],
+                   @gaps[0].process_sequences_na(ref, tgt))
+    end
+
+    def test_process_sequences_na_tooshort
+      ref = 'CAAGACCTAAACTGGATTCCAA'
+      tgt = 'CAAGACCTCTGGATATCCAA'
+      assert_raise(RuntimeError) { @gaps[0].process_sequences_na(ref, tgt) }
+      ref = 'c'
+      tgt = 'c'
+      assert_raise(RuntimeError) { @gaps[0].process_sequences_na(ref, tgt) }
+    end
+
+    def test_process_sequences_na_aa
+      ref1 = 'atgaaggaggttattgaatgtcggcggt'
+      tgt1 = 'MKEVVINVGG'
+      ref1_aligned = 'atgaaggag---gttattgaatgtcggcggt'
+      tgt1_aligned = 'M  K  E  V  V  I  >N  V  G  G  '
+      assert_equal([ ref1_aligned, tgt1_aligned ],
+                   @gaps[1].process_sequences_na_aa(ref1, tgt1))
+    end
+
+    def test_process_sequences_na_aa_reverse_frameshift
+      ref2 = 'atgaaggaggttataatgtcggcggt'
+      tgt2 = 'MKEVVINVGG'
+      ref2_aligned = 'atgaaggag---gttat<aatgtcggcggt'
+      tgt2_aligned = 'M  K  E  V  V  I  N  V  G  G  '
+      assert_equal([ ref2_aligned, tgt2_aligned ],
+                   @gaps[2].process_sequences_na_aa(ref2, tgt2))
+    end
+
+    def test_process_sequences_na_aa_reverse_frameshift_more
+      gap = Bio::GFF::GFF3::Record::Gap.new("M3 R3 M3")
+      ref = 'atgaagattaatgtc'
+      tgt = 'MKIINV'
+      ref_aligned = 'atgaag<<<attaatgtc'
+      tgt_aligned = 'M  K  I  I  N  V  '
+      assert_equal([ ref_aligned, tgt_aligned ],
+                   gap.process_sequences_na_aa(ref, tgt))
+    end
+
+    def test_process_sequences_na_aa_tooshort
+      ref2 = 'atgaaggaggttataatgtcggcgg'
+      tgt2 = 'MKEVVINVG'
+      assert_raise(RuntimeError) do
+        @gaps[2].process_sequences_na_aa(ref2, tgt2)
+      end
+
+      ref2 = 'atg'
+      tgt2 = 'M'
+      assert_raise(RuntimeError) do
+        @gaps[2].process_sequences_na_aa(ref2, tgt2)
+      end
+    end
+
+    def test___scan_gap
+      str1 = 'CAAGACCT---CTGGATATCCAAT'
+      str2 = '-aaaaaaa-a-a---ggag--'
+      c = Bio::GFF::GFF3::Record::Gap::Code
+      data1 = [ c.new(:M, 8), c.new(:I, 3), c.new(:M, 13) ]
+      data2 = [ c.new(:I, 1), c.new(:M, 7), c.new(:I, 1), 
+                c.new(:M, 1), c.new(:I, 1), c.new(:M, 1),
+                c.new(:I, 3), c.new(:M, 4), c.new(:I, 2) ]
+
+      assert_equal(data1, @gaps[0].instance_eval { __scan_gap(str1) })
+      assert_equal(data2, @gaps[0].instance_eval { __scan_gap(str2) })
+    end
+
+    def test_new_from_sequences_na
+      ref_aligned = 'CAAGACCTAAACTGGAT-TCCAAT'
+      tgt_aligned = 'CAAGACCT---CTGGATATCCAAT'
+      
+      assert_equal(@gaps[0], Bio::GFF::GFF3::Record::Gap.new_from_sequences_na(ref_aligned, tgt_aligned))
+    end
+
+    def test_new_from_sequences_na_aa
+      ref = 'atgaaggag---gttattgaatgtcggcggt'
+      tgt = 'M  K  E  V  V  I  >N  V  G  G  '
+      assert_equal(@gaps[1],
+                   Bio::GFF::GFF3::Record::Gap.new_from_sequences_na_aa(ref,
+                                                                        tgt))
+    end
+
+    def test_new_from_sequences_na_aa_reverse_frameshift
+      ref = 'atgaaggag---gttat<aatgtcggcggt'
+      tgt = 'M  K  E  V  V  I  N  V  G  G  '
+      assert_equal(@gaps[2],
+                   Bio::GFF::GFF3::Record::Gap.new_from_sequences_na_aa(ref,
+                                                                        tgt))
+    end
+
+    def test_new_from_sequences_na_aa_reverse_frameshift_more
+      gap = Bio::GFF::GFF3::Record::Gap.new("M3 R3 M3")
+      ref = 'atgaag<<<attaatgtc'
+      tgt = 'M  K  I  I  N  V  '
+      assert_equal(gap,
+                   Bio::GFF::GFF3::Record::Gap.new_from_sequences_na_aa(ref,
+                                                                        tgt))
+    end
+
+    def test_new_from_sequences_na_aa_boundary_gap
+      g = Bio::GFF::GFF3::Record::Gap
+
+      ref = '---atgatg'
+      tgt = 'K  M  M  '
+      assert_equal(Bio::GFF::GFF3::Record::Gap.new('I1 M2'),
+                   g.new_from_sequences_na_aa(ref, tgt))
+
+      ref = 'atgatg---'
+      tgt = 'M  M  K  '
+      assert_equal(Bio::GFF::GFF3::Record::Gap.new('M2 I1'),
+                   g.new_from_sequences_na_aa(ref, tgt))
+
+      ref = 'atgatgatg'
+      tgt = '-  M  M  '
+      assert_equal(Bio::GFF::GFF3::Record::Gap.new('D1 M2'),
+                   g.new_from_sequences_na_aa(ref, tgt))
+
+      ref = 'atgatgatg'
+      tgt = 'M  M  -  '
+      assert_equal(Bio::GFF::GFF3::Record::Gap.new('M2 D1'),
+                   g.new_from_sequences_na_aa(ref, tgt))
+    end
+
+    def test_new_from_sequences_na_aa_example
+      gap = Bio::GFF::GFF3::Record::Gap.new('M2 R1 M1 F2 M1')
+      ref1 = 'atgg-taagac-att'
+      tgt1 = 'M  V  K  -  I  '
+      ref2 = 'atggt<aagacatt'
+      tgt2 = 'M  V  K  >>I  '
+      gap1 = Bio::GFF::GFF3::Record::Gap.new_from_sequences_na_aa(ref1, tgt1)
+      assert_equal(gap, gap1)
+      gap2 = Bio::GFF::GFF3::Record::Gap.new_from_sequences_na_aa(ref2, tgt2)
+      assert_equal(gap, gap2)
+    end
+  end #class TestGFF3RecordGap
+
+  class TestGFF3SequenceRegion < Test::Unit::TestCase
+
+    def setup
+      @data =
+        [ Bio::GFF::GFF3::SequenceRegion.new('ABCD1234', 123, 456),
+          Bio::GFF::GFF3::SequenceRegion.new(">X Y=Z;P%,Q\tR", 78, 90),
+          Bio::GFF::GFF3::SequenceRegion.new(nil, nil, nil),
+        ]
+    end
+
+    def test_parse
+      strings = 
+        [ '##sequence-region ABCD1234 123 456',
+          '##sequence-region %3EX%20Y%3DZ%3BP%25%2CQ%09R 78 90',
+          '##sequence-region'
+        ]
+      @data.each do |reg|
+        str = strings.shift
+        assert_equal(reg, Bio::GFF::GFF3::SequenceRegion.parse(str))
+      end
+    end
+
+    def test_seqid
+      assert_equal('ABCD1234', @data[0].seqid)
+      assert_equal(">X Y=Z;P%,Q\tR", @data[1].seqid)
+      assert_equal(nil, @data[2].seqid)
+    end
+
+    def test_start
+      assert_equal(123, @data[0].start)
+      assert_equal(78, @data[1].start)
+      assert_nil(@data[2].start)
+    end
+
+    def test_end
+      assert_equal(456, @data[0].end)
+      assert_equal(90, @data[1].end)
+      assert_nil(@data[2].end)
+    end
+
+    def test_to_s
+      assert_equal("##sequence-region ABCD1234 123 456\n", @data[0].to_s)
+      assert_equal("##sequence-region %3EX%20Y%3DZ%3BP%25%2CQ%09R 78 90\n",
+                   @data[1].to_s)
+      assert_equal("##sequence-region . . .\n", @data[2].to_s)
+    end
+
+  end #class TestGFF3SequenceRegion
+
+  class TestGFF3MetaData < Test::Unit::TestCase
+
+    def setup
+      @data =
+        Bio::GFF::GFF3::MetaData.new('feature-ontology',
+                                     'http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12')
+    end
+
+    def test_parse
+      assert_equal(@data,
+                   Bio::GFF::GFF3::MetaData.parse('##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12'))
+    end
+
+    def test_directive
+      assert_equal('feature-ontology', @data.directive)
+    end
+
+    def test_data
+      assert_equal('http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12', @data.data)
+    end
+  end #class TestGFF3MetaData
+
+end #module Bio
+
+