bio-polymarker 1.3.2

checksums.yaml

@@ -0,0 +1,7 @@
+---
+SHA256:
+  metadata.gz: 89d5e8e03f5d0ad769937950884f4c02591e445a9135817e20feee20489dda24
+  data.tar.gz: 34fa2901aa11717b33be10a5e1405a159c93375e14d1a1783b7d3da7d2d6e966
+SHA512:
+  metadata.gz: 0c04602ec3dd28a1bca16a5d30c3292fab2d069304c08111f3749dac1666b7a22291ad7eefc94ecf0f5e1510c720c9c9a9955e484177927bc7506b7d9e3af95a
+  data.tar.gz: 2ec66e342aeb13ba371b7e22da7fcfabb7d690903ddd13de732177d6489a3ad1732f496ae169dc71b7baf76f09a07a64d501ab50672b73194d58199c861b33d4

data/.travis.yml

@@ -0,0 +1,24 @@
+language: ruby
+sudo: false
+addons:
+  apt:
+    packages:
+    - zlib1g-dev
+    - libncurses5-dev
+    - libtinfo-dev 
+    - exonerate  
+    - blast2
+    - ncbi-blast+
+    - mafft
+    - primer3
+before_install:
+  - gem update --system
+  - export RUBYOPT="-W1"
+rvm:
+  - 2.3
+  - 2.4
+  - 2.5
+  - 2.6
+  - 2.7
+
+

data/Gemfile

@@ -0,0 +1,23 @@
+source "http://rubygems.org"
+# Add dependencies required to use your gem here.
+# Example:
+#   gem "activesupport", ">= 2.3.5"
+
+gem "bio", ">= 1.5.1"
+gem "bio-samtools-wrapper", ">= 2.7.0"
+gem "descriptive_statistics"
+#gem "rake"
+
+gem "sorted_set"
+
+gem "systemu", ">=2.5.2"
+
+group :development do
+	gem "shoulda", ">= 2.10"
+	gem 'test-unit'
+	if RUBY_VERSION.start_with?("2.1") or RUBY_VERSION.start_with?("2.2") or RUBY_VERSION.start_with?("2.0")
+		gem "jeweler", "= 2.0.1"
+	else
+		gem "juwelier" 
+	end
+end

data/README.md

@@ -0,0 +1,205 @@
+# bio-polyploid-tools
+
+## Introduction
+
+This tools are designed to deal with polyploid wheat. The first tool is to design KASP primers, making them as specific as possible. 
+
+
+## Installation
+
+```sh
+gem install bio-polyploid-tools
+```
+You need to have in your ```$PATH``` the following programs:
+
+* [MAFFT](http://mafft.cbrc.jp/alignment/software/)
+* [primer3](http://primer3.sourceforge.net/releases.php)
+* [exonerate](http://www.ebi.ac.uk/~guy/exonerate/) 
+* [blast](https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE%3DBlastDocs&DOC_TYPE%3DDownload)
+
+The code was originally developed on ruby 2.1, 2.3 and 2.5. It may work on older version. However, it is only actively tested in currently supported ruby versions: 
+  
+  * 2.1.10
+  * 2.2.5
+  * 2.3.5
+  * 2.4.2
+  * 2.5.0
+
+# PolyMarker
+
+To run PolyMarker with the CSS wheat contigs, you need to unzip the reference file from  [ensembl](http://ftp.ensemblgenomes.org/pub/release-25/plants/fasta/triticum_aestivum/dna/Triticum_aestivum.IWGSC2.25.dna.genome.fa.gz).
+
+
+```sh
+polymarker.rb --contigs Triticum_aestivum.IWGSC2.25.dna.genome.fa --marker_list snp_list.csv --output output_folder
+```
+
+The ```snp_list``` file must follow the convention ```ID,Chromosome,SEQUENCE``` with the SNP inside the sequence in the format [A/T]. As a reference, look at test/data/short_primer_design_test.csv
+
+If you want to use the web interface, visit the [PolyMarker webservice at TGAC](http://polymarker.tgac.ac.uk)
+
+The available command line arguments are: 
+
+```
+Usage: polymarker.rb [options]
+    -c, --contigs FILE               File with contigs to use as database
+    -m, --marker_list FILE           File with the list of markers to search from
+    -g, --genomes_count INT          Number of genomes (default 3, for hexaploid)
+    -s, --snp_list FILE              File with the list of snps to search from, requires --reference to get the sequence using a position
+    -t, --mutant_list FILE           File with the list of positions with mutation and the mutation line.
+    requires --reference to get the sequence using a position
+    -r, --reference FILE             Fasta file with the sequence for the markers (to complement --snp_list)
+    -o, --output FOLDER              Output folder
+    -e, --exonerate_model MODEL      Model to be used in exonerate to search for the contigs
+    -i, --min_identity INT           Minimum identity to consider a hit (default 90)
+    -a, --arm_selection arm_selection_embl|arm_selection_morex|arm_selection_first_two
+                    Function to decide the chromome arm
+    -p, --primer_3_preferences FILE  file with preferences to be sent to primer3
+    -v, --variation_free_region INT  If present, avoid generating the common primer if there are homoeologous SNPs within the specified distance (not tested)
+    -x, --extract_found_contigs      If present, save in a separate file the contigs with matches. Useful to debug.
+    -P, --primers_to_order			 If present, saves a file named primers_to_order which contains the KASP tails
+```
+
+## Input formats
+
+The following formats are used to define the marker sequences:
+
+### Marker list
+
+If the option ```--marker_list FILE``` is used, the SNP and the flanking sequence is included in the file. The format contains 3 columns (the order is important):
+
+* **snp_name** The ID of the marker. Must be unique. 
+* **target chromosome** for the specific primers. Must be in line with the chromosome selection critieria. 
+* **sequence** The sequence flanking the SNP with the SNP highligted on square brackets (```[]```) and the two alleles separated by a forward slash (```/```). 
+
+#### Example:
+
+```
+BS00068396_51,2A,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA
+```
+
+### SNP list
+
+If the flanking sequence is unknow, but the position on a reference is available,  the option ```--snp_list``` can be used and the FASTA file with the reference sequence must be provided with the option ```--reference```. This is to allow the use of a different assembly or set of contigs used for the discovery of the SNPs that are different to the reference given in the option ```--contigs```. The format contains the following positional columns: 
+
+* **scaffold** The sacffold where the SNP is. 
+* **reference allele** The base in the reference (may or may not be the same as in the reference file.
+* **position** Position of the SNP. The first base in the scaffold is base 1. 
+* **alternative allele** The base in the alternative allele. 
+* **target chromosome** for the specific primers. Must be in line with the chromosome selection critieria. 
+
+#### Example
+
+```
+IWGSC_CSS_1AL_scaff_110,C,519,A,2A
+```
+
+This file format can be used with ```snp_positions_to_polymarker.rb``` to produce the input for the option```--marker_list```.
+
+
+### Custom reference sequences. 
+
+By default, the contigs and pseudomolecules from [ensembl](ftp://ftp.ensemblgenomes.org/pub/release-25/plants/fasta/triticum_aestivum/dna/Triticum_aestivum.IWGSC2.25.dna.genome.fa.gz
+) are used. However, it is possible to use a custom reference. To define the chromosome where each contig belongs the argument ```arm_selection``` is used.  The defailt uses ids like: ```IWGSC_CSS_1AL_scaff_110```, where the third field, separated by underscores is used. A simple way to add costum references is to rename the fasta file to follow that convention. Another way is to use the option ```--arm_selection arm_selection_first_two```, where only the first two characters in each contig is used as identifier, useful when pseudomolecules are named after the chromosomes (ie: ">1A" in the fasta file). 
+
+If your contigs follow a different convention, in the file ```ChromosomeArm.rb``` it is possible to define new parsers, by adding at the begining, with the rest of the parsers a new lambda like:
+
+```rb
+@@arm_selection_functions[:embl] = lambda do | contig_name|
+  arr = contig_name.split('_')
+  ret = "U"
+  ret = arr[2][0,2] if arr.size >= 3
+  ret = "3B" if arr.size == 2 and arr[0] == "v443"
+  ret = arr[0][0,2] if arr.size == 1   
+  return ret
+end
+```
+
+The function should return a 2 character string, when the first is the chromosome number and the second the chromosome group. The symbol in the hash is the name to be used in the argument ```--arm_selection```.  If you want your parser to be added to the distribution, feel free to fork and make a pull request.  
+
+##Using blast
+
+To use blast instead of exonerate, use the following command:
+
+```
+./bin/polymarker.rb --contigs test/data/BS00068396_51_contigs.fa --marker_list test/data/BS00068396_51_for_polymarker.fa  --aligner blast  -a arm_selection_first_two
+```
+
+
+## Release Notes
+
+### 0.9.7 
+There was some strange issue with the numbering, so bumped to 0.9.7
+
+* Moved the arm selection function for fields in the chromosome name to the ```ChromosomeArm``` class.
+
+### 0.8.7
+* FEATURE: ```polymarker.rb``` now also prints the total number of hits found. 
+
+### 0.8.6
+
+* BUGFIX: ```priemr3.rb``` had a regression when adding the repetitive flag to the ```@values``` array. This lead to the wrong order of the columns in the output and possibly other secondary effects. 
+
+### 0.8.5
+
+* Added the option ```--max_hits``` to ```polyamarker.rb``` to set a maximum number of bast hits to identify repetitive regions. This adds the column ```is_repetitve``` to the output. The mask is not calculated in repetitive regions and the primers are designed as non-specific. 
+
+### 0.8.4 
+
+* Added script ```tag_stats.rb`` That gets the descriptive statistics for a tag in a bam file for each reference. 
+
+```bash
+ruby tag_stats.rb -b HI.3206.006.Index_2.CS_125RNA_14d_Leaf8.sorted.bam -r /Users/ramirezr/Dropbox/JIC/expVIPMetadatas/RefSeq1.0/Genes/annotation/IWGSCv1.0_UTR_ALL.cdnas.fasta --tag 'NH'
+```
+
+### 0.8.3
+
+* BUGFIX: ```ChromosomeArm.rb``` was fixed to conform the module assumptions for the package. 
+
+
+### 0.8.2
+
+* FEATURE: The functions to select the chromosome arm are now in ```lib/bio/PolyploidTools/ChromosomeArm.rb``` and the help message is updated automatically with the valid options. 
+* FEATURE: Added option ```filter_best``` to replicate the original behaviour of selecting the best hit of each chromosome. Still useful for assemblies which still contain synthetic duplications.
+
+### 0.8.1
+
+* BUGFIX: There was an error which prevented the correct localisation of the SNP in markeres with gaps in the local alignment before the position with the snp.
+* FEATURE: PolyMarker now selects the best hit of the target chromosome. This improves the specificity in regions with a recent duplication. The drawback is that if your assembly has artificial repetitions, the primers won't be marked as 'chromosome specific', but as 'chromosome semi-specific '. In a future version this will be addressed. 
+
+### 0.8
+
+* FEATURE: ```polymarker.rb``` added the flag ```--aligner blast|exonerate ``` which lets you pick between ```blast``` or ```exonerate``` as the aligner. For blast the default is to have the database with the same name as the ```--contigs``` file. However, it is possible to use a different name vua the option ```--database```.
+
+### 0.7.3
+
+* FEATURE: ```polymarker.rb``` Added to the flag ```--arm_selection``` the option ```scaffold```, which now supports a scaffold specific primer.
+* FEATURE: ```snp_position_to_polymarker``` Added the option ```--mutant_list```  to prepare files for PolyMarker from files with the following columns ```ID,Allele_1,position,Allele_1,target_chromosome```. 
+
+### 0.7.2
+
+* FEATURE: Added a flag ```min_identity``` to set the minimum identity to consider a hit. The default is 90
+
+### 0.7.1
+* BUGFIX: Now the parser for ```arm_selection_embl``` works with the mixture of contigs and pseudomolecules
+*  DOC: Added documentation on how to use custom references.  
+
+### 0.7.0
+* Added flag ```genomes_count``` for number of genomes, to be used on tetraploids, etc. 
+
+### 0.6.1
+
+
+* polymarker.rb now validates that all the files exist. 
+* BUGFIX: A reference was required even when it was not used to generate contigs. 
+
+# Notes
+
+* BUG: Blocks with NNNs are picked and treated as semi-specific. 
+* BUG: If the name of the reference have space, the ID is not chopped. ">gene_1 (G12A)" shouls be treated as ">gene_1". 
+* TODO: Add a parameter file to configure the alignments. 
+* TODO: Produce primers for products of different sizes. This can probably be done with the primer_3_preferences option, but hasn't been tested. 
+
+
+
+

data/Rakefile

@@ -0,0 +1,61 @@
+require 'rubygems'
+require 'bundler'
+#
+#require 'bundler/version'
+
+begin
+  Bundler.setup(:default, :development)
+  rescue Bundler::BundlerError => e
+  $stderr.puts e.message
+  $stderr.puts "Run `bundle install` to install missing gems"
+  exit e.status_code
+end
+require 'rake'
+
+
+if RUBY_VERSION.start_with?("2.1") or RUBY_VERSION.start_with?("2.2") or RUBY_VERSION.start_with?("2.0")
+  require 'jeweler'
+  @taskClass = Jeweler
+else
+  require 'juwelier'
+  @taskClass = Juwelier
+end
+
+
+
+@taskClass::Tasks.new do |gem|
+  # gem is a Gem::Specification... see http://docs.rubygems.org/read/chapter/20 for more options
+   gem.name = "bio-polymarker"
+  gem.homepage = "https://github.com/cb2e6f/bio-polymarker"
+  gem.license = "MIT"
+  gem.summary = %Q{Tool to work with polyploids, NGS and molecular biology}
+  gem.description = %Q{Repository of tools developed at Crop Genetics in JIC to work with polyploid wheat}
+   gem.email = "rob.ellis@jic.ac.uk"
+  gem.authors = ["Rob Ellis"]
+  # Include your dependencies below. Runtime dependencies are required when using your gem,
+  # and development dependencies are only needed for development (ie running rake tasks, tests, etc)
+  #gem.add_runtime_dependency 'bio-samtools', '= 0.6.2'
+  #  gem.add_development_dependency 'rspec', '> 1.2.3'
+#  gem.extensions = "ext/mkrf_conf.rb"
+end
+@taskClass::RubygemsDotOrgTasks.new
+
+require 'rake/testtask'
+Rake::TestTask.new(:test) do |test|
+  test.libs << 'lib' << 'test'
+  test.pattern = 'test/**/test_*.rb'
+  test.verbose = true
+end
+
+
+if RUBY_VERSION.start_with?("1.8")
+  require 'rcov/rcovtask'
+  Rcov::RcovTask.new do |test|
+    test.libs << 'test'
+    test.pattern = 'test/**/test_*.rb'
+    test.verbose = true
+  end
+end
+
+task :default => :test
+

data/SECURITY.md

@@ -0,0 +1,16 @@
+# Security Policy
+
+## Supported Versions
+
+The following table shows the currently supported version. 
+
+| Version | Supported          |
+| ------- | ------------------ |
+| 1.1.x   | :white_check_mark: |
+| 1.0.x   | :x:                |
+| 0.x.x   | :x:                |
+
+
+## Reporting a Vulnerability
+
+If you find a vulneravility, please submit a comment in the security tab

data/VERSION

@@ -0,0 +1 @@
+1.3.2

data/bin/bfr.rb

@@ -0,0 +1,128 @@
+#!/usr/bin/env ruby
+require 'rubygems'
+#require 'extensions/all'
+require 'bio-samtools-wrapper'
+require 'optparse'
+
+$: << File.expand_path(File.dirname(__FILE__) + '/../lib')
+$: << File.expand_path('.')
+path=File.expand_path(File.dirname(__FILE__) + '/../lib/bio-polymarker.rb')
+$stderr.puts "Loading: #{path}"
+require path
+
+options = {}
+
+options[:chunk] = 0
+options[:chunk_size] = 0
+options[:bucket] = 1
+
+OptionParser.new do |opts|
+  opts.banner = "Usage: bfr.rb [options]"
+  
+  opts.on("-r", "--reference FILE", "Fasta file with the reference sequence. Make sure to run faidx before running bfr in parallel") do |o|
+     options[:reference] = o
+   end
+   
+  opts.on("-a", "--parent_1 FILE", "Sorted BAM file with the alginments from parental 1") do |o|
+    options[:parent_1] = o
+  end
+  
+  opts.on("-b", "--parent_2 FILE", "Sorted BAM file with the alginments from parental 2") do |o|
+    options[:parent_2] = o
+  end
+  
+  opts.on("-c", "--bulk_1 FILE", "Sorted BAM file with the alginments from bulk1 1 (corresponding to the phenotype of parental 1)") do |o|
+    options[:bulk_1] = o
+  end
+  
+  opts.on("-d", "--bulk_2 FILE", "Sorted BAM file with the alginments from bulk1 2 (corresponding to the phenotype of parental 2)") do |o|
+    options[:bulk_2] = o
+  end
+  
+  opts.on("-o", "--bfr FILE", "Output file with the BFRs in the chunck") do |o|
+    options[:output_filename] = o
+  end
+
+  opts.on("-s", "--stats FILE", "Output with the summary of the run. Only writes at the end, so in principle, paralell process should be able to write on it to get a status of how much has been completed.") do |o|
+    options[:stats_file] = o
+  end
+  opts.on("-d", "--bulk_2 FILE", "Sorted BAM file with the alginments from bulk1 2 (corresponding to the phenotype of parental 2)") do |o|
+    options[:bulk_2] = o
+  end
+  
+  opts.on("-m", "--chunk_size FILE", "Number of chunks to divde the SNP calling. Useful to run in a cluster.") do |o|
+    options[:chunk_size] = o.to_i
+  end
+  
+  opts.on("-n", "--chunk FILE", "Chunk number. Must be less than chunk_size. ") do |o|
+    options[:chunk] = o.to_i
+  end
+  
+    
+end.parse!
+
+p options
+p ARGV
+
+
+reference = options[:reference] 
+chunk =  options[:chunk] 
+chunk_size = options[:chunk_size]
+output_filename =  options[:output_filename] 
+stats_file = options[:stats_file]
+
+
+min = chunk * chunk_size
+max = min + chunk_size
+
+
+parental_1=options[:parent_1]
+parental_2=options[:parent_2]
+
+
+bulk_1 = options[:bulk_1]
+bulk_2 = options[:bulk_2]
+
+
+fasta_db = Bio::DB::Fasta::FastaFile.new({:fasta=>reference})
+fasta_db.load_fai_entries
+
+
+if chunk_size == 0
+  min = 0
+  max = fasta_db.index.entries.size
+end
+
+container = Bio::BFRTools::BFRContainer.new
+
+container.reference reference
+container.parental_1  ( {:path => parental_1 } )
+container.parental_2  ( {:path => parental_2 } )
+container.bulk_1 ( {:path => bulk_1  })
+container.bulk_2 ( {:path => bulk_2  })
+
+i = -1
+
+container.init_counters
+output_file =  File.open(output_filename, "w")
+puts "Range: #{min}:#{max}"
+fasta_db.index.entries.each do | r |
+  i = i  + 1
+  #puts r
+  #puts i
+  next if i < min or i >= max 
+  container.process_region({:region => r.get_full_region.to_s,:output_file => output_file } )
+  #puts "Processed"
+end
+output_file.close
+
+file_h = nil
+if !File.exists? stats_file
+  file_h = File.open(stats_file, "w")
+  container.print_header({:output_file_stats => file_h})
+else
+  file_h =  File.open(stats_file, "a")
+end
+container.print_stats({:output_file_stats => file_h})
+
+file_h.close

data/bin/blast_triads.rb

@@ -0,0 +1,166 @@
+#!/usr/bin/env ruby
+require 'optparse'
+require 'bio'
+require 'csv'
+require 'bio-blastxmlparser'
+require 'fileutils'
+require 'tmpdir'
+
+
+options = {}
+options[:identity] = 50
+options[:min_bases] = 200
+options[:split_token] = "-"
+options[:tmp_folder]  = Dir.mktmpdir
+options[:program]  = "blastn"
+options[:random_sample] = 0
+
+OptionParser.new do |opts|
+  
+  opts.banner = "Usage: filter_blat.rb [options]"
+
+  opts.on("-i", "--identity FLOAT", "Minimum percentage identity") do |o|
+    options[:identity] = o.to_f
+  end
+  opts.on("-c", "--min_bases int", "Minimum alignment length (default 200)") do |o|
+    options[:min_bases] = o.to_i
+  end
+
+  opts.on("-t", "--triads FILE", "CSV file with the gene triad names in the named columns 'A','B' and 'D' ") do |o|
+    options[:triads] = o
+  end
+
+  opts.on("-f", "--sequences FILE" , "FASTA file containing all the possible sequences. ") do |o|
+    options[:fasta] = o
+  end
+
+  opts.on("-s", "--split_token CHAR", "Character used to split the sequence name. The name will be evarything before this token on the name of the sequences") do |o|
+    options[:split_token] = o
+  end
+
+  opts.on("-p", "--program blastn|blastp", "The program to use in the alignments. Currntly only supported blastn and blastp") do |o|
+    options[:program] = o
+  end
+
+  opts.on("-r", "--random_sample INT", "Number of blast to run and keep. If set, only the number of subsets will be run") do |o|
+    options[:random_sample] = o.to_i
+  end
+
+
+end.parse!
+
+
+def blast_pair_fast(path_a, path_b, out_path, program: "blastn")
+  cmd = "#{program} -query #{path_a} -subject #{path_b} -task #{program} -out #{out_path} -outfmt '5' "
+  #puts cmd
+  executed = system cmd
+  result = []
+  blast_version = nil
+  n = Bio::BlastXMLParser::XmlIterator.new(out_path).to_enum
+  longest = nil
+  max_length = 0
+  max_pident = 0.0
+  max_similarity = 0.0
+  n.each do | iter |
+    iter.each do | hit |
+      align_len = 0
+      identity = 0.0
+      positives = 0.0
+      hit.each do | hsp |
+        align_len += hsp.align_len
+        identity  += hsp.identity  
+        positives += hsp.positive if program == "blastp"
+      end
+      if align_len > max_length
+        max_length = align_len
+        max_pident = 100 * identity      / align_len
+        max_similarity = 100 * positives / align_len
+      end
+    end
+  end
+  [max_length, max_pident, max_similarity]
+end
+
+valid_pairs_A_B = Hash.new
+valid_pairs_A_D = Hash.new
+valid_pairs_B_D = Hash.new
+
+split_token = options[:split_token]
+
+sequences = Hash.new
+sequence_count=0
+Bio::FlatFile.open(Bio::FastaFormat, options[:fasta]) do |fasta_file|
+  fasta_file.each do |entry|
+    gene_name = entry.entry_id.split(split_token)[0]  
+    sequences[gene_name] = entry unless sequences[gene_name]
+    sequences[gene_name] = entry if entry.length > sequences[gene_name].length
+    sequence_count += 1
+  end
+end
+
+$stderr.puts "#Loaded #{sequences.length} genes from #{sequence_count} sequences"
+#FileUtils.mkdir_p(options[:tmp_folder])
+$stderr.puts "TMP dir: #{options[:tmp_folder]}"
+
+a_tmp   = options[:tmp_folder] + "/A.fa"
+b_tmp   = options[:tmp_folder] + "/B.fa"
+d_tmp   = options[:tmp_folder] + "/D.fa"
+out_tmp = options[:tmp_folder] + "/out.blast"
+
+
+puts [
+  "group_id" , "query"      , "subject" , 
+  "chr_query", "chr_subject", "aln_type",
+  "length"   , "pident" , "psimilarity"   ].join("\t")
+
+count_lines = File.foreach(options[:triads]).inject(0) {|c, line| c+1}
+
+probability =  options[:random_sample] / count_lines.to_f
+probability = 1 if options[:random_sample] == 0
+prng = Random.new
+#puts probability
+
+CSV.foreach(options[:triads], headers:true ) do |row|
+   a = row['A']
+   b = row['B']
+   d = row['D']
+   triad = row['group_id']
+
+   save = probability > prng.rand && probability < 1
+   run  = probability == 1 || save 
+   next unless run
+
+   seq_a = sequences[a]
+   seq_b = sequences[b]
+   seq_d = sequences[d]
+   File.open(a_tmp, 'w') {|f| f.write(seq_a) } if seq_a
+   File.open(b_tmp, 'w') {|f| f.write(seq_b) } if seq_b
+   File.open(d_tmp, 'w') {|f| f.write(seq_d) } if seq_d
+   save_folder = "random_sample/#{triad}"
+   
+   if save
+    FileUtils.mkdir_p save_folder
+    FileUtils.cp(a_tmp, save_folder) if seq_a
+    FileUtils.cp(b_tmp, save_folder) if seq_b
+    FileUtils.cp(d_tmp, save_folder) if seq_d
+   end
+   #This had a bug where the columns where always "AB"
+   if seq_a and seq_b
+      to_print = [triad, a, b , "A","B","A->B"]
+      to_print << blast_pair_fast(a_tmp, b_tmp, out_tmp, program:options[:program])
+      FileUtils.cp(out_tmp, "#{save_folder}/A_B.xml") if save
+      puts to_print.join("\t")
+   end
+  if seq_a and seq_d
+      to_print = [triad, a, d , "A","D","A->D"]
+      to_print << blast_pair_fast(a_tmp, d_tmp, out_tmp, program:options[:program]) 
+      puts to_print.join("\t")
+      FileUtils.cp(out_tmp, "#{save_folder}/A_D.xml") if save
+  end
+  if seq_b and seq_d
+      to_print = [triad, b, d , "B","D","B->D"]
+      to_print << blast_pair_fast(b_tmp, d_tmp, out_tmp, program:options[:program])
+      FileUtils.cp(out_tmp, "#{save_folder}/B_D.xml") if save
+      puts to_print.join("\t")
+  end
+end