bio 0.7.0

data/lib/bio/location.rb

@@ -0,0 +1,650 @@
+#
+# = bio/location.rb - Locations/Location class (GenBank location format)
+#
+# Copyright::	Copyright (C) 2001, 2005
+#		KATAYAMA Toshiaki <k@bioruby.org>
+# License::	LGPL
+#
+# $Id: location.rb,v 0.22 2005/12/18 15:50:06 k Exp $
+#
+# == Appendix : GenBank location descriptor classification
+# 
+# === Definition of the position notation of the GenBank location format
+# 
+# According to the GenBank manual 'gbrel.txt', I classified position notations
+# into 10 patterns - (A) to (J).
+# 
+#       3.4.12.2 Feature Location
+#       
+#         The second column of the feature descriptor line designates the
+#       location of the feature in the sequence. The location descriptor
+#       begins at position 22. Several conventions are used to indicate
+#       sequence location.
+#       
+#         Base numbers in location descriptors refer to numbering in the entry,
+#       which is not necessarily the same as the numbering scheme used in the
+#       published report. The first base in the presented sequence is numbered
+#       base 1. Sequences are presented in the 5 to 3 direction.
+#       
+#       Location descriptors can be one of the following:
+#       
+#   (A) 1. A single base;
+#       
+#   (B) 2. A contiguous span of bases;
+#       
+#   (C) 3. A site between two bases;
+#       
+#   (D) 4. A single base chosen from a range of bases;
+#   
+#   (E) 5. A single base chosen from among two or more specified bases;
+#   
+#   (F) 6. A joining of sequence spans;
+#   
+#   (G) 7. A reference to an entry other than the one to which the feature
+#         belongs (i.e., a remote entry), followed by a location descriptor
+#         referring to the remote sequence;
+#   
+#   (H) 8. A literal sequence (a string of bases enclosed in quotation marks).
+#   
+#   
+#   (C)   A site between two residues, such as an endonuclease cleavage site, is
+#       indicated by listing the two bases separated by a carat (e.g., 23^24).
+#   
+#   (D)   A single residue chosen from a range of residues is indicated by the
+#       number of the first and last bases in the range separated by a single
+#       period (e.g., 23.79). The symbols < and > indicate that the end point
+#   (I) of the range is beyond the specified base number.
+#   
+#   (B)   A contiguous span of bases is indicated by the number of the first and
+#       last bases in the range separated by two periods (e.g., 23..79). The
+#   (I) symbols < and > indicate that the end point of the range is beyond the
+#       specified base number. Starting and ending positions can be indicated
+#       by base number or by one of the operators described below.
+#   
+#         Operators are prefixes that specify what must be done to the indicated
+#       sequence to locate the feature. The following are the operators
+#       available, along with their most common format and a description.
+#   
+#   (J) complement (location): The feature is complementary to the location
+#       indicated. Complementary strands are read 5 to 3.
+#   
+#   (F) join (location, location, .. location): The indicated elements should
+#       be placed end to end to form one contiguous sequence.
+#   
+#   (F) order (location, location, .. location): The elements are found in the
+#       specified order in the 5 to 3 direction, but nothing is implied about
+#       the rationality of joining them.
+#   
+#   (F) group (location, location, .. location): The elements are related and
+#       should be grouped together, but no order is implied.
+#   
+#   (E) one-of (location, location, .. location): The element can be any one,
+#       but only one, of the items listed.
+# 
+# === Reduction strategy of the position notations
+# 
+#   (A) Location n
+#   
+#   (B) Location n..m
+#   
+#   (C) Location n^m
+#   
+#   (D) (n.m)		=> Location n
+#   
+#   (E) one-of(n,m,..)	=> Location n
+#       one-of(n..m,..)	=> Location n..m
+#   
+#   (F) order(loc,loc,..)	=> join(loc, loc,..)
+#       group(loc,loc,..)	=> join(loc, loc,..)
+#       join(loc,loc,..)	=> Sequence
+#   
+#   (G) ID:loc		=> Location with ID
+#   
+#   (H) "atgc"		=> Location only with Sequence
+#   
+#   (I) <n			=> Location n with lt flag
+#       >n			=> Location n with gt flag
+#       <n..m		=> Location n..m with lt flag
+#       n..>m		=> Location n..m with gt flag
+#       <n..>m		=> Location n..m with lt, gt flag
+#   
+#   (J) complement(loc)	=> Sequence
+#   
+#   (K) replace(loc, str)	=> Location with replacement Sequence
+# 
+# === GenBank location examples
+# 
+# (C) n^m
+# 
+# * [AB015179]	754^755
+# * [AF179299]	complement(53^54)
+# * [CELXOL1ES]	replace(4480^4481,"")
+# * [ECOUW87]	replace(4792^4793,"a")
+# * [APLPCII]	replace(1905^1906,"acaaagacaccgccctacgcc")
+# 
+# (D) (n.m)
+# 
+# * [HACSODA]	157..(800.806)
+# * [HALSODB]	(67.68)..(699.703)
+# * [AP001918]	(45934.45974)..46135
+# * [BACSPOJ]	<180..(731.761)
+# * [BBU17998]	(88.89)..>1122
+# * [ECHTGA]	complement((1700.1708)..(1715.1721))
+# * [ECPAP17]	complement(<22..(255.275))
+# * [LPATOVGNS]	complement((64.74)..1525)
+# * [PIP404CG]	join((8298.8300)..10206,1..855)
+# * [BOVMHDQBY4]	join(M30006.1:(392.467)..575,M30005.1:415..681,M30004.1:129..410,M30004.1:907..1017,521..534)
+# * [HUMMIC2A]	replace((651.655)..(651.655),"")
+# * [HUMSOD102]	order(L44135.1:(454.445)..>538,<1..181)
+# 
+# (E) one-of
+# 
+# * [ECU17136]	one-of(898,900)..983
+# * [CELCYT1A]	one-of(5971..6308,5971..6309)
+# * [DMU17742]	8050..one-of(10731,10758,10905,11242)
+# * [PFU27807]	one-of(623,627,632)..one-of(628,633,637)
+# * [BTBAINH1]	one-of(845,953,963,1078,1104)..1354
+# * [ATU39449]	join(one-of(969..1094,970..1094,995..1094,1018..1094),1518..1587,1726..2119,2220..2833,2945..3215)
+# 
+# (F) join, order, group
+# 
+# * [AB037374S2]	join(AB037374.1:1..177,1..807)
+# * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
+# * [ASNOS11]	join(AF130124.1:<2563..2964,AF130125.1:21..157,AF130126.1:12..174,AF130127.1:21..112,AF130128.1:21..162,AF130128.1:281..595,AF130128.1:661..842,AF130128.1:916..1030,AF130129.1:21..115,AF130130.1:21..165,AF130131.1:21..125,AF130132.1:21..428,AF130132.1:492..746,AF130133.1:21..168,AF130133.1:232..401,AF130133.1:475..906,AF130133.1:970..1107,AF130133.1:1176..1367,21..>128)
+# 
+# * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
+# * [AF006691]	order(912..1918,20410..21416)
+# * [AF024666]	order(complement(18919..19224),complement(13965..14892))
+# * [AF264948]	order(27066..27076,27089..27099,27283..27314,27330..27352)
+# * [D63363]	order(3..26,complement(964..987))
+# * [ECOCURLI2]	order(complement(1009..>1260),complement(AF081827.1:<1..177))
+# * [S72388S2]	order(join(S72388.1:757..911,S72388.1:609..1542),1..>139)
+# * [HEYRRE07]	order(complement(1..38),complement(M82666.1:1..140),complement(M82665.1:1..176),complement(M82664.1:1..215),complement(M82663.1:1..185),complement(M82662.1:1..49),complement(M82661.1:1..133))
+# * [COL11A1G34]	order(AF101079.1:558..1307,AF101080.1:1..749,AF101081.1:1..898,AF101082.1:1..486,AF101083.1:1..942,AF101084.1:1..1734,AF101085.1:1..2385,AF101086.1:1..1813,AF101087.1:1..2287,AF101088.1:1..1073,AF101089.1:1..989,AF101090.1:1..5017,AF101091.1:1..3401,AF101092.1:1..1225,AF101093.1:1..1072,AF101094.1:1..989,AF101095.1:1..1669,AF101096.1:1..918,AF101097.1:1..1114,AF101098.1:1..1074,AF101099.1:1..1709,AF101100.1:1..986,AF101101.1:1..1934,AF101102.1:1..1699,AF101103.1:1..940,AF101104.1:1..2330,AF101105.1:1..4467,AF101106.1:1..1876,AF101107.1:1..2465,AF101108.1:1..1150,AF101109.1:1..1170,AF101110.1:1..1158,AF101111.1:1..1193,1..611)
+# 
+# group() are found in the COMMENT field only (in GenBank 122.0)
+# 
+#   gbpat2.seq:            FT   repeat_region   group(598..606,611..619)
+#   gbpat2.seq:            FT   repeat_region   group(8..16,1457..1464).
+#   gbpat2.seq:            FT   variation       group(t1,t2)
+#   gbpat2.seq:            FT   variation       group(t1,t3)
+#   gbpat2.seq:            FT   variation       group(t1,t2,t3)
+#   gbpat2.seq:            FT   repeat_region   group(11..202,203..394)
+#   gbpri9.seq:COMMENT     Residues reported = 'group(1..2145);'.
+# 
+# (G) ID:location
+# 
+# * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
+# * [AF178221S4]	join(AF178221.1:<1..60,AF178222.1:1..63,AF178223.1:1..42,1..>90)
+# * [BOVMHDQBY4]	join(M30006.1:(392.467)..575,M30005.1:415..681,M30004.1:129..410,M30004.1:907..1017,521..534)
+# * [HUMSOD102]	order(L44135.1:(454.445)..>538,<1..181)
+# * [SL16SRRN1]	order(<1..>267,X67092.1:<1..>249,X67093.1:<1..>233)
+# 
+# (I) <, >
+# 
+# * [A5U48871]	<1..>318
+# * [AA23SRRNP]	<1..388
+# * [AA23SRRNP]	503..>1010
+# * [AAM5961]	complement(<1..229)
+# * [AAM5961]	complement(5231..>5598)
+# * [AF043934]	join(<1,60..99,161..241,302..370,436..594,676..887,993..1141,1209..1329,1387..1559,1626..1646,1708..>1843)
+# * [BACSPOJ]	<180..(731.761)
+# * [BBU17998]	(88.89)..>1122
+# * [AARPOB2]	order(AF194507.1:<1..510,1..>871)
+# * [SL16SRRN1]	order(<1..>267,X67092.1:<1..>249,X67093.1:<1..>233)
+# 
+# (J) complement
+# 
+# * [AF179299]	complement(53^54)	<= hoge insertion site etc.
+# * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
+# * [AF209868S2]	order(complement(1..>308),complement(AF209868.1:75..336))
+# * [AP000001]	join(complement(1..61),complement(AP000007.1:252907..253505))
+# * [CPPLCG]	complement(<1..(1093.1098))
+# * [D63363]	order(3..26,complement(964..987))
+# * [ECHTGA]	complement((1700.1708)..(1715.1721))
+# * [ECOUXW]	order(complement(1658..1663),complement(1636..1641))
+# * [LPATOVGNS]	complement((64.74)..1525)
+# * [AF129075]	complement(join(71606..71829,75327..75446,76039..76203,76282..76353,76914..77029,77114..77201,77276..77342,78138..78316,79755..79892,81501..81562,81676..81856,82341..82490,84208..84287,85032..85122,88316..88403))
+# * [ZFDYST2]	join(AF137145.1:<1..18,complement(<1..99))
+# 
+# (K) replace
+# 
+# * [CSU27710]	replace(64,"A")
+# * [CELXOL1ES]	replace(5256,"t")
+# * [ANICPC]	replace(1..468,"")
+# * [CSU27710]	replace(67..68,"GC")
+# * [CELXOL1ES]	replace(4480^4481,"")	<= ? only one case in GenBank 122.0
+# * [ECOUW87]	replace(4792^4793,"a")
+# * [CEU34893]	replace(1..22,"ggttttaacccagttactcaag")
+# * [APLPCII]	replace(1905^1906,"acaaagacaccgccctacgcc")
+# * [MBDR3S1]	replace(1400..>9281,"")
+# * [HUMMHDPB1F]	replace(complement(36..37),"ttc")
+# * [HUMMIC2A]	replace((651.655)..(651.655),"")
+# * [LEIMDRPGP]	replace(1..1554,"L01572")
+# * [TRBND3]	replace(376..395,"atttgtgtgtggtaatta")
+# * [TRBND3]	replace(376..395,"atttgtgtgggtaatttta")
+# * [TRBND3]	replace(376..395,"attttgttgttgttttgttttgaatta")
+# * [TRBND3]	replace(376..395,"atgtgtggtgaatta")
+# * [TRBND3]	replace(376..395,"atgtgtgtggtaatta")
+# * [TRBND3]	replace(376..395,"gatttgttgtggtaatttta")
+# * [MSU09460]	replace(193,		<= replace(193, "t")
+# * [HUMMAGE12X]	replace(3002..3003,	<= replace(3002..3003, "GC")
+# * [ADR40FIB]	replace(510..520,	<= replace(510..520, "taatcctaccg")
+# * [RATDYIIAAB]	replace(1306..1443,"aagaacatccacggagtcagaactgggctcttcacgccggatttggcgttcgaggccattgtgaaaaagcaggcaatgcaccagcaagctcagttcctacccctgcgtggacctggttatccaggagctaatcagtacagttaggtggtcaagctgaaagagccctgtctgaaa")
+# 
+#--
+#
+#  This library is free software; you can redistribute it and/or
+#  modify it under the terms of the GNU Lesser General Public
+#  License as published by the Free Software Foundation; either
+#  version 2 of the License, or (at your option) any later version.
+#
+#  This library is distributed in the hope that it will be useful,
+#  but WITHOUT ANY WARRANTY; without even the implied warranty of
+#  MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+#  Lesser General Public License for more details.
+#
+#  You should have received a copy of the GNU Lesser General Public
+#  License along with this library; if not, write to the Free Software
+#  Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307  USA
+#
+#++
+#
+
+module Bio
+
+class Location
+
+  # Pass a range of the 'location' segment.  The 'location' segment can be
+  # 'ID:' + ('n' or 'n..m' or 'n^m' or "seq") with '<' or '>'.
+  def initialize(location = nil)
+
+    if location
+      if location =~ /:/				# (G) ID:location
+        xref_id, location = location.split(':')
+      end
+      if location =~ /</				# (I) <,>
+        lt = true
+      end
+      if location =~ />/
+        gt = true
+      end
+    end
+
+    # s : start base, e : end base => from, to
+    case location
+    when /^[<>]?(\d+)$/				# (A, I) n
+      s = e = $1.to_i
+    when /^[<>]?(\d+)\.\.[<>]?(\d+)$/			# (B, I) n..m
+      s = $1.to_i
+      e = $2.to_i
+      if e - s < 0
+#       raise "Error: invalid range : #{location}"
+        $stderr.puts "[Warning] invalid range : #{location}" if $DEBUG
+      end
+    when /^[<>]?(\d+)\^[<>]?(\d+)$/			# (C, I) n^m
+      s = $1.to_i
+      e = $2.to_i
+      if e - s != 1
+#       raise "Error: invalid range : #{location}"
+        $stderr.puts "[Warning] invalid range : #{location}" if $DEBUG
+      end
+    when /^"?([ATGCatgc]+)"?$/                  # (H) literal sequence
+      sequence = $1.downcase
+      s = e = nil
+    when nil
+      ;
+    else
+      raise "Error: unknown location format : #{location}"
+    end
+
+    @from       = s             # start position of the location
+    @to         = e             # end position of the location
+    @strand     = 1             # strand direction of the location
+                                #   forward => 1 or complement => -1
+    @sequence   = sequence      # literal sequence of the location
+    @lt         = lt            # true if the position contains '<'
+    @gt         = gt            # true if the position contains '>'
+    @xref_id    = xref_id       # link to the external entry as GenBank ID
+  end
+
+  attr_accessor :from, :to, :strand, :sequence, :lt, :gt, :xref_id
+
+  # Complement the sequence from outside.
+  def complement
+    @strand *= -1
+    self					# return Location object
+  end
+
+  # Replace the sequence from outside.
+  def replace(sequence)
+    @sequence	= sequence.downcase
+    self					# return Location object
+  end
+
+  # Returns a range (from..to) of the segment as a Range object.
+  def range
+    @from..@to
+  end
+
+end # class location
+
+
+class Locations
+
+  include Enumerable
+
+  # Parse a GenBank style position string and returns a Locations object,
+  # which contains a list of Location objects.
+  def initialize(position)
+    if position.is_a? Array
+      @locations = position
+    else
+      position   = gbl_cleanup(position)	# preprocessing
+      @locations = gbl_pos2loc(position)	# create an Array of Location
+    end
+  end
+  attr_accessor :locations
+
+  # Iterates on each Location object.
+  def each
+    @locations.each do |x|
+      yield(x)
+    end
+  end
+
+  # Returns nth Location object.
+  def [](n)
+    @locations[n]
+  end
+
+  # Returns first Location object.
+  def first
+    @locations.first
+  end
+
+  # Returns last Location object.
+  def last
+    @locations.last
+  end
+
+  # Returns an Array containing overall min and max position [min, max]
+  # of this Locations object.
+  def span
+    span_min = @locations.min { |a,b| a.from <=> b.from }
+    span_max = @locations.max { |a,b| a.to   <=> b.to   }
+    return span_min.from, span_max.to
+  end
+
+  # Similar to span, but returns a Range object min..max
+  def range
+    min, max = span
+    min..max
+  end
+
+  # Returns a length of the spliced RNA.
+  def length
+    len = 0
+    @locations.each do |x|
+      if x.sequence
+        len += x.sequence.size
+      else
+        len += (x.to - x.from + 1)
+      end
+    end
+    len
+  end
+  alias size length
+
+  # Convert absolute position in DNA (na) to relative position in RNA (na).
+  # If type == :aa,
+  # convert absolute position in DNA (na) to relative position in Protein (aa).
+  def relative(n, type = nil)
+    case type
+    when :location
+      ;
+    when :aa
+      if n = abs2rel(n)
+        (n - 1) / 3 + 1
+      else
+        nil
+      end
+    else
+      abs2rel(n)
+    end
+  end
+
+  # Convert relative position in RNA (na) to absolute position in DNA (na).
+  # If type == :aa,
+  # convert relative position in Protein (aa) -> absolute position in DNA (na).
+  #
+  # * Examples
+  #
+  #     loc = Bio::Locations.new('complement(12838..13533)')
+  #     loc.absolute(10)          #=> 13524 (rel2abs)
+  #     loc.relative(13524)       #=> 10    (abs2rel)
+  #     loc.absolute(10, :aa)     #=> 13506 (rel2abs)
+  #     loc.relative(13506, :aa)  #=> 10    (abs2rel)
+  #
+  def absolute(n, type = nil)
+    case type
+    when :location
+      ;
+    when :aa
+      n = (n - 1) * 3 + 1
+      rel2abs(n)
+    else
+      rel2abs(n)
+    end
+  end
+
+
+  private
+
+
+  # Preprocessing to clean up the position notation.
+  def gbl_cleanup(position)
+    # sometimes position contains white spaces...
+    position.gsub!(/\s+/, '')
+
+    # select one base					# (D) n.m
+    #               ..         n          m           :
+    #     <match>   $1       ( $2         $3       not   )
+    position.gsub!(/(\.{2})?\(?([<>\d]+)\.([<>\d]+)(?!:)\)?/) do |match|
+      if $1
+        $1 + $3			# ..(n.m)  => ..m
+      else
+        $2				# (?n.m)?  => n
+      end
+    end
+
+    # select the 1st location				# (E) one-of()
+    #     <match>   ..      one-of ($2     ,$3      )
+    position.gsub!(/(\.{2})?one-of\(([^,]+),([^)]+)\)/) do |match|
+      if $1
+        $1 + $3.gsub(/.*,(.*)/, '\1')	# ..one-of(n,m)  => ..m
+      else
+        $2				# one-of(n,m)    => n
+      end
+    end
+
+    # substitute order(), group() by join()		# (F) group(), order()
+    position.gsub!(/(order|group)/, 'join')
+
+    return position
+  end
+
+
+  # Parse position notation and create Location objects.
+  def gbl_pos2loc(position)
+    ary = []
+
+    case position
+
+    when /^join\((.*)\)$/				# (F) join()
+      position = $1
+
+      join_list = []		# sub positions to join
+      bracket   = []		# position with bracket
+      s_count   = 0		# stack counter
+
+      position.split(',').each do |sub_pos|
+        case sub_pos
+        when /\(.*\)/
+          join_list << sub_pos
+        when /\(/
+          s_count += 1
+          bracket << sub_pos
+        when /\)/
+          s_count -= 1
+          bracket << sub_pos
+          if s_count == 0
+            join_list << bracket.join(',')
+          end
+        else
+          if s_count == 0
+            join_list << sub_pos
+          else
+            bracket << sub_pos
+          end
+        end
+      end
+
+      join_list.each do |position|
+        ary << gbl_pos2loc(position)
+      end
+
+    when /^complement\((.*)\)$/			# (J) complement()
+      position =       $1
+      gbl_pos2loc(position).reverse_each do |location|
+        ary << location.complement
+      end
+
+    when /^replace\(([^,]+),"?([^"]*)"?\)/		# (K) replace()
+      position =    $1
+      sequence =              $2
+      ary << gbl_pos2loc(position).first.replace(sequence)
+
+    else						# (A, B, C, G, H, I)
+      ary << Location.new(position)
+
+    end
+
+    return ary.flatten
+  end
+
+
+  # Convert the relative position to the absolute position
+  def rel2abs(n) 
+    return nil unless n > 0			# out of range 
+
+    cursor = 0 
+    @locations.each do |x|      
+      if x.sequence 
+        len = x.sequence.size 
+      else 
+        len = x.to - x.from + 1 
+      end  
+      if n > cursor + len 
+        cursor += len 
+      else 
+        if x.strand < 0 
+          return x.to - (n - cursor - 1) 
+        else 
+          return x.from + (n - cursor - 1) 
+        end 
+      end                             
+    end 
+    return nil					# out of range 
+  end
+
+  # Convert the absolute position to the relative position
+  def abs2rel(n)
+    return nil unless n > 0			# out of range
+
+    cursor = 0
+    @locations.each do |x|
+      if x.sequence
+        len = x.sequence.size
+      else
+        len = x.to - x.from + 1
+      end
+      if n < x.from or n > x.to then
+        cursor += len
+      else
+        if x.strand < 0 then
+          return x.to - (n - cursor - 1)
+        else
+          return n + cursor + 1 - x.from
+        end
+      end
+    end
+    return nil				# out of range
+  end
+
+end # class Locations
+
+end # module Bio
+
+
+if __FILE__ == $0
+  puts "Test new & span methods"
+  [
+    '754^755',
+    'complement(53^54)',
+    'replace(4792^4793,"a")',
+    'replace(1905^1906,"acaaagacaccgccctacgcc")',
+    '157..(800.806)',
+    '(67.68)..(699.703)',
+    '(45934.45974)..46135',
+    '<180..(731.761)',
+    '(88.89)..>1122',
+    'complement((1700.1708)..(1715.1721))',
+    'complement(<22..(255.275))',
+    'complement((64.74)..1525)',
+    'join((8298.8300)..10206,1..855)',
+    'replace((651.655)..(651.655),"")',
+    'one-of(898,900)..983',
+    'one-of(5971..6308,5971..6309)',
+    '8050..one-of(10731,10758,10905,11242)',
+    'one-of(623,627,632)..one-of(628,633,637)',
+    'one-of(845,953,963,1078,1104)..1354',
+    'join(2035..2050,complement(1775..1818),13..345,414..992,1232..1253,1024..1157)',
+    'join(complement(1..61),complement(AP000007.1:252907..253505))',
+    'complement(join(71606..71829,75327..75446,76039..76203))',
+    'order(3..26,complement(964..987))',
+    'order(L44135.1:(454.445)..>538,<1..181)',
+    '<200001..<318389',
+  ].each do |pos|
+    p pos
+    p Bio::Locations.new(pos).span
+    p Bio::Locations.new(pos).range
+    p Bio::Locations.new(pos)
+  end
+
+  puts "Test rel2abs/abs2rel method"
+  [
+    '6..15',
+    'join(6..10,16..30)',
+    'complement(join(6..10,16..30))',
+    'join(complement(6..10),complement(16..30))',
+    'join(6..10,complement(16..30))',
+  ].each do |pos|
+    loc = Bio::Locations.new(pos)
+    p pos
+#   p loc
+    (1..21).each do |x|
+      print "absolute(#{x}) #=> ", y = loc.absolute(x), "\n"
+      print "relative(#{y}) #=> ", y ? loc.relative(y) : y, "\n"
+      print "absolute(#{x}, :aa) #=> ", y = loc.absolute(x, :aa), "\n"
+      print "relative(#{y}, :aa) #=> ", y ? loc.relative(y, :aa) : y, "\n"
+    end
+  end
+
+  pos = 'join(complement(6..10),complement(16..30))'
+  loc = Bio::Locations.new(pos)
+  print "pos         : "; p pos
+  print "`- loc[1]   : "; p loc[1]
+  print "   `- range : "; p loc[1].range
+end
+