wwood-bioruby 1.2.11

data/test/unit/bio/db/test_nexus.rb

@@ -0,0 +1,364 @@
+#
+# = test/bio/db/nexus.rb - Unit test for Bio::Nexus
+#
+# Copyright::  Copyright (C) 2006        Christian M Zmasek <cmzmasek@yahoo.com>
+#
+# License::     The Ruby License
+#
+# $Id:$
+#
+# == Description
+#
+# This file contains unit tests for Bio::Nexus.
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/db/nexus'
+
+module Bio
+  
+  class TestNexus < Test::Unit::TestCase
+
+    NEXUS_STRING_1 = <<-END_OF_NEXUS_STRING
+    #NEXUS
+    Begin Taxa;
+     Dimensions [[comment]] ntax=4;
+     TaxLabels "hag fish" [comment] 'african frog'
+     [lots of different comment follow]
+     [] [a] [[a]] [ a ] [[ a ]] [ [ a ] ] [a ]
+     [[a ]] [ [a ] ] [ a] [[ a]] [ [ a] ] [  ]
+     [[  ]] [ [  ] ] [ a b ] [[ a b ]] [ [ a b ] ]
+     [x[ x [x[ x[[x[[xx[x[  x]] ]x ] []]][x]]x]]]
+     
+     [comment_1 comment_3] "rat    snake" 'red
+     
+     
+     mouse';
+    End;
+    
+    [yet another comment End; ]
+   
+    Begin Characters;
+     Dimensions nchar=20
+                ntax=4;
+             [  ntax=1000; ]
+     Format DataType=DNA
+            Missing=x
+            Gap=- MatchChar=.;
+     Matrix [comment]
+     fish  ACATA GAGGG 
+                       TACCT CTAAG
+     frog  ACTTA GAGGC TACCT CTAGC
+     snake ACTCA CTGGG TACCT TTGCG
+     mouse ACTCA GACGG TACCT TTGCG;
+    End;
+    
+    Begin Trees;
+     [comment]
+     Tree best=(fish,(frog,(snake,mo
+                          use)));
+      [some long comment]                    
+     Tree
+     
+     other=(snake,
+     
+                     (frog,(fish,mo
+                           use
+                           )));
+    End;
+    
+    
+    
+    Begin Trees;
+     [comment]
+     Tree worst=(A,(B,(C,D
+                           )));
+     Tree bad=(a,
+   
+                      (b,(c ,  d
+                           )
+                           
+                           
+                           )     );
+    End; 
+  
+   
+    Begin Distances;
+     Dimensions nchar=20 ntax=5;
+     Format Triangle=Both;
+     Matrix
+     taxon_1 0.0 1.0
+             2.0 4.0 7.0
+     taxon_2 1.0
+             0.0 3.0 5.0 8.0
+     taxon_3 3.0 4.0 0.0 6.0 9.0
+     taxon_4 7.0 3.0 2.0 0.0 9.5
+     taxon_5 1.2 1.3 1.4 1.5 0.0;
+    End;
+  
+    Begin Data;
+     Dimensions ntax=5 nchar=14;
+     Format Datatype=RNA gap=# MISSING=x MatchChar=^;
+     TaxLabels ciona
+                 cow [comment1 commentX] ape
+               'purple urchin' "green lizard";
+     Matrix
+     [ comment [old comment] ]
+     taxon_1    A- CCGTCGA-GTTA
+     taxon_2 T- CCG-CGA-GATC
+     
+     taxon_3 A- C-GTCGA-GATG
+       
+       taxon_4                A-    C   C   TC   G
+         A  -     -G  T         T
+         
+         T
+         
+     taxon_5
+T-CGGTCGT-CTTA;
+    End;
+  
+    Begin Private1;
+     Something foo=5 bar=20;
+     Format Datatype=DNA;
+     Matrix
+      taxon_1 1111 1111111111
+      taxon_2 2222 2222222222
+      taxon_3 3333 3333333333
+      taxon_4 4444 4444444444
+      taxon_5 5555 5555555555;
+    End;
+    
+    Begin Private1;
+     some [boring]
+     interesting [
+      outdated
+     ] data be here
+    End;
+    
+    END_OF_NEXUS_STRING
+    
+    DATA_BLOCK_OUTPUT_STRING = <<-DATA_BLOCK_OUTPUT_STRING
+Begin Data;
+ Dimensions NTax=5 NChar=14;
+ Format DataType=RNA Missing=x Gap=# MatchChar=^;
+ TaxLabels ciona cow ape purple_urchin green_lizard;
+ Matrix
+ taxon_1     A-CCGTCGA-GTTA
+ taxon_2     T-CCG-CGA-GATC
+ taxon_3     A-C-GTCGA-GATG
+ taxon_4     A-CCTCGA--GTTT
+ taxon_5     T-CGGTCGT-CTTA;
+End;
+DATA_BLOCK_OUTPUT_STRING
+
+    def test_nexus
+      
+      nexus = Bio::Nexus.new( NEXUS_STRING_1 )
+      blocks = nexus.get_blocks
+      assert_equal( 8, blocks.size )
+      
+      private_blocks   = nexus.get_blocks_by_name( "private1" )  
+      data_blocks      = nexus.get_data_blocks
+      character_blocks = nexus.get_characters_blocks
+      trees_blocks     = nexus.get_trees_blocks
+      distances_blocks = nexus.get_distances_blocks
+      taxa_blocks      = nexus.get_taxa_blocks
+      
+      assert_equal( 2, private_blocks.size )
+      assert_equal( 1, data_blocks.size )
+      assert_equal( 1, character_blocks.size )
+      assert_equal( 2, trees_blocks.size )
+      assert_equal( 1, distances_blocks.size )
+      assert_equal( 1, taxa_blocks.size )
+      
+      taxa_block = taxa_blocks[ 0 ]
+      assert_equal( taxa_block.get_number_of_taxa.to_i , 4 )
+      assert_equal( taxa_block.get_taxa[ 0 ], "hag_fish" )
+      assert_equal( taxa_block.get_taxa[ 1 ], "african_frog" )
+      assert_equal( taxa_block.get_taxa[ 2 ], "rat_snake" )
+      assert_equal( taxa_block.get_taxa[ 3 ], "red_mouse" )
+      
+      chars_block = character_blocks[ 0 ]
+      assert_equal( chars_block.get_number_of_taxa.to_i, 4 )
+      assert_equal( chars_block.get_number_of_characters.to_i, 20 )
+      assert_equal( chars_block.get_datatype, "DNA" )
+      assert_equal( chars_block.get_match_character, "." )
+      assert_equal( chars_block.get_missing, "x" )
+      assert_equal( chars_block.get_gap_character, "-" )
+      assert_equal( chars_block.get_matrix.get_value( 0, 0 ), "fish" )
+      assert_equal( chars_block.get_matrix.get_value( 1, 0 ), "frog" )
+      assert_equal( chars_block.get_matrix.get_value( 2, 0 ), "snake" )
+      assert_equal( chars_block.get_matrix.get_value( 3, 0 ), "mouse" )
+      assert_equal( chars_block.get_matrix.get_value( 0, 20 ), "G" )
+      assert_equal( chars_block.get_matrix.get_value( 1, 20 ), "C" )
+      assert_equal( chars_block.get_matrix.get_value( 2, 20 ), "G" )
+      assert_equal( chars_block.get_matrix.get_value( 3, 20 ), "G" )
+      assert_equal( chars_block.get_characters_strings_by_name( "fish" )[ 0 ], "ACATAGAGGGTACCTCTAAG" ) 
+      assert_equal( chars_block.get_characters_strings_by_name( "frog" )[ 0 ], "ACTTAGAGGCTACCTCTAGC" ) 
+      assert_equal( chars_block.get_characters_strings_by_name( "snake" )[ 0 ], "ACTCACTGGGTACCTTTGCG" ) 
+      assert_equal( chars_block.get_characters_strings_by_name( "mouse" )[ 0 ], "ACTCAGACGGTACCTTTGCG" ) 
+      
+      assert_equal( chars_block.get_characters_string( 0 ), "ACATAGAGGGTACCTCTAAG" ) 
+      assert_equal( chars_block.get_characters_string( 1 ), "ACTTAGAGGCTACCTCTAGC" ) 
+      assert_equal( chars_block.get_characters_string( 2 ), "ACTCACTGGGTACCTTTGCG" ) 
+      assert_equal( chars_block.get_characters_string( 3 ), "ACTCAGACGGTACCTTTGCG" )
+      
+      assert_equal( chars_block.get_row_name( 1 ), "frog" )
+
+      assert_equal( chars_block.get_sequences_by_name( "fish" )[ 0 ].seq.to_s.downcase, "ACATAGAGGGTACCTCTAAG".downcase ) 
+      assert_equal( chars_block.get_sequences_by_name( "frog" )[ 0 ].seq.to_s.downcase, "ACTTAGAGGCTACCTCTAGC".downcase ) 
+      assert_equal( chars_block.get_sequences_by_name( "snake" )[ 0 ].seq.to_s.downcase, "ACTCACTGGGTACCTTTGCG".downcase ) 
+      assert_equal( chars_block.get_sequences_by_name( "mouse" )[ 0 ].seq.to_s.downcase, "ACTCAGACGGTACCTTTGCG".downcase ) 
+      
+      assert_equal( chars_block.get_sequences_by_name( "fish" )[ 0 ].definition, "fish" )
+      assert_equal( chars_block.get_sequences_by_name( "frog" )[ 0 ].definition, "frog" )
+      assert_equal( chars_block.get_sequences_by_name( "snake" )[ 0 ].definition, "snake" )
+      assert_equal( chars_block.get_sequences_by_name( "mouse" )[ 0 ].definition, "mouse" )
+      
+      assert_equal( chars_block.get_sequence( 0 ).seq.to_s.downcase, "ACATAGAGGGTACCTCTAAG".downcase ) 
+      assert_equal( chars_block.get_sequence( 1 ).seq.to_s.downcase, "ACTTAGAGGCTACCTCTAGC".downcase ) 
+      assert_equal( chars_block.get_sequence( 2 ).seq.to_s.downcase, "ACTCACTGGGTACCTTTGCG".downcase ) 
+      assert_equal( chars_block.get_sequence( 3 ).seq.to_s.downcase, "ACTCAGACGGTACCTTTGCG".downcase ) 
+
+      assert_equal( chars_block.get_sequence( 0 ).definition, "fish" ) 
+      assert_equal( chars_block.get_sequence( 1 ).definition, "frog" ) 
+      assert_equal( chars_block.get_sequence( 2 ).definition, "snake" ) 
+      assert_equal( chars_block.get_sequence( 3 ).definition, "mouse" ) 
+      
+      
+      tree_block_0 = trees_blocks[ 0 ]
+      tree_block_1 = trees_blocks[ 1 ]
+      assert_equal( tree_block_0.get_tree_names[ 0 ], "best" )
+      assert_equal( tree_block_0.get_tree_names[ 1 ], "other" )
+      assert_equal( tree_block_0.get_tree_strings_by_name( "best" )[ 0 ], "(fish,(frog,(snake,mouse)));" )
+      assert_equal( tree_block_0.get_tree_strings_by_name( "other" )[ 0 ], "(snake,(frog,(fish,mouse)));" )
+      
+      best_tree = tree_block_0.get_trees_by_name( "best" )[ 0 ]
+      other_tree = tree_block_0.get_trees_by_name( "other" )[ 0 ]
+      worst_tree = tree_block_1.get_tree( 0 )
+      bad_tree = tree_block_1.get_tree( 1 )
+      assert_equal( 6, best_tree.descendents( best_tree.root ).size )
+      assert_equal( 4, best_tree.leaves.size)
+      assert_equal( 6, other_tree.descendents( other_tree.root ).size )
+      assert_equal( 4, other_tree.leaves.size)
+      fish_leaf_best = best_tree.nodes.find { |x| x.name == 'fish' }
+      assert_equal( 1, best_tree.ancestors(  fish_leaf_best ).size )
+      fish_leaf_other = other_tree.nodes.find { |x| x.name == 'fish' }
+      assert_equal( 3, other_tree.ancestors(  fish_leaf_other ).size )
+
+      a_leaf_worst = worst_tree.nodes.find { |x| x.name == 'A' }
+      assert_equal( 1, worst_tree.ancestors(  a_leaf_worst ).size )
+      c_leaf_bad = bad_tree.nodes.find { |x| x.name == 'c' }
+      assert_equal( 3, bad_tree.ancestors(  c_leaf_bad ).size )
+      
+      
+      dist_block = distances_blocks[ 0 ]
+      assert_equal( dist_block.get_number_of_taxa.to_i, 5 )
+      assert_equal( dist_block.get_number_of_characters.to_i, 20 )
+      assert_equal( dist_block.get_triangle, "Both" )
+      assert_equal( dist_block.get_matrix.get_value( 0, 0 ), "taxon_1" )
+      assert_equal( dist_block.get_matrix.get_value( 1, 0 ), "taxon_2" )
+      assert_equal( dist_block.get_matrix.get_value( 2, 0 ), "taxon_3" )
+      assert_equal( dist_block.get_matrix.get_value( 3, 0 ), "taxon_4" )
+      assert_equal( dist_block.get_matrix.get_value( 4, 0 ), "taxon_5" )
+      assert_equal( dist_block.get_matrix.get_value( 0, 5 ).to_f, 7.0 )
+      assert_equal( dist_block.get_matrix.get_value( 1, 5 ).to_f, 8.0 )
+      assert_equal( dist_block.get_matrix.get_value( 2, 5 ).to_f, 9.0 )
+      assert_equal( dist_block.get_matrix.get_value( 3, 5 ).to_f, 9.5 )
+      assert_equal( dist_block.get_matrix.get_value( 4, 5 ).to_f, 0.0 )
+      
+      data_block = data_blocks[ 0 ]
+      assert_equal( data_block.get_number_of_taxa.to_i, 5 )
+      assert_equal( data_block.get_number_of_characters.to_i, 14 )
+      assert_equal( data_block.get_datatype, "RNA" )
+      assert_equal( data_block.get_match_character, "^" )
+      assert_equal( data_block.get_missing, "x" )
+      assert_equal( data_block.get_gap_character, "#" )
+      assert_equal( data_block.get_matrix.get_value( 0, 0 ), "taxon_1" )
+      assert_equal( data_block.get_matrix.get_value( 1, 0 ), "taxon_2" )
+      assert_equal( data_block.get_matrix.get_value( 2, 0 ), "taxon_3" )
+      assert_equal( data_block.get_matrix.get_value( 3, 0 ), "taxon_4" )
+      assert_equal( data_block.get_matrix.get_value( 4, 0 ), "taxon_5" )
+      assert_equal( data_block.get_matrix.get_value( 0, 14 ), "A" )
+      assert_equal( data_block.get_matrix.get_value( 1, 14 ), "C" )
+      assert_equal( data_block.get_matrix.get_value( 2, 14 ), "G" )
+      assert_equal( data_block.get_matrix.get_value( 3, 14 ), "T" )
+      assert_equal( data_block.get_matrix.get_value( 4, 14 ), "A" )
+      assert_equal( data_block.get_taxa[ 0 ], "ciona" )
+      assert_equal( data_block.get_taxa[ 1 ], "cow" )
+      assert_equal( data_block.get_taxa[ 2 ], "ape" )
+      assert_equal( data_block.get_taxa[ 3 ], "purple_urchin" )
+      assert_equal( data_block.get_taxa[ 4 ], "green_lizard" )
+      
+     
+      assert_equal( data_block.get_characters_strings_by_name( "taxon_1" )[ 0 ], "A-CCGTCGA-GTTA" ) 
+      assert_equal( data_block.get_characters_strings_by_name( "taxon_2" )[ 0 ], "T-CCG-CGA-GATC" ) 
+      assert_equal( data_block.get_characters_strings_by_name( "taxon_3" )[ 0 ], "A-C-GTCGA-GATG" ) 
+      assert_equal( data_block.get_characters_strings_by_name( "taxon_4" )[ 0 ], "A-CCTCGA--GTTT" )
+      assert_equal( data_block.get_characters_strings_by_name( "taxon_5" )[ 0 ], "T-CGGTCGT-CTTA" )     
+      
+      assert_equal( data_block.get_characters_string( 0 ), "A-CCGTCGA-GTTA" ) 
+      assert_equal( data_block.get_characters_string( 1 ), "T-CCG-CGA-GATC" ) 
+      assert_equal( data_block.get_characters_string( 2 ), "A-C-GTCGA-GATG" ) 
+      assert_equal( data_block.get_characters_string( 3 ), "A-CCTCGA--GTTT" )
+      assert_equal( data_block.get_characters_string( 4 ), "T-CGGTCGT-CTTA" )
+      
+      assert_equal( data_block.get_row_name( 0 ), "taxon_1" )
+      assert_equal( data_block.get_row_name( 1 ), "taxon_2" )
+      assert_equal( data_block.get_row_name( 2 ), "taxon_3" )
+      assert_equal( data_block.get_row_name( 3 ), "taxon_4" )
+      assert_equal( data_block.get_row_name( 4 ), "taxon_5" )
+
+      assert_equal( data_block.get_sequences_by_name( "taxon_1" )[ 0 ].seq.to_s.downcase, "A-CCGTCGA-GTTA".downcase ) 
+      assert_equal( data_block.get_sequences_by_name( "taxon_2" )[ 0 ].seq.to_s.downcase, "T-CCG-CGA-GATC".downcase ) 
+      assert_equal( data_block.get_sequences_by_name( "taxon_3" )[ 0 ].seq.to_s.downcase, "A-C-GTCGA-GATG".downcase ) 
+      assert_equal( data_block.get_sequences_by_name( "taxon_4" )[ 0 ].seq.to_s.downcase, "A-CCTCGA--GTTT".downcase ) 
+      assert_equal( data_block.get_sequences_by_name( "taxon_5" )[ 0 ].seq.to_s.downcase, "T-CGGTCGT-CTTA".downcase )
+      
+      assert_equal( data_block.get_sequences_by_name( "taxon_1" )[ 0 ].definition, "taxon_1" )
+      assert_equal( data_block.get_sequences_by_name( "taxon_2" )[ 0 ].definition, "taxon_2" )
+      assert_equal( data_block.get_sequences_by_name( "taxon_3" )[ 0 ].definition, "taxon_3" )
+      assert_equal( data_block.get_sequences_by_name( "taxon_4" )[ 0 ].definition, "taxon_4" )
+      assert_equal( data_block.get_sequences_by_name( "taxon_5" )[ 0 ].definition, "taxon_5" )
+      
+      assert_equal( data_block.get_sequence( 0 ).seq.to_s.downcase, "A-CCGTCGA-GTTA".downcase ) 
+      assert_equal( data_block.get_sequence( 1 ).seq.to_s.downcase, "T-CCG-CGA-GATC".downcase ) 
+      assert_equal( data_block.get_sequence( 2 ).seq.to_s.downcase, "A-C-GTCGA-GATG".downcase ) 
+      assert_equal( data_block.get_sequence( 3 ).seq.to_s.downcase, "A-CCTCGA--GTTT".downcase )
+      assert_equal( data_block.get_sequence( 4 ).seq.to_s.downcase, "T-CGGTCGT-CTTA".downcase ) 
+
+      assert_equal( data_block.get_sequence( 0 ).definition, "taxon_1" ) 
+      assert_equal( data_block.get_sequence( 1 ).definition, "taxon_2" ) 
+      assert_equal( data_block.get_sequence( 2 ).definition, "taxon_3" ) 
+      assert_equal( data_block.get_sequence( 3 ).definition, "taxon_4" )
+      assert_equal( data_block.get_sequence( 4 ).definition, "taxon_5" ) 
+      
+      assert_equal( DATA_BLOCK_OUTPUT_STRING, data_block.to_nexus() ) 
+      
+      generic_0 = private_blocks[ 0 ]
+      generic_1 = private_blocks[ 1 ]
+      assert_equal( generic_0.get_tokens[ 0 ], "Something" )
+      assert_equal( generic_0.get_tokens[ 1 ], "foo" )
+      assert_equal( generic_0.get_tokens[ 2 ], "5" )
+      assert_equal( generic_0.get_tokens[ 3 ], "bar" )
+      assert_equal( generic_0.get_tokens[ 4 ], "20" )
+      assert_equal( generic_0.get_tokens[ 5 ], "Format" )
+      assert_equal( generic_0.get_tokens[ 6 ], "Datatype" )
+      assert_equal( generic_0.get_tokens[ 7 ], "DNA" )
+      assert_equal( generic_0.get_tokens[ 8 ], "Matrix" )
+      assert_equal( generic_0.get_tokens[ 9 ], "taxon_1" )
+      assert_equal( generic_0.get_tokens[10 ], "1111" )
+      assert_equal( generic_1.get_tokens[ 0 ], "some" )
+      assert_equal( generic_1.get_tokens[ 1 ], "interesting" )
+      assert_equal( generic_1.get_tokens[ 2 ], "data" )
+      assert_equal( generic_1.get_tokens[ 3 ], "be" )
+      assert_equal( generic_1.get_tokens[ 4 ], "here" )
+      
+    end # test_nexus
+  end # class TestNexus
+end # module Bio

data/test/unit/bio/db/test_prosite.rb

@@ -0,0 +1,1437 @@
+#
+# test/unit/bio/db/test_prosite.rb - Unit test for Bio::PROSITE
+#
+# Copyright::  Copyright (C) 2005 Mitsuteru Nakao <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_prosite.rb,v 1.6 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/db/prosite'
+
+module Bio
+  class TestPROSITEConst < Test::Unit::TestCase
+
+    def test_delimiter
+      assert_equal("\n//\n", Bio::PROSITE::DELIMITER)
+      assert_equal("\n//\n", Bio::PROSITE::RS)
+    end
+
+    def test_tagsize
+      assert_equal(5, Bio::PROSITE::TAGSIZE)
+    end
+
+  end # class TestPROSITEConst
+
+
+  class TestPROSITE < Test::Unit::TestCase
+
+    def setup
+      bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4)).cleanpath.to_s
+      data = File.open(File.join(bioruby_root, 'test', 'data', 'prosite', 'prosite.dat')).read
+      data = data.split(Bio::PROSITE::RS)[0]
+      @obj = Bio::PROSITE.new(data)
+    end
+
+    def test_name
+      assert_equal("G_PROTEIN_RECEP_F1_1", @obj.name)
+    end
+
+    def test_division
+      data = "PATTERN"
+      assert_equal(data, @obj.division)
+    end
+
+    def test_ac
+      data = "PS00237"
+      assert_equal(data, @obj.ac)
+    end
+
+    def test_dt
+      assert_equal("APR-1990 (CREATED); NOV-1997 (DATA UPDATE); JUL-1998 (INFO UPDATE).", @obj.dt)
+    end
+
+    def test_de
+      data = "G-protein coupled receptors family 1 signature."
+      assert_equal(data, @obj.de)
+    end
+
+    def test_pa
+      pattern = "[GSTALIVMFYWC]-[GSTANCPDE]-{EDPKRH}-x(2)-[LIVMNQGA]-x(2)-[LIVMFT]-[GSTANC]-[LIVMFYWSTAC]-[DENH]-R-[FYWCSH]-x(2)-[LIVM]."
+      assert_equal(pattern, @obj.pa)
+    end
+
+    def test_ma
+      assert_equal('', @obj.ma)
+    end
+
+    def test_ru
+      assert_equal('', @obj.ru)
+    end
+
+    def test_nr
+      data = {"FALSE_NEG"=>112, "POSITIVE"=>[1057, 1057], "PARTIAL"=>48, "FALSE_POS"=>[64, 64], "RELEASE"=>["40.7", 103373], "TOTAL"=>[1121, 1121], "UNKNOWN"=>[0, 0]}
+
+      assert_equal(data, @obj.nr)
+    end
+
+    def test_release
+      assert_equal(['40.7', 103373], @obj.release)
+    end
+
+    def test_swissprot_release_number
+      assert_equal('40.7', @obj.swissprot_release_number)
+    end
+
+    def test_swissprot_release_sequences
+      assert_equal(103373, @obj.swissprot_release_sequences)
+    end
+
+    def test_total
+      assert_equal([1121, 1121], @obj.total)
+    end
+
+    def test_total_hits
+      assert_equal(1121, @obj.total_hits)
+    end
+
+    def test_total_sequences
+      assert_equal(1121, @obj.total_sequences)
+    end
+    
+    def test_positive
+      assert_equal([1057, 1057], @obj.positive)
+    end
+
+    def test_positive_hits
+      assert_equal(1057, @obj.positive_hits)
+    end
+
+    def test_positive_sequences
+      assert_equal(1057, @obj.positive_sequences)
+    end
+    
+    def test_unknown
+      assert_equal([0, 0], @obj.unknown)
+    end
+
+    def test_unknown_hits
+      assert_equal(0, @obj.unknown_hits)
+    end
+
+    def test_unknown_sequences
+      assert_equal(0, @obj.unknown_sequences)
+    end
+
+    def test_false_pos
+      assert_equal([64, 64], @obj.false_pos)
+    end
+
+    def test_false_positive_sequences
+      assert_equal(64, @obj.false_positive_sequences)
+    end
+
+    def test_false_neg
+      assert_equal(112, @obj.false_neg)
+    end
+
+    def test_partial
+      assert_equal(48, @obj.partial)
+    end
+
+    def test_cc
+      assert_equal({"TAXO-RANGE"=>"??E?V", "MAX-REPEAT"=>"1"}, @obj.cc)
+    end
+
+    def test_taxon_range
+      assert_equal('??E?V', @obj.taxon_range)
+    end
+
+    def test_max_repeat
+      assert_equal(1, @obj.max_repeat)
+    end
+    
+    def test_site
+      assert_equal([0, nil], @obj.site)
+    end
+
+    def test_skip_flag
+      assert_equal(nil, @obj.skip_flag)
+    end
+
+    def test_dr
+      assert_equal(Hash, @obj.dr.class)
+      data = ['OPSD_LIMBE', 'T']
+      assert_equal(data, @obj.dr["O42427"])
+    end
+
+    def test_list_xref
+      flag = ''
+      assert_equal([], @obj.list_xref(flag))
+    end
+
+    def test_list_truepositive
+      data = ["O42427",
+ "P11617",
+ "P46090",
+ "P30939",
+ "P28336",
+ "Q9Z2J6",
+ "Q64326",
+ "P46092",
+ "P07550",
+ "Q9UKL2",
+ "P30940",
+ "P46093",
+ "Q61224",
+ "Q63384",
+ "P46094",
+ "Q28309",
+ "P22328",
+ "P46095",
+ "O77590",
+ "O02813",
+ "Q9R1C8",
+ "P22329",
+ "O93441",
+ "O42300",
+ "Q10904",
+ "O43613",
+ "Q9Z0D9",
+ "P18130",
+ "O42301",
+ "O43614",
+ "P22330",
+ "P22331",
+ "Q9GLJ8",
+ "O15552",
+ "O43193",
+ "P22332",
+ "O43194",
+ "Q9WV26",
+ "Q9TST4",
+ "Q62053",
+ "P58307",
+ "O42307",
+ "Q9TST5",
+ "P58308",
+ "Q9TST6",
+ "P41983",
+ "P30951",
+ "P41984",
+ "O02824",
+ "O88626",
+ "P91657",
+ "P30953",
+ "P18825",
+ "O62709",
+ "O42574",
+ "P30954",
+ "Q28585",
+ "O88628",
+ "P30955",
+ "P28221",
+ "Q9WU02",
+ "P28222",
+ "P32299",
+ "P70310",
+ "P28223",
+ "O76099",
+ "P04201",
+ "P35894",
+ "Q15722",
+ "P35895",
+ "O93459",
+ "P14416",
+ "P35897",
+ "P35898",
+ "P35899",
+ "P49578",
+ "O42451",
+ "P47745",
+ "Q9Y5N1",
+ "O42452",
+ "P50052",
+ "P47746",
+ "O97878",
+ "O02835",
+ "Q09502",
+ "Q28596",
+ "O00254",
+ "P31355",
+ "P47747",
+ "O97879",
+ "O02836",
+ "P31356",
+ "P30966",
+ "P79436",
+ "P47748",
+ "P87365",
+ "P08099",
+ "Q9JL21",
+ "P47749",
+ "P87366",
+ "O18481",
+ "P16582",
+ "P87367",
+ "P30968",
+ "O97880",
+ "P47750",
+ "P87368",
+ "Q62758",
+ "P30969",
+ "Q28468",
+ "O97881",
+ "Q09638",
+ "P09703",
+ "P87369",
+ "O95918",
+ "Q9TUE1",
+ "O97882",
+ "P22909",
+ "P09704",
+ "O18485",
+ "O42327",
+ "P47751",
+ "P47883",
+ "P18841",
+ "O55193",
+ "O97883",
+ "O18486",
+ "O42328",
+ "P47884",
+ "Q9EP86",
+ "O42329",
+ "O14626",
+ "P48145",
+ "P47887",
+ "O08725",
+ "P48146",
+ "P30974",
+ "O08858",
+ "O18910",
+ "O42330",
+ "O55197",
+ "O08726",
+ "O70526",
+ "P30975",
+ "O18911",
+ "Q28474",
+ "O18912",
+ "O70528",
+ "O18913",
+ "P34311",
+ "O18914",
+ "O42466",
+ "O95371",
+ "Q9WU25",
+ "P47892",
+ "P70596",
+ "P33396",
+ "P70597",
+ "Q61130",
+ "Q15743",
+ "Q15612",
+ "P51144",
+ "P32745",
+ "O00270",
+ "Q00991",
+ "Q9YGY9",
+ "P29754",
+ "Q9GZK3",
+ "O02721",
+ "Q9GZK4",
+ "Q15615",
+ "Q9Y5P1",
+ "Q60613",
+ "Q15062",
+ "P29755",
+ "Q9UKP6",
+ "Q28905",
+ "Q9YGZ0",
+ "P47898",
+ "Q60614",
+ "P47899",
+ "Q9GZK7",
+ "Q9YGZ1",
+ "Q9YGZ2",
+ "O97504",
+ "Q15619",
+ "P30987",
+ "Q9YGZ3",
+ "Q9YGZ4",
+ "Q93126",
+ "Q15620",
+ "Q9YGZ5",
+ "P30989",
+ "Q13725",
+ "Q93127",
+ "P16473",
+ "P23749",
+ "Q9YGZ6",
+ "O54814",
+ "O62743",
+ "Q9YGZ7",
+ "P52202",
+ "Q15622",
+ "Q9YGZ8",
+ "P56514",
+ "P30728",
+ "O97772",
+ "Q9YGZ9",
+ "P30991",
+ "P56515",
+ "P30729",
+ "Q9J529",
+ "P56516",
+ "P47774",
+ "O62747",
+ "P30992",
+ "P35403",
+ "P15823",
+ "P47775",
+ "Q9WUK7",
+ "P30993",
+ "O97512",
+ "P35404",
+ "P06002",
+ "O08878",
+ "P30730",
+ "P30994",
+ "O46635",
+ "P35405",
+ "P30731",
+ "P21728",
+ "P35406",
+ "P42288",
+ "P21729",
+ "P35407",
+ "P49217",
+ "P31387",
+ "P35408",
+ "P42289",
+ "O00155",
+ "P31388",
+ "O46639",
+ "P48039",
+ "Q64121",
+ "P35409",
+ "P49219",
+ "P31389",
+ "O18935",
+ "Q9TU05",
+ "P42290",
+ "P21730",
+ "P21731",
+ "P18871",
+ "P31390",
+ "P42291",
+ "P48040",
+ "P31391",
+ "P35410",
+ "P20789",
+ "Q13606",
+ "P48042",
+ "O42490",
+ "P35411",
+ "O88410",
+ "P31392",
+ "P29089",
+ "Q13607",
+ "P48043",
+ "P35412",
+ "P48044",
+ "O89039",
+ "P35413",
+ "P30872",
+ "O01668",
+ "P35414",
+ "P30873",
+ "Q9YH00",
+ "P79211",
+ "P30874",
+ "Q9YH01",
+ "Q28927",
+ "P30875",
+ "Q9YH02",
+ "P49912",
+ "O08890",
+ "P25100",
+ "Q28928",
+ "O95006",
+ "Q9YH03",
+ "P25101",
+ "Q28929",
+ "O95007",
+ "O15218",
+ "O88680",
+ "Q9YH04",
+ "O08892",
+ "Q05394",
+ "P79901",
+ "Q9YH05",
+ "P25102",
+ "P33032",
+ "Q64264",
+ "Q9ERZ3",
+ "P79902",
+ "P25103",
+ "P79217",
+ "Q9UGF5",
+ "Q9ERZ4",
+ "Q9N2A2",
+ "P79903",
+ "P13945",
+ "P25104",
+ "P79218",
+ "P33033",
+ "Q9UGF6",
+ "Q9N2A3",
+ "P25105",
+ "O97661",
+ "O70431",
+ "P79350",
+ "Q9UGF7",
+ "Q9N2A4",
+ "P48974",
+ "P25106",
+ "O97663",
+ "P03999",
+ "P16235",
+ "O95013",
+ "P22269",
+ "O97665",
+ "P26684",
+ "P97468",
+ "P47798",
+ "O97666",
+ "P22270",
+ "O18821",
+ "P47799",
+ "P49922",
+ "Q61038",
+ "P51050",
+ "P25929",
+ "P49238",
+ "Q28807",
+ "P28285",
+ "P79911",
+ "P28286",
+ "P13953",
+ "Q19084",
+ "O61303",
+ "P04000",
+ "P25930",
+ "P04001",
+ "Q9NPB9",
+ "P25931",
+ "Q9R1K6",
+ "P42866",
+ "P56412",
+ "P79914",
+ "Q61041",
+ "Q9GK74",
+ "P25115",
+ "P04950",
+ "P25116",
+ "P19020",
+ "P18762",
+ "O12948",
+ "Q26495",
+ "Q09561",
+ "Q25157",
+ "P70115",
+ "O77830",
+ "Q83207",
+ "P02699",
+ "O12000",
+ "Q01717",
+ "Q25158",
+ "P29403",
+ "P50406",
+ "Q01718",
+ "P29404",
+ "O42384",
+ "P50407",
+ "P79234",
+ "O42385",
+ "O02769",
+ "Q17232",
+ "P79236",
+ "P21761",
+ "P79237",
+ "P04274",
+ "Q28003",
+ "O75388",
+ "P24603",
+ "Q9TUK4",
+ "P53452",
+ "P08588",
+ "Q28005",
+ "P43240",
+ "Q61184",
+ "O08786",
+ "P79240",
+ "P53453",
+ "Q13639",
+ "Q9Y3N9",
+ "Q9UP62",
+ "P18089",
+ "P53454",
+ "P79928",
+ "P79242",
+ "Q01726",
+ "P24053",
+ "P79243",
+ "Q17239",
+ "Q01727",
+ "Q14330",
+ "P18090",
+ "Q9R024",
+ "O62791",
+ "O02777",
+ "P43114",
+ "O62792",
+ "P79113",
+ "O77713",
+ "O08790",
+ "O62793",
+ "P54833",
+ "P43116",
+ "O62794",
+ "Q61614",
+ "O77715",
+ "Q00788",
+ "P43117",
+ "O42266",
+ "O62795",
+ "O88319",
+ "Q03566",
+ "P43118",
+ "O62796",
+ "O02781",
+ "O08530",
+ "P43119",
+ "O42268",
+ "P16395",
+ "O62798",
+ "Q9DDN6",
+ "P05363",
+ "P30518",
+ "O13227",
+ "Q9GZQ6",
+ "P43252",
+ "O18982",
+ "P43253",
+ "P79807",
+ "O18983",
+ "P79808",
+ "O77721",
+ "O35786",
+ "P30098",
+ "P56439",
+ "P79809",
+ "P20309",
+ "O77723",
+ "P56440",
+ "Q28838",
+ "P55919",
+ "Q9UHM6",
+ "Q9TT23",
+ "P56441",
+ "P97926",
+ "Q63652",
+ "P55920",
+ "P56442",
+ "P79812",
+ "P25962",
+ "P56443",
+ "P35462",
+ "P56444",
+ "P35463",
+ "P56445",
+ "O97571",
+ "P79393",
+ "P56446",
+ "O02662",
+ "P49144",
+ "P56447",
+ "P79394",
+ "Q25188",
+ "P49145",
+ "P28190",
+ "P56448",
+ "P24628",
+ "P56449",
+ "O02664",
+ "P49146",
+ "P33765",
+ "Q9EQD2",
+ "Q24563",
+ "P33766",
+ "Q90674",
+ "O02666",
+ "P56450",
+ "P06199",
+ "Q25190",
+ "O02667",
+ "Q99500",
+ "P25021",
+ "P56451",
+ "P08482",
+ "P30796",
+ "Q9H1Y3",
+ "Q28031",
+ "P79266",
+ "O14581",
+ "P08483",
+ "P25023",
+ "P49019",
+ "P25024",
+ "P08485",
+ "P12657",
+ "P12526",
+ "Q9QXZ9",
+ "P08908",
+ "P07700",
+ "P25025",
+ "P32300",
+ "Q9Z1S9",
+ "P35342",
+ "P17200",
+ "O09047",
+ "P08909",
+ "O76100",
+ "Q91175",
+ "P43140",
+ "P49285",
+ "P32302",
+ "P35343",
+ "P43141",
+ "P49286",
+ "P32303",
+ "P35344",
+ "Q91178",
+ "P32304",
+ "Q9Y5X5",
+ "P35345",
+ "P08911",
+ "P43142",
+ "O08556",
+ "P49288",
+ "P35346",
+ "P52702",
+ "P32305",
+ "P08912",
+ "P11483",
+ "P32306",
+ "P52703",
+ "Q9R0M1",
+ "P08913",
+ "P32307",
+ "Q62463",
+ "P35348",
+ "O42294",
+ "P30542",
+ "P32308",
+ "P30411",
+ "P30543",
+ "P32309",
+ "Q9TU77",
+ "Q02152",
+ "Q02284",
+ "Q18904",
+ "P35350",
+ "P30545",
+ "Q28044",
+ "P08100",
+ "O77616",
+ "P35351",
+ "P70031",
+ "P30546",
+ "P79148",
+ "P30547",
+ "P32310",
+ "P16849",
+ "P32311",
+ "Q9JI35",
+ "P30548",
+ "P32312",
+ "P30549",
+ "Q9Y5Y4",
+ "P30680",
+ "P32313",
+ "O08565",
+ "Q28997",
+ "P97266",
+ "P11229",
+ "Q28998",
+ "Q9NYM4",
+ "O93603",
+ "P35356",
+ "P30550",
+ "O15973",
+ "P35357",
+ "P30551",
+ "O77621",
+ "P35358",
+ "P58173",
+ "P34968",
+ "P30552",
+ "P35359",
+ "P34969",
+ "P22888",
+ "P30553",
+ "O19012",
+ "P30554",
+ "P30555",
+ "O19014",
+ "P35360",
+ "Q9MZV8",
+ "P30556",
+ "Q99788",
+ "P35361",
+ "Q04683",
+ "P34970",
+ "P35362",
+ "P70174",
+ "P34971",
+ "Q9WUT7",
+ "P30558",
+ "Q9TUP7",
+ "P79291",
+ "P28088",
+ "P35363",
+ "P34972",
+ "O42179",
+ "P30559",
+ "P79292",
+ "Q99527",
+ "Q01776",
+ "P35364",
+ "P34973",
+ "Q64077",
+ "P41591",
+ "P21554",
+ "P34974",
+ "Q9XT45",
+ "O88495",
+ "P46002",
+ "Q90309",
+ "P41592",
+ "P79848",
+ "P56479",
+ "P21555",
+ "Q9GLX8",
+ "P35365",
+ "P34975",
+ "Q29003",
+ "P30560",
+ "P35366",
+ "P21556",
+ "P47211",
+ "P16177",
+ "P34976",
+ "P10980",
+ "O42604",
+ "P35367",
+ "Q95247",
+ "P34977",
+ "Q29005",
+ "P33533",
+ "P34978",
+ "P28646",
+ "Q17292",
+ "P41595",
+ "P35368",
+ "P33534",
+ "P56481",
+ "P79166",
+ "P41596",
+ "P20905",
+ "P35369",
+ "P28647",
+ "P33535",
+ "P56482",
+ "P41597",
+ "P24530",
+ "P56483",
+ "P47900",
+ "O19024",
+ "P35370",
+ "P56484",
+ "P47901",
+ "O18766",
+ "Q17296",
+ "O19025",
+ "P35371",
+ "P51651",
+ "P34981",
+ "P56485",
+ "Q9H207",
+ "P35372",
+ "P56486",
+ "Q13304",
+ "P35373",
+ "P34982",
+ "Q29010",
+ "Q9H209",
+ "P35374",
+ "P34983",
+ "O76000",
+ "P08255",
+ "P04761",
+ "P22086",
+ "P56488",
+ "P35375",
+ "Q98980",
+ "Q28886",
+ "Q95254",
+ "P14842",
+ "P34984",
+ "O76001",
+ "O76002",
+ "P56489",
+ "P35376",
+ "P34986",
+ "Q9XT57",
+ "Q98982",
+ "Q95125",
+ "Q28756",
+ "Q9H343",
+ "O13018",
+ "P35377",
+ "P34987",
+ "Q9XT58",
+ "P97288",
+ "P56490",
+ "Q9H344",
+ "P35378",
+ "P70612",
+ "P56491",
+ "P79175",
+ "P34989",
+ "P35379",
+ "P16610",
+ "P56492",
+ "O19032",
+ "P79176",
+ "Q9H346",
+ "P49059",
+ "P56493",
+ "P79177",
+ "P56494",
+ "Q9NQN1",
+ "P56495",
+ "P79863",
+ "P97292",
+ "Q91081",
+ "P79178",
+ "P97714",
+ "Q99677",
+ "P35382",
+ "P35383",
+ "O54798",
+ "P56496",
+ "Q99678",
+ "O19037",
+ "Q04573",
+ "P34992",
+ "P34993",
+ "P15409",
+ "O54799",
+ "P56497",
+ "Q99679",
+ "Q94741",
+ "P97717",
+ "P34994",
+ "Q29154",
+ "P97295",
+ "Q90328",
+ "P56498",
+ "P32211",
+ "Q92847",
+ "P34995",
+ "P32212",
+ "P34996",
+ "Q60474",
+ "P34997",
+ "Q63447",
+ "Q60475",
+ "P10608",
+ "Q60476",
+ "Q62928",
+ "Q13585",
+ "O95665",
+ "P79188",
+ "P37288",
+ "Q9DGG4",
+ "Q90334",
+ "P51436",
+ "P26255",
+ "P37289",
+ "Q17053",
+ "O16005",
+ "Q28509",
+ "P21450",
+ "P55167",
+ "Q9Z2D5",
+ "P79190",
+ "P21451",
+ "Q9QZN9",
+ "P79191",
+ "P21452",
+ "P51675",
+ "Q28642",
+ "P21453",
+ "P51676",
+ "Q60483",
+ "P49892",
+ "P14600",
+ "P51677",
+ "Q60484",
+ "Q9ES90",
+ "Q9HC97",
+ "P51678",
+ "P17124",
+ "P79748",
+ "P51679",
+ "O18793",
+ "Q62805",
+ "P41231",
+ "P28678",
+ "P41232",
+ "Q9Y2T5",
+ "P51680",
+ "P18599",
+ "Q9TT96",
+ "Q9WVD0",
+ "P28679",
+ "O19054",
+ "Q18007",
+ "P32229",
+ "Q9XT82",
+ "O35599",
+ "P51681",
+ "P51682",
+ "P47800",
+ "P28680",
+ "Q25414",
+ "P28681",
+ "P51683",
+ "Q90214",
+ "Q28519",
+ "Q90215",
+ "P51684",
+ "P28682",
+ "O60755",
+ "P28683",
+ "P29371",
+ "P51685",
+ "Q9H3N8",
+ "O16017",
+ "P21462",
+ "P25089",
+ "O00574",
+ "P21463",
+ "P28684",
+ "P79756",
+ "O54689",
+ "P51686",
+ "P47936",
+ "O16018",
+ "P51582",
+ "O16019",
+ "P22671",
+ "Q9UM60",
+ "P47937",
+ "O77408",
+ "Q9TTQ9",
+ "Q95154",
+ "P26824",
+ "P25090",
+ "Q95155",
+ "O16020",
+ "P52500",
+ "Q95156",
+ "Q28524",
+ "O35210",
+ "P32236",
+ "Q95157",
+ "P48302",
+ "Q90352",
+ "P32237",
+ "O35476",
+ "P02700",
+ "P48303",
+ "P32238",
+ "O02213",
+ "P25095",
+ "P32239",
+ "O35214",
+ "O35478",
+ "P32240",
+ "P20395",
+ "P79763",
+ "P18901",
+ "Q16581",
+ "P25099",
+ "P79898",
+ "O77680",
+ "P32244",
+ "Q9PUI7",
+ "P28564",
+ "P49650",
+ "P32245",
+ "P28565",
+ "P49651",
+ "P32246",
+ "P28566",
+ "P49652",
+ "Q98894",
+ "P32247",
+ "Q9H255",
+ "Q98895",
+ "P32248",
+ "P32249",
+ "P20272",
+ "P43088",
+ "Q95170",
+ "P50128",
+ "P32250",
+ "P50391",
+ "P70658",
+ "P08172",
+ "P50129",
+ "P08173",
+ "P32251",
+ "P46616",
+ "Q9QYN8",
+ "P50130",
+ "P51470",
+ "P14763",
+ "P51471",
+ "P50132",
+ "Q27987",
+ "P49660",
+ "P51472",
+ "P51473",
+ "O60412",
+ "P51474",
+ "P51475",
+ "Q90373",
+ "Q95179",
+ "P51476",
+ "P58406",
+ "O88853",
+ "P70536",
+ "Q17094",
+ "O88854",
+ "Q11082",
+ "P37067",
+ "Q90245",
+ "P79785",
+ "P37068",
+ "O13076",
+ "Q92633",
+ "P46626",
+ "Q91559",
+ "P37069",
+ "P46627",
+ "P21917",
+ "P23944",
+ "O97967",
+ "P46628",
+ "P56971",
+ "P43657",
+ "O62809",
+ "Q28553",
+ "P21918",
+ "P23945",
+ "P20288",
+ "O19091",
+ "O15529",
+ "P37070",
+ "Q28422",
+ "P29274",
+ "P37071",
+ "P29275",
+ "Q9Z0Z6",
+ "P29276",
+ "Q25321",
+ "Q18179",
+ "P30372",
+ "Q90252",
+ "O14843",
+ "Q9Z2I3",
+ "Q25322",
+ "Q08520",
+ "Q28558",
+ "P51488",
+ "P41143",
+ "P23265",
+ "Q28691",
+ "P51489",
+ "P09241",
+ "O18312",
+ "P41144",
+ "Q61212",
+ "P23266",
+ "Q9WV08",
+ "P41145",
+ "P46636",
+ "P23267",
+ "P56718",
+ "P41146",
+ "P21109",
+ "P51490",
+ "P79400",
+ "Q9UPC5",
+ "Q62035",
+ "P56719",
+ "P23269",
+ "O14718",
+ "P79798",
+ "P51491",
+ "O18315",
+ "P41149",
+ "P23270",
+ "O60431",
+ "P49681",
+ "P23271",
+ "P19327",
+ "P30935",
+ "P11613",
+ "P49682",
+ "P23272",
+ "P41968",
+ "O43603",
+ "P19328",
+ "Q63931",
+ "P30936",
+ "P49683",
+ "P11614",
+ "P23273",
+ "P46089",
+ "P28334",
+ "P49684",
+ "P30937",
+ "P11615",
+ "P23274",
+ "P28335",
+ "O13092",
+ "O43869",
+ "P97520",
+ "Q01337",
+ "P30938",
+ "P49685",
+ "P11616",
+ "P23275",
+ "Q01338"]
+      assert_equal(data.sort, @obj.list_truepositive.sort)
+    end
+
+    def test_list_falsenegative
+      data = ["P18259",
+ "Q13813",
+ "Q55593",
+ "Q00274",
+ "P54466",
+ "Q9HJA4",
+ "P55687",
+ "Q9W0K0",
+ "Q42608",
+ "P45873",
+ "P45198",
+ "P15828",
+ "P18609",
+ "Q51758",
+ "P24151",
+ "P23892",
+ "P41510",
+ "P22817",
+ "P46457",
+ "O15910",
+ "P23515",
+ "O59098",
+ "P26560",
+ "P26561",
+ "P47551",
+ "P22023",
+ "P21503",
+ "Q9VNB3",
+ "P25147",
+ "Q42675",
+ "P21524",
+ "P06882",
+ "Q61647",
+ "P42790",
+ "Q10775",
+ "O84877",
+ "P51656",
+ "P75548",
+ "Q92839",
+ "P51657",
+ "P37274",
+ "P34724",
+ "P07751",
+ "P00498",
+ "P07886",
+ "P26258",
+ "O67284",
+ "Q25410",
+ "P46724",
+ "P76097",
+ "P16086",
+ "P08032",
+ "P14198",
+ "P77916",
+ "O60779",
+ "P13688",
+ "Q03834",
+ "Q63912",
+ "O68824",
+ "P77932",
+ "Q53547",
+ "P77933",
+ "P34529",
+ "Q00126"]
+      assert_equal(data.sort, @obj.list_falsenegative.sort)
+    end
+    
+    def test_list_falsepositive
+      data =["P41985",
+ "P41986",
+ "P17645",
+ "Q60612",
+ "Q60879",
+ "P52592",
+ "Q60882",
+ "Q60883",
+ "Q60884",
+ "Q60885",
+ "Q60886",
+ "Q60887",
+ "Q60888",
+ "Q60889",
+ "Q60890",
+ "P49218",
+ "Q60891",
+ "Q60892",
+ "P49220",
+ "Q60893",
+ "Q60894",
+ "Q60895",
+ "O70430",
+ "O70432",
+ "P51046",
+ "P51047",
+ "P51048",
+ "P51049",
+ "P51051",
+ "P51052",
+ "Q98913",
+ "Q98914",
+ "Q61616",
+ "Q61618",
+ "P79250",
+ "P14803",
+ "P49287",
+ "Q28602",
+ "P97267",
+ "Q90305",
+ "Q29006",
+ "Q95252",
+ "P34985",
+ "Q90456",
+ "Q95136",
+ "Q95137",
+ "Q62953",
+ "Q95195"]
+      assert_equal(data.sort, @obj.list_falsepositive.sort)
+    end
+
+    def test_list_potentialhit
+      data = ["P41985",
+ "P41986",
+ "P17645",
+ "Q60612",
+ "Q60879",
+ "P52592",
+ "Q60882",
+ "Q60883",
+ "Q60884",
+ "Q60885",
+ "Q60886",
+ "Q60887",
+ "Q60888",
+ "Q60889",
+ "Q60890",
+ "P49218",
+ "Q60891",
+ "Q60892",
+ "P49220",
+ "Q60893",
+ "Q60894",
+ "Q60895",
+ "O70430",
+ "O70432",
+ "P51046",
+ "P51047",
+ "P51048",
+ "P51049",
+ "P51051",
+ "P51052",
+ "Q98913",
+ "Q98914",
+ "Q61616",
+ "Q61618",
+ "P79250",
+ "P14803",
+ "P49287",
+ "Q28602",
+ "P97267",
+ "Q90305",
+ "Q29006",
+ "Q95252",
+ "P34985",
+ "Q90456",
+ "Q95136",
+ "Q95137",
+ "Q62953",
+ "Q95195"]
+      assert_equal(data.sort, @obj.list_potentialhit.sort)
+    end
+
+    def test_list_unknown
+      data = []
+      assert_equal(data, @obj.list_unknown)
+    end
+
+    def test_pdb_xref
+      data = ["1BOJ", "1BOK", "1F88"]
+      assert_equal(data, @obj.pdb_xref)
+    end
+
+    def test_pdoc_xref
+      data = "PDOC00210"
+      assert_equal(data, @obj.pdoc_xref)
+    end
+
+    def test_pa2re
+      pa = '[AC]-x-V-x(4)-{ED}.'
+      assert_equal(/[AC].V.{4}[^ED]/i, @obj.pa2re(pa))
+    end
+
+    def test_self_pa2re
+      pa = '[AC]-x-V-x(4)-{ED}.'
+      assert_equal(/[AC].V.{4}[^ED]/i, Bio::PROSITE.pa2re(pa))
+    end
+
+  end # class TestPROSITE
+end