agentic-flow 1.9.0 → 1.9.2

package/agentic-flow/examples/crispr-cas13-pipeline/docs/data-models.yaml

@@ -1,1639 +0,0 @@
-# CRISPR-Cas13 Pipeline - Data Models
-# Version: 1.0.0
-# Date: 2025-10-12
-# Compliance: GA4GH, NCBI, ISO 8601
-
----
-# Core Data Models
-
-Experiment:
-  description: "Top-level experimental metadata container"
-  type: object
-  required:
-    - experiment_id
-    - title
-    - species
-    - cas13_variant
-    - guide_rna
-    - date_performed
-  properties:
-    experiment_id:
-      type: string
-      format: uuid
-      description: "Unique experiment identifier (UUID v4)"
-      example: "550e8400-e29b-41d4-a716-446655440000"
-
-    title:
-      type: string
-      minLength: 10
-      maxLength: 200
-      description: "Human-readable experiment title"
-      example: "Cas13d-mediated STAT1 knockdown in rhesus macaque liver"
-
-    description:
-      type: string
-      maxLength: 2000
-      description: "Detailed experimental description"
-      example: "Evaluation of Cas13d off-target effects and interferon response..."
-
-    species:
-      type: string
-      enum:
-        - rhesus_macaque
-        - cynomolgus_macaque
-        - human_cell_line
-        - mouse
-        - custom
-      description: "Species (NCBI Taxonomy-aligned)"
-      taxonomy_id:
-        rhesus_macaque: 9544
-        cynomolgus_macaque: 9541
-        human_cell_line: 9606
-        mouse: 10090
-
-    tissue_type:
-      type: string
-      enum:
-        - liver
-        - kidney
-        - brain
-        - blood
-        - spleen
-        - lung
-        - heart
-        - cultured_cells
-        - organoid
-        - other
-      description: "Tissue or cell type (BRENDA Tissue Ontology)"
-
-    cas13_variant:
-      type: string
-      enum:
-        - Cas13a  # LwaCas13a (Leptotrichia wadei)
-        - Cas13b  # PspCas13b (Prevotella sp.)
-        - Cas13c  # BzCas13c (Bacteroides zoohelcus)
-        - Cas13d  # EsCas13d (Eubacterium siraeum)
-      description: "Cas13 ortholog used in experiment"
-
-    guide_rna:
-      $ref: '#/GuideRNA'
-
-    delivery_method:
-      type: string
-      enum:
-        - AAV  # Adeno-Associated Virus
-        - LNP  # Lipid Nanoparticle
-        - electroporation
-        - transfection
-        - microinjection
-        - other
-      description: "Delivery vehicle for Cas13 + gRNA"
-
-    timepoint_hours:
-      type: integer
-      minimum: 0
-      maximum: 8760  # 1 year
-      description: "Time post-treatment (hours)"
-      example: 72
-
-    replicate_number:
-      type: integer
-      minimum: 1
-      maximum: 100
-      description: "Biological replicate number"
-
-    control_type:
-      type: string
-      enum:
-        - mock_treated
-        - non_targeting_grna
-        - untreated
-        - positive_control
-      nullable: true
-      description: "Control experiment type (null if experimental condition)"
-
-    experimenter:
-      type: string
-      maxLength: 100
-      description: "Person who performed experiment"
-      example: "Dr. Jane Smith"
-
-    institution:
-      type: string
-      maxLength: 200
-      description: "Research institution"
-      example: "University of California, San Francisco"
-
-    iacuc_protocol:
-      type: string
-      pattern: "^[A-Z0-9-]+$"
-      description: "IACUC protocol number (if animal study)"
-      example: "IACUC-2024-12345"
-
-    date_performed:
-      type: string
-      format: date-time
-      description: "Experiment execution date (ISO 8601)"
-      example: "2025-10-12T14:30:00Z"
-
-    created_at:
-      type: string
-      format: date-time
-      readOnly: true
-
-    updated_at:
-      type: string
-      format: date-time
-      readOnly: true
-
-    metadata:
-      type: object
-      additionalProperties: true
-      description: "Flexible metadata field for custom annotations"
-
----
-
-GuideRNA:
-  description: "Guide RNA sequence and target information"
-  type: object
-  required:
-    - sequence
-    - target_gene
-  properties:
-    sequence:
-      type: string
-      pattern: "^[ACGTU]{22,30}$"
-      description: "Guide RNA sequence (22-30nt, RNA format with U)"
-      example: "GUCAUGCACUGUACUGACUACU"
-
-    sequence_dna:
-      type: string
-      pattern: "^[ACGT]{22,30}$"
-      description: "DNA equivalent of gRNA (auto-generated)"
-      example: "GTCATGCACTGTACTGACTACT"
-
-    length:
-      type: integer
-      minimum: 22
-      maximum: 30
-      description: "Guide RNA length (nt)"
-
-    target_gene:
-      type: string
-      pattern: "^[A-Z0-9-]+$"
-      description: "Target gene symbol (HGNC/MGI nomenclature)"
-      example: "STAT1"
-
-    target_transcript_id:
-      type: string
-      description: "Ensembl or RefSeq transcript ID"
-      examples:
-        - "ENST00000361099"
-        - "NM_007315.4"
-
-    target_transcript_biotype:
-      type: string
-      enum:
-        - protein_coding
-        - lncRNA
-        - miRNA
-        - snoRNA
-        - snRNA
-        - misc_RNA
-      description: "Transcript biotype (Ensembl classification)"
-
-    protospacer_coordinates:
-      type: object
-      description: "Genomic coordinates of target site"
-      properties:
-        chromosome:
-          type: string
-          pattern: "^(chr)?([1-9]|1[0-9]|2[0-2]|X|Y|MT?)$"
-          example: "chr2"
-        start:
-          type: integer
-          minimum: 1
-          example: 191854689
-        end:
-          type: integer
-          minimum: 1
-          example: 191854711
-        strand:
-          type: string
-          enum: ["+", "-"]
-
-    pfs_sequence:
-      type: string
-      pattern: "^[ACGTU]{1,6}$"
-      description: "Protospacer Flanking Site (Cas13 PAM equivalent)"
-      example: "A"  # Cas13d prefers 3' A
-
-    gc_content:
-      type: number
-      minimum: 0.0
-      maximum: 1.0
-      description: "GC content fraction"
-
-    predicted_structure:
-      type: object
-      description: "Secondary structure prediction (Vienna format)"
-      properties:
-        dot_bracket:
-          type: string
-          example: "((((....))))"
-        mfe:
-          type: number
-          description: "Minimum free energy (kcal/mol)"
-          example: -3.4
-
-    off_target_potential:
-      type: string
-      enum: [low, medium, high]
-      description: "Predicted off-target risk (preliminary)"
-
-    design_tool:
-      type: string
-      description: "Tool used for gRNA design"
-      examples:
-        - "CHOPCHOP"
-        - "Cas13design"
-        - "custom"
-
----
-
-SequencingRun:
-  description: "Raw sequencing data (FASTQ) metadata"
-  type: object
-  required:
-    - run_id
-    - experiment_id
-    - sample_id
-    - sequencing_platform
-    - read_files
-  properties:
-    run_id:
-      type: string
-      format: uuid
-      description: "Unique sequencing run identifier"
-
-    experiment_id:
-      type: string
-      format: uuid
-      description: "Parent experiment ID (foreign key)"
-
-    sample_id:
-      type: string
-      description: "Sample identifier"
-      example: "Sample_001_liver_72h_rep1"
-
-    sequencing_platform:
-      type: string
-      enum:
-        - Illumina_NovaSeq_6000
-        - Illumina_NextSeq_2000
-        - Illumina_MiSeq
-        - Oxford_Nanopore_MinION
-        - Oxford_Nanopore_PromethION
-        - PacBio_Sequel_II
-        - BGI_DNBSEQ
-      description: "Sequencing platform"
-
-    library_prep:
-      type: string
-      enum:
-        - TruSeq_Stranded_mRNA
-        - NEBNext_Ultra_II
-        - SMARTer_Stranded_Total_RNA
-        - QuantSeq_3prime
-        - custom
-      description: "Library preparation kit"
-
-    read_type:
-      type: string
-      enum:
-        - single_end
-        - paired_end
-      description: "Read type"
-
-    read_length:
-      type: integer
-      minimum: 50
-      maximum: 300
-      description: "Read length (nt)"
-      example: 150
-
-    read_files:
-      type: array
-      minItems: 1
-      maxItems: 2
-      items:
-        $ref: '#/FastqFile'
-
-    total_reads:
-      type: integer
-      minimum: 0
-      description: "Total read count"
-      example: 45000000
-
-    flowcell_id:
-      type: string
-      description: "Sequencing flowcell ID"
-      example: "H3TVJDRXY"
-
-    lane:
-      type: integer
-      minimum: 1
-      maximum: 8
-      description: "Flowcell lane number"
-
-    barcode_index:
-      type: string
-      pattern: "^[ACGT]{6,12}$"
-      description: "Sample barcode/index sequence"
-      example: "ATCACG"
-
-    sequencing_date:
-      type: string
-      format: date-time
-      description: "Sequencing run date"
-
-    sequencing_facility:
-      type: string
-      maxLength: 200
-      description: "Sequencing facility name"
-
-    created_at:
-      type: string
-      format: date-time
-      readOnly: true
-
----
-
-FastqFile:
-  description: "Individual FASTQ file record"
-  type: object
-  required:
-    - file_id
-    - file_path
-    - file_size
-    - md5_checksum
-  properties:
-    file_id:
-      type: string
-      format: uuid
-
-    file_path:
-      type: string
-      format: uri
-      description: "S3 URI or file path"
-      example: "s3://sequencing-data/exp123/sample001_R1.fastq.gz"
-
-    file_name:
-      type: string
-      description: "Original filename"
-      example: "Sample_001_S1_L001_R1_001.fastq.gz"
-
-    read_pair:
-      type: string
-      enum: ["R1", "R2", "single"]
-      description: "Read pair designation"
-
-    file_size:
-      type: integer
-      minimum: 0
-      description: "File size in bytes"
-      example: 3458765432
-
-    file_size_human:
-      type: string
-      description: "Human-readable file size"
-      example: "3.2 GB"
-
-    compression:
-      type: string
-      enum: ["gzip", "bzip2", "uncompressed"]
-      description: "Compression format"
-
-    md5_checksum:
-      type: string
-      pattern: "^[a-f0-9]{32}$"
-      description: "MD5 hash for integrity verification"
-      example: "5d41402abc4b2a76b9719d911017c592"
-
-    sha256_checksum:
-      type: string
-      pattern: "^[a-f0-9]{64}$"
-      description: "SHA-256 hash (optional, more secure)"
-
-    quality_encoding:
-      type: string
-      enum: ["Phred33", "Phred64"]
-      default: "Phred33"
-      description: "Quality score encoding"
-
-    upload_date:
-      type: string
-      format: date-time
-
-    uploaded_by:
-      type: string
-      description: "User who uploaded file"
-
----
-
-QualityControl:
-  description: "FastQC quality control metrics"
-  type: object
-  required:
-    - qc_id
-    - sequencing_run_id
-    - status
-  properties:
-    qc_id:
-      type: string
-      format: uuid
-
-    sequencing_run_id:
-      type: string
-      format: uuid
-      description: "Parent sequencing run (foreign key)"
-
-    status:
-      type: string
-      enum: [pass, warn, fail]
-      description: "Overall QC status"
-
-    total_sequences:
-      type: integer
-      minimum: 0
-
-    poor_quality_sequences:
-      type: integer
-      minimum: 0
-
-    sequence_length:
-      type: object
-      properties:
-        min: integer
-        max: integer
-        mean: number
-
-    mean_quality_score:
-      type: number
-      minimum: 0
-      maximum: 42
-      description: "Mean Phred quality score across all bases"
-
-    per_base_quality:
-      type: array
-      items:
-        type: object
-        properties:
-          position:
-            type: integer
-          mean_quality:
-            type: number
-          q25:
-            type: number
-          q75:
-            type: number
-
-    per_sequence_quality:
-      type: object
-      properties:
-        mean_quality_distribution:
-          type: array
-          items:
-            quality_bin: integer
-            count: integer
-
-    gc_content:
-      type: number
-      minimum: 0
-      maximum: 100
-      description: "GC content percentage"
-
-    adapter_content:
-      type: object
-      properties:
-        illumina_universal_adapter:
-          type: number
-          minimum: 0
-          maximum: 100
-          description: "% sequences with adapter"
-        illumina_small_rna_adapter:
-          type: number
-        nextera_transposase:
-          type: number
-
-    duplication_rate:
-      type: number
-      minimum: 0
-      maximum: 100
-      description: "% duplicate reads"
-
-    overrepresented_sequences:
-      type: array
-      maxItems: 20
-      items:
-        type: object
-        properties:
-          sequence:
-            type: string
-          count:
-            type: integer
-          percentage:
-            type: number
-          source:
-            type: string
-            description: "Predicted source (e.g., 'Illumina Adapter')"
-
-    report_html:
-      type: string
-      format: uri
-      description: "URL to HTML QC report"
-
-    report_json:
-      type: string
-      format: uri
-      description: "URL to JSON QC data"
-
-    fastqc_version:
-      type: string
-      example: "v0.12.1"
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-Alignment:
-  description: "Read alignment results (BAM/SAM)"
-  type: object
-  required:
-    - alignment_id
-    - sequencing_run_id
-    - reference_genome
-    - aligner
-  properties:
-    alignment_id:
-      type: string
-      format: uuid
-
-    sequencing_run_id:
-      type: string
-      format: uuid
-      description: "Parent sequencing run"
-
-    reference_genome:
-      $ref: '#/ReferenceGenome'
-
-    aligner:
-      type: string
-      enum:
-        - STAR
-        - HISAT2
-        - Bowtie2
-        - BWA-MEM
-        - minimap2
-      description: "Alignment tool used"
-
-    aligner_version:
-      type: string
-      example: "2.7.10b"
-
-    alignment_parameters:
-      type: object
-      additionalProperties: true
-      description: "Aligner-specific parameters"
-      example:
-        outSAMtype: "BAM SortedByCoordinate"
-        alignIntronMax: 1000000
-        outFilterMismatchNmax: 2
-
-    bam_file:
-      type: string
-      format: uri
-      description: "S3 URI to BAM file"
-      example: "s3://alignments/exp123/sample001.bam"
-
-    bai_file:
-      type: string
-      format: uri
-      description: "BAM index file (.bai)"
-
-    total_reads:
-      type: integer
-      description: "Total input reads"
-
-    mapped_reads:
-      type: integer
-      description: "Successfully mapped reads"
-
-    uniquely_mapped_reads:
-      type: integer
-      description: "Uniquely mapped reads (MAPQ >= 10)"
-
-    multi_mapped_reads:
-      type: integer
-      description: "Multi-mapping reads"
-
-    unmapped_reads:
-      type: integer
-      description: "Unmapped reads"
-
-    alignment_rate:
-      type: number
-      minimum: 0
-      maximum: 1
-      description: "Fraction of mapped reads"
-      example: 0.94
-
-    mean_mapping_quality:
-      type: number
-      minimum: 0
-      maximum: 60
-      description: "Mean MAPQ score"
-
-    insert_size_metrics:
-      type: object
-      description: "Paired-end insert size statistics"
-      properties:
-        mean:
-          type: number
-        median:
-          type: number
-        standard_deviation:
-          type: number
-
-    coverage_metrics:
-      type: object
-      properties:
-        mean_coverage:
-          type: number
-        median_coverage:
-          type: number
-        covered_bases:
-          type: integer
-          description: "Number of bases with >=1 read"
-
-    execution_time_seconds:
-      type: integer
-      description: "Alignment runtime"
-
-    peak_memory_gb:
-      type: number
-      description: "Peak memory usage (GB)"
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-ReferenceGenome:
-  description: "Reference genome/transcriptome metadata"
-  type: object
-  required:
-    - genome_id
-    - species
-    - assembly_name
-    - source
-  properties:
-    genome_id:
-      type: string
-      format: uuid
-
-    species:
-      type: string
-      example: "Macaca mulatta"
-
-    assembly_name:
-      type: string
-      description: "Genome assembly name"
-      examples:
-        - "rheMac10"
-        - "GRCh38"
-        - "macFas5"
-
-    assembly_accession:
-      type: string
-      description: "GenBank/RefSeq assembly accession"
-      example: "GCF_003339765.1"
-
-    source:
-      type: string
-      enum:
-        - NCBI
-        - Ensembl
-        - UCSC
-        - custom
-
-    ensembl_version:
-      type: integer
-      description: "Ensembl release version"
-      example: 110
-
-    genome_fasta:
-      type: string
-      format: uri
-      description: "FASTA file location"
-
-    annotation_gtf:
-      type: string
-      format: uri
-      description: "Gene annotation GTF/GFF3 file"
-
-    transcriptome_fasta:
-      type: string
-      format: uri
-      description: "Transcriptome FASTA (for RNA-seq)"
-
-    aligner_index:
-      type: object
-      properties:
-        star_index:
-          type: string
-          format: uri
-        hisat2_index:
-          type: string
-          format: uri
-        bowtie2_index:
-          type: string
-          format: uri
-
-    chromosome_sizes:
-      type: array
-      items:
-        type: object
-        properties:
-          name:
-            type: string
-            example: "chr1"
-          length:
-            type: integer
-            example: 228864388
-
-    total_genome_size:
-      type: integer
-      description: "Total genome size in bp"
-
-    gene_count:
-      type: integer
-      description: "Number of annotated genes"
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-TargetAnalysis:
-  description: "On-target CRISPR activity analysis"
-  type: object
-  required:
-    - analysis_id
-    - experiment_id
-    - target_gene
-  properties:
-    analysis_id:
-      type: string
-      format: uuid
-
-    experiment_id:
-      type: string
-      format: uuid
-
-    target_gene:
-      type: string
-      description: "Target gene symbol"
-
-    target_transcript_id:
-      type: string
-      description: "Specific transcript targeted"
-
-    control_expression_tpm:
-      type: number
-      minimum: 0
-      description: "Control sample TPM (Transcripts Per Million)"
-      example: 125.3
-
-    treated_expression_tpm:
-      type: number
-      minimum: 0
-      description: "Treated sample TPM"
-      example: 16.2
-
-    fold_change:
-      type: number
-      description: "Log2 fold change (treated vs control)"
-      example: -2.95
-
-    knockdown_efficiency:
-      type: number
-      minimum: 0
-      maximum: 1
-      description: "Knockdown efficiency (1 - treated/control)"
-      example: 0.871
-
-    p_value:
-      type: number
-      minimum: 0
-      maximum: 1
-      description: "Statistical significance (DESeq2/edgeR)"
-      example: 1.2e-15
-
-    adjusted_p_value:
-      type: number
-      minimum: 0
-      maximum: 1
-      description: "FDR-adjusted p-value (Benjamini-Hochberg)"
-
-    read_counts:
-      type: object
-      properties:
-        control_reads:
-          type: integer
-        treated_reads:
-          type: integer
-        total_library_size_control:
-          type: integer
-        total_library_size_treated:
-          type: integer
-
-    transcript_abundance:
-      type: array
-      description: "Isoform-level expression"
-      items:
-        type: object
-        properties:
-          transcript_id:
-            type: string
-          tpm:
-            type: number
-          fold_change:
-            type: number
-
-    confidence_level:
-      type: string
-      enum: [high, medium, low]
-      description: "Confidence in knockdown measurement"
-
-    statistical_method:
-      type: string
-      enum: [DESeq2, edgeR, limma-voom, NOISeq]
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-OffTargetSite:
-  description: "Predicted off-target RNA cleavage site"
-  type: object
-  required:
-    - offtarget_id
-    - experiment_id
-    - rank
-    - confidence_score
-  properties:
-    offtarget_id:
-      type: string
-      format: uuid
-
-    experiment_id:
-      type: string
-      format: uuid
-
-    rank:
-      type: integer
-      minimum: 1
-      description: "Rank by confidence score (1 = highest risk)"
-
-    confidence_score:
-      type: number
-      minimum: 0.0
-      maximum: 1.0
-      description: "Off-target likelihood score"
-      example: 0.82
-
-    gene_symbol:
-      type: string
-      description: "Off-target gene symbol"
-      example: "GAPDH"
-
-    gene_id:
-      type: string
-      description: "Ensembl/RefSeq gene ID"
-      example: "ENSG00000111640"
-
-    transcript_id:
-      type: string
-      description: "Specific transcript"
-      example: "ENST00000229239"
-
-    genomic_coordinates:
-      type: object
-      required: [chromosome, start, end, strand]
-      properties:
-        chromosome:
-          type: string
-          example: "chr12"
-        start:
-          type: integer
-          example: 6646711
-        end:
-          type: integer
-          example: 6646733
-        strand:
-          type: string
-          enum: ["+", "-"]
-
-    aligned_sequence:
-      type: string
-      pattern: "^[ACGTU]{22,30}$"
-      description: "Aligned off-target sequence"
-
-    alignment:
-      type: object
-      properties:
-        guide_rna:
-          type: string
-          example: "GUCAUGCACUGUACUGACUACU"
-        off_target:
-          type: string
-          example: "GUCAUGCACUGUA-UGACUACU"
-        alignment_visual:
-          type: string
-          example: "|||||||||||| |||||||||"
-
-    mismatch_count:
-      type: integer
-      minimum: 0
-      maximum: 10
-      description: "Total mismatches + gaps"
-
-    mismatch_positions:
-      type: array
-      items:
-        type: integer
-      description: "0-indexed mismatch positions"
-      example: [13]
-
-    seed_mismatches:
-      type: integer
-      minimum: 0
-      description: "Mismatches in seed region (positions 1-12)"
-
-    pam_flanking_sequence:
-      type: string
-      pattern: "^[ACGTU]{1,6}$"
-      description: "PFS/PAM sequence"
-
-    sequence_context:
-      type: string
-      description: "±50nt context around off-target site"
-
-    accessibility_score:
-      type: number
-      minimum: 0
-      maximum: 1
-      description: "RNA accessibility prediction (0=inaccessible, 1=accessible)"
-
-    secondary_structure:
-      type: object
-      properties:
-        dot_bracket:
-          type: string
-        mfe:
-          type: number
-          description: "Minimum free energy"
-
-    expression_level:
-      type: number
-      minimum: 0
-      description: "Off-target transcript expression (TPM)"
-
-    observed_cleavage:
-      type: boolean
-      description: "Whether cleavage was observed in RNA-seq data"
-
-    fold_change:
-      type: number
-      nullable: true
-      description: "Expression change (if observed)"
-
-    prediction_method:
-      type: string
-      description: "Algorithm used for prediction"
-      examples:
-        - "BLAST"
-        - "Bowtie"
-        - "Cas-OFFinder"
-        - "custom_scoring"
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-ImmuneResponse:
-  description: "Innate immune pathway activation analysis"
-  type: object
-  required:
-    - immune_id
-    - experiment_id
-  properties:
-    immune_id:
-      type: string
-      format: uuid
-
-    experiment_id:
-      type: string
-      format: uuid
-
-    overall_immune_score:
-      type: number
-      description: "Composite immune activation score (normalized)"
-      example: 2.35
-
-    interferon_score:
-      type: number
-      description: "Interferon pathway activation score"
-
-    activated_pathways:
-      type: array
-      items:
-        type: string
-        enum:
-          - Type_I_IFN
-          - Type_III_IFN
-          - RIG-I_pathway
-          - MDA5_pathway
-          - OAS_RNase_L
-          - PKR_pathway
-          - inflammasome
-          - NF-kB
-      example: ["Type_I_IFN", "RIG-I_pathway"]
-
-    differential_genes:
-      type: array
-      description: "Differentially expressed immune genes"
-      items:
-        type: object
-        properties:
-          gene_symbol:
-            type: string
-            example: "IFNB1"
-          gene_name:
-            type: string
-            example: "Interferon Beta 1"
-          fold_change:
-            type: number
-            example: 12.5
-          p_value:
-            type: number
-            example: 3.2e-10
-          adjusted_p_value:
-            type: number
-          pathway:
-            type: string
-            example: "Type_I_IFN"
-          role:
-            type: string
-            description: "Gene function"
-            example: "Cytokine signaling"
-
-    gene_set_enrichment:
-      type: array
-      description: "GSEA results for immune pathways"
-      items:
-        type: object
-        properties:
-          pathway_name:
-            type: string
-            example: "HALLMARK_INTERFERON_ALPHA_RESPONSE"
-          enrichment_score:
-            type: number
-          normalized_enrichment_score:
-            type: number
-          p_value:
-            type: number
-          fdr_q_value:
-            type: number
-          leading_edge_genes:
-            type: array
-            items:
-              type: string
-
-    key_cytokines:
-      type: object
-      description: "Expression of key cytokines"
-      properties:
-        IFNB1:
-          type: number
-          description: "Type I IFN-beta"
-        IFNL1:
-          type: number
-          description: "Type III IFN-lambda 1"
-        IL6:
-          type: number
-        TNF:
-          type: number
-        CXCL10:
-          type: number
-          description: "IP-10"
-
-    pattern_recognition_receptors:
-      type: object
-      properties:
-        DDX58:
-          type: number
-          description: "RIG-I"
-        IFIH1:
-          type: number
-          description: "MDA5"
-        TLR3:
-          type: number
-        TLR7:
-          type: number
-        ZBP1:
-          type: number
-          description: "Z-DNA binding protein 1"
-
-    interferon_stimulated_genes:
-      type: object
-      properties:
-        ISG15:
-          type: number
-        MX1:
-          type: number
-        OAS1:
-          type: number
-        OAS2:
-          type: number
-        RSAD2:
-          type: number
-          description: "Viperin"
-        IFIT1:
-          type: number
-
-    heatmap_url:
-      type: string
-      format: uri
-      description: "URL to immune gene expression heatmap"
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-ProcessingJob:
-  description: "Asynchronous processing job"
-  type: object
-  required:
-    - job_id
-    - job_type
-    - status
-  properties:
-    job_id:
-      type: string
-      format: uuid
-
-    job_type:
-      type: string
-      enum:
-        - qc_only
-        - alignment
-        - full_pipeline
-        - off_target_prediction
-        - immune_analysis
-        - custom
-
-    status:
-      type: string
-      enum:
-        - queued
-        - running
-        - completed
-        - failed
-        - cancelled
-
-    priority:
-      type: string
-      enum: [low, normal, high, urgent]
-      default: normal
-
-    experiment_id:
-      type: string
-      format: uuid
-      nullable: true
-
-    sequencing_run_id:
-      type: string
-      format: uuid
-      nullable: true
-
-    input_files:
-      type: array
-      items:
-        type: string
-        format: uri
-
-    output_files:
-      type: array
-      items:
-        type: string
-        format: uri
-
-    parameters:
-      type: object
-      additionalProperties: true
-      description: "Job-specific parameters"
-
-    reference_genome:
-      type: string
-      description: "Reference genome ID"
-
-    progress:
-      type: number
-      minimum: 0
-      maximum: 1
-      description: "Job progress (0.0-1.0)"
-      example: 0.65
-
-    current_stage:
-      type: string
-      description: "Current processing stage"
-      examples:
-        - "quality_control"
-        - "alignment"
-        - "quantification"
-        - "off_target_prediction"
-
-    eta_seconds:
-      type: integer
-      nullable: true
-      description: "Estimated time to completion (seconds)"
-
-    started_at:
-      type: string
-      format: date-time
-      nullable: true
-
-    completed_at:
-      type: string
-      format: date-time
-      nullable: true
-
-    execution_time_seconds:
-      type: integer
-      nullable: true
-      description: "Total execution time"
-
-    error_message:
-      type: string
-      nullable: true
-      description: "Error details if status=failed"
-
-    error_code:
-      type: string
-      nullable: true
-      examples:
-        - "ALIGNMENT_FAILED"
-        - "INSUFFICIENT_MEMORY"
-        - "FILE_NOT_FOUND"
-
-    retry_count:
-      type: integer
-      default: 0
-      description: "Number of retry attempts"
-
-    max_retries:
-      type: integer
-      default: 3
-
-    resource_usage:
-      type: object
-      properties:
-        cpu_hours:
-          type: number
-        peak_memory_gb:
-          type: number
-        disk_io_gb:
-          type: number
-        gpu_hours:
-          type: number
-          nullable: true
-
-    worker_node:
-      type: string
-      description: "Compute node that executed job"
-
-    container_image:
-      type: string
-      description: "Docker image used"
-      example: "quay.io/biocontainers/star:2.7.10b"
-
-    notification_email:
-      type: string
-      format: email
-      nullable: true
-
-    created_by:
-      type: string
-      description: "User who submitted job"
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-Provenance:
-  description: "W3C PROV-O compatible provenance record"
-  type: object
-  required:
-    - provenance_id
-    - entity_id
-    - activity_id
-  properties:
-    provenance_id:
-      type: string
-      format: uuid
-
-    entity_id:
-      type: string
-      description: "ID of the data entity (file, dataset)"
-
-    entity_type:
-      type: string
-      enum:
-        - fastq_file
-        - bam_file
-        - vcf_file
-        - expression_matrix
-        - qc_report
-        - analysis_result
-
-    activity_id:
-      type: string
-      description: "Processing activity ID"
-
-    activity_type:
-      type: string
-      enum:
-        - quality_control
-        - trimming
-        - alignment
-        - quantification
-        - differential_expression
-        - off_target_prediction
-
-    agent_id:
-      type: string
-      description: "Agent (tool/user) that performed activity"
-
-    agent_type:
-      type: string
-      enum:
-        - software_tool
-        - user
-        - automated_pipeline
-
-    tool_name:
-      type: string
-      example: "STAR"
-
-    tool_version:
-      type: string
-      example: "2.7.10b"
-
-    tool_parameters:
-      type: object
-      additionalProperties: true
-
-    input_entities:
-      type: array
-      items:
-        type: string
-      description: "IDs of input entities (wasDerivedFrom)"
-
-    output_entities:
-      type: array
-      items:
-        type: string
-      description: "IDs of generated entities (wasGeneratedBy)"
-
-    started_at:
-      type: string
-      format: date-time
-
-    ended_at:
-      type: string
-      format: date-time
-
-    execution_environment:
-      type: object
-      properties:
-        os:
-          type: string
-          example: "Ubuntu 22.04"
-        container_image:
-          type: string
-        resource_allocation:
-          type: object
-          properties:
-            cpus:
-              type: integer
-            memory_gb:
-              type: number
-
-    provenance_graph:
-      type: string
-      description: "RDF serialization (Turtle/JSON-LD)"
-
-    created_at:
-      type: string
-      format: date-time
-
----
-
-User:
-  description: "System user account"
-  type: object
-  required:
-    - user_id
-    - email
-    - role
-  properties:
-    user_id:
-      type: string
-      format: uuid
-
-    email:
-      type: string
-      format: email
-
-    username:
-      type: string
-      pattern: "^[a-z0-9_-]{3,20}$"
-
-    full_name:
-      type: string
-      maxLength: 100
-
-    institution:
-      type: string
-      maxLength: 200
-
-    role:
-      type: string
-      enum:
-        - admin
-        - researcher
-        - analyst
-        - guest
-
-    permissions:
-      type: array
-      items:
-        type: string
-        enum:
-          - submit_jobs
-          - view_all_experiments
-          - delete_data
-          - manage_users
-          - modify_settings
-
-    api_key:
-      type: string
-      writeOnly: true
-      description: "API authentication key (hashed)"
-
-    api_key_created_at:
-      type: string
-      format: date-time
-
-    last_login:
-      type: string
-      format: date-time
-
-    account_status:
-      type: string
-      enum: [active, suspended, deleted]
-      default: active
-
-    storage_quota_gb:
-      type: integer
-      default: 1000
-      description: "Storage quota (GB)"
-
-    storage_used_gb:
-      type: number
-      description: "Current storage usage"
-
-    created_at:
-      type: string
-      format: date-time
-
-    updated_at:
-      type: string
-      format: date-time
-
----
-
-AuditLog:
-  description: "System audit log entry"
-  type: object
-  required:
-    - log_id
-    - event_type
-    - user_id
-    - timestamp
-  properties:
-    log_id:
-      type: string
-      format: uuid
-
-    event_type:
-      type: string
-      enum:
-        - user_login
-        - user_logout
-        - job_submitted
-        - job_cancelled
-        - data_uploaded
-        - data_downloaded
-        - data_deleted
-        - settings_changed
-        - api_access
-        - authentication_failed
-
-    user_id:
-      type: string
-      format: uuid
-
-    resource_type:
-      type: string
-      nullable: true
-      enum:
-        - experiment
-        - sequencing_run
-        - job
-        - file
-        - user
-
-    resource_id:
-      type: string
-      nullable: true
-
-    action:
-      type: string
-      description: "Action performed"
-      examples:
-        - "CREATE"
-        - "READ"
-        - "UPDATE"
-        - "DELETE"
-
-    ip_address:
-      type: string
-      format: ipv4
-
-    user_agent:
-      type: string
-      description: "Browser/client user agent"
-
-    request_method:
-      type: string
-      enum: [GET, POST, PUT, DELETE, PATCH]
-      nullable: true
-
-    request_path:
-      type: string
-      nullable: true
-      example: "/api/v1/jobs"
-
-    response_status:
-      type: integer
-      nullable: true
-      example: 201
-
-    details:
-      type: object
-      additionalProperties: true
-      description: "Additional event details"
-
-    timestamp:
-      type: string
-      format: date-time
-
-    severity:
-      type: string
-      enum: [info, warning, error, critical]
-      default: info