BioDSL 1.0.0

data/test/BioDSL/seq/test_digest.rb

@@ -0,0 +1,71 @@
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                  #
+#                                                                                #
+# This program is free software; you can redistribute it and/or                  #
+# modify it under the terms of the GNU General Public License                    #
+# as published by the Free Software Foundation; either version 2                 #
+# of the License, or (at your option) any later version.                         #
+#                                                                                #
+# This program is distributed in the hope that it will be useful,                #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of                 #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                  #
+# GNU General Public License for more details.                                   #
+#                                                                                #
+# You should have received a copy of the GNU General Public License              #
+# along with this program; if not, write to the Free Software                    #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. #
+#                                                                                #
+# http://www.gnu.org/copyleft/gpl.html                                           #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# This software is part of BioDSL (www.BioDSL.org).                        #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+class TestDigest < Test::Unit::TestCase
+  def setup
+    @entry = BioDSL::Seq.new(seq: "cgatcgatcGGATCCgagagggtgtgtagtgGAATTCcgctgc")
+  end
+
+  test "#each_digest with bad residue in pattern raises" do
+    assert_raise(BioDSL::DigestError) { @entry.each_digest("X", 0).to_a }
+  end
+
+  test "#each_digest returns correctly" do
+    digests = @entry.each_digest("GGATCC", 1).to_a
+    assert_equal(2, digests.size)
+    assert_equal("[0-9]", digests.first.seq_name)
+    assert_equal("cgatcgatcG", digests.first.seq)
+    assert_equal("[10-42]", digests.last.seq_name)
+    assert_equal("GATCCgagagggtgtgtagtgGAATTCcgctgc", digests.last.seq)
+  end
+
+  test "#each_digest with negavive offset returns correctly" do
+    digests = @entry.each_digest("CGATCG", -1).to_a
+    assert_equal(1, digests.size)
+    assert_equal("[0-42]", digests.first.seq_name)
+    assert_equal(@entry.seq, digests.first.seq)
+  end
+
+  test "#each_digest with offset out of bounds returns correctly" do
+    digests = @entry.each_digest("AATTCcgctgc", 15).to_a
+    assert_equal(1, digests.size)
+    assert_equal("[0-42]", digests.first.seq_name)
+    assert_equal(@entry.seq, digests.first.seq)
+  end
+
+  test "#each_digest in block context returns correctly" do
+    @entry.each_digest("GGATCC", 1) do |digest|
+      assert_equal("[0-9]", digest.seq_name)
+      assert_equal("cgatcgatcG", digest.seq)
+      break
+    end
+  end
+end

data/test/BioDSL/seq/test_dynamic.rb

@@ -0,0 +1,133 @@
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                  #
+#                                                                                #
+# This program is free software; you can redistribute it and/or                  #
+# modify it under the terms of the GNU General Public License                    #
+# as published by the Free Software Foundation; either version 2                 #
+# of the License, or (at your option) any later version.                         #
+#                                                                                #
+# This program is distributed in the hope that it will be useful,                #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of                 #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                  #
+# GNU General Public License for more details.                                   #
+#                                                                                #
+# You should have received a copy of the GNU General Public License              #
+# along with this program; if not, write to the Free Software                    #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. #
+#                                                                                #
+# http://www.gnu.org/copyleft/gpl.html                                           #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# This software is part of BioDSL (www.BioDSL.org).                        #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+class TestDynamic < Test::Unit::TestCase
+  def setup
+    @p = BioDSL::Seq.new(seq_name: "test", seq: "atcg")
+    @p.extend(BioDSL::Dynamic)
+  end
+
+  test "#patmatch with no match returns nil" do
+    assert_nil(@p.patmatch("gggg"))
+  end
+
+  test "#patmatch with perfect match returns correctly" do
+    m = @p.patmatch("atcg")
+    assert_equal(0, m.beg)
+    assert_equal("atcg", m.match)
+    assert_equal(0, m.mis)
+    assert_equal(0, m.ins)
+    assert_equal(0, m.del)
+    assert_equal(4, m.length)
+  end
+
+  test "#patmatch with perfect match with ambiguity codes returns correctly" do
+    m = @p.patmatch("nnnn")
+    assert_equal(0, m.beg)
+    assert_equal("atcg", m.match)
+    assert_equal(0, m.mis)
+    assert_equal(0, m.ins)
+    assert_equal(0, m.del)
+    assert_equal(4, m.length)
+  end
+
+  test "#patmatch with one mismatch and edit dist zero returns nil" do
+    assert_nil(@p.patmatch("aCcg"))
+  end
+
+  test "#patmatch with one mismatch and edit dist one returns correctly" do
+    m = @p.patmatch("aCcg", 0, 1)
+    assert_equal(0, m.beg)
+    assert_equal("atcg", m.match)
+    assert_equal(1, m.mis)
+    assert_equal(0, m.ins)
+    assert_equal(0, m.del)
+    assert_equal(4, m.length)
+  end
+
+  test "#patmatch with two mismatch and edit dist one returns nil" do
+    assert_nil(@p.patmatch("aGcA", 0, 1))
+  end
+
+  test "#patmatch with one insertion and edit dist zero returns nil" do
+    assert_nil(@p.patmatch("atGcg"))
+  end
+
+  test "#patmatch with one insertion and edit dist one returns correctly" do
+    m = @p.patmatch("atGcg", 0, 1)
+    assert_equal(0, m.beg)
+    assert_equal("atcg", m.match)
+    assert_equal(0, m.mis)
+    assert_equal(1, m.ins)
+    assert_equal(0, m.del)
+    assert_equal(4, m.length)
+  end
+
+  test "#patmatch with two insertions and edit dist one returns nil" do
+    assert_nil(@p.patmatch("atGcTg", 0, 1))
+  end
+
+  test "#patmatch with two insertions and edit dist two returns correctly" do
+    m = @p.patmatch("atGcTg", 0, 2)
+    assert_equal(0, m.beg)
+    assert_equal("atcg", m.match)
+    assert_equal(0, m.mis)
+    assert_equal(2, m.ins)
+    assert_equal(0, m.del)
+    assert_equal(4, m.length)
+  end
+
+  test "#patmatch with one deletion and edit distance zero returns nil" do
+    assert_nil(@p.patmatch("acg"))
+  end
+
+  test "#patmatch with one deletion and edit distance one returns correctly" do
+    m = @p.patmatch("acg", 0, 1)
+    assert_equal(0, m.beg)
+    assert_equal("atcg", m.match)
+    assert_equal(0, m.mis)
+    assert_equal(0, m.ins)
+    assert_equal(1, m.del)
+    assert_equal(4, m.length)
+  end
+
+  test "#patscan locates three patterns ok" do
+    p = BioDSL::Seq.new(seq_name: "test", seq: "ataacgagctagctagctagctgactac")
+    p.extend(BioDSL::Dynamic)
+    assert_equal(3, p.patscan("tag").count)
+  end
+
+  test "#patscan with pos locates two patterns ok" do
+    p = BioDSL::Seq.new(seq_name: "test", seq: "ataacgagctagctagctagctgactac")
+    p.extend(BioDSL::Dynamic)
+    assert_equal(2, p.patscan("tag", 10).count)
+  end
+end

data/test/BioDSL/seq/test_homopolymer.rb

@@ -0,0 +1,58 @@
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                  #
+#                                                                                #
+# This program is free software; you can redistribute it and/or                  #
+# modify it under the terms of the GNU General Public License                    #
+# as published by the Free Software Foundation; either version 2                 #
+# of the License, or (at your option) any later version.                         #
+#                                                                                #
+# This program is distributed in the hope that it will be useful,                #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of                 #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                  #
+# GNU General Public License for more details.                                   #
+#                                                                                #
+# You should have received a copy of the GNU General Public License              #
+# along with this program; if not, write to the Free Software                    #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. #
+#                                                                                #
+# http://www.gnu.org/copyleft/gpl.html                                           #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# This software is part of BioDSL (www.BioDSL.org).                        #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+class TestHomopolymer < Test::Unit::TestCase 
+  def setup
+    @entry = BioDSL::Seq.new(seq: "atcgatTTTTTTcggttga")
+  end
+
+  test "#each_homopolymer with bad min raises" do
+    assert_raise(BioDSL::HomopolymerError) { @entry.each_homopolymer(0) }
+    assert_raise(BioDSL::HomopolymerError) { @entry.each_homopolymer(-1) }
+  end
+
+  test "#each_homopolymer returns correctly" do
+    hps = @entry.each_homopolymer(3)
+    assert_equal(1, hps.size)
+    assert_equal(7, hps.first.length)
+    assert_equal("TTTTTTT", hps.first.pattern)
+    assert_equal(5, hps.first.pos)
+  end
+
+  test "#each_homopolymer in block context returns correctly" do
+    @entry.each_homopolymer(3) do |hp|
+      assert_equal(7, hp.length)
+      assert_equal("TTTTTTT", hp.pattern)
+      assert_equal(5, hp.pos)
+      break
+    end
+  end
+end

data/test/BioDSL/seq/test_kmer.rb

@@ -0,0 +1,134 @@
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                  #
+#                                                                                #
+# This program is free software; you can redistribute it and/or                  #
+# modify it under the terms of the GNU General Public License                    #
+# as published by the Free Software Foundation; either version 2                 #
+# of the License, or (at your option) any later version.                         #
+#                                                                                #
+# This program is distributed in the hope that it will be useful,                #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of                 #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                  #
+# GNU General Public License for more details.                                   #
+#                                                                                #
+# You should have received a copy of the GNU General Public License              #
+# along with this program; if not, write to the Free Software                    #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. #
+#                                                                                #
+# http://www.gnu.org/copyleft/gpl.html                                           #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# This software is part of BioDSL (www.BioDSL.org).                        #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+class TestKmer < Test::Unit::TestCase 
+  def setup
+    @entry = BioDSL::Seq.new(seq: "aNacCGactGAtacACGTAC")
+  end
+
+  test "#to_kmers without argument raises" do
+    assert_raise(ArgumentError) { @entry.to_kmers() }
+  end
+
+  test "#to_kmers without :kmer_size raises" do
+    assert_raise(BioDSL::KmerError) { @entry.to_kmers(step_size: 1) }
+  end
+
+  test "#to_kmers with bad :kmer_size raises" do
+    assert_raise(BioDSL::KmerError) { @entry.to_kmers(kmer_size: 0) }
+    assert_raise(BioDSL::KmerError) { @entry.to_kmers(kmer_size: 13) }
+  end
+
+  test "#to_kmers with OK :kmer_size don't raise" do
+    assert_nothing_raised { @entry.to_kmers(kmer_size: 1) }
+    assert_nothing_raised { @entry.to_kmers(kmer_size: 12) }
+  end
+
+  test "#to_kmers with bad :step_size raises" do
+    assert_raise(BioDSL::KmerError) { @entry.to_kmers(kmer_size: 8, step_size: 0) }
+    assert_raise(BioDSL::KmerError) { @entry.to_kmers(kmer_size: 8, step_size: 13) }
+  end
+
+  test "#to_kmers with OK :step_size don't raise" do
+    assert_nothing_raised { @entry.to_kmers(kmer_size: 8, step_size: 1) }
+    assert_nothing_raised { @entry.to_kmers(kmer_size: 8, step_size: 12) }
+  end
+
+  test "#to_kmers with bad :score_min raises" do
+    @entry.qual = "IIIIIIIII!IIIIIIIIII"
+    assert_raise(BioDSL::KmerError) { @entry.to_kmers(kmer_size: 8, score_min: -1) }
+    assert_raise(BioDSL::KmerError) { @entry.to_kmers(kmer_size: 8, score_min: 41) }
+  end
+
+  test "#to_kmers with OK :score_min don't raise" do
+    @entry.qual = "IIIIIIIII!IIIIIIIIII"
+    assert_nothing_raised { @entry.to_kmers(kmer_size: 8, score_min: 0) }
+    assert_nothing_raised { @entry.to_kmers(kmer_size: 8, score_min: 40) }
+  end
+
+  test "#to_kmers with kmer_size: 1 returns correctly" do
+    result = @entry.to_kmers(kmer_size: 1)
+    expected = [0, 1, 2, 3]
+    assert_equal(expected, result)
+  end
+
+  test "#to_kmers with kmer_size: 1 and step_size: 2 returns correctly" do
+    result = @entry.to_kmers(kmer_size: 1, step_size: 2)
+    expected = [0, 1, 2, 3]
+    assert_equal(expected, result)
+  end
+
+  test "#to_kmers with kmer_size: 5 returns correctly" do
+    result = @entry.to_kmers(kmer_size: 5)
+    expected = [72, 139, 156, 172, 180, 290, 452, 557, 625, 690, 713, 722, 786, 807]
+    assert_equal(expected, result)
+  end
+
+  test "#to_kmers with kmer_size: 5 and step_size: 2 returns correctly" do
+    result = @entry.to_kmers(kmer_size: 5, step_size: 2)
+    expected = [72, 139, 156, 172, 180, 452, 713]
+    assert_equal(expected, result)
+  end
+
+  test "#to_kmers with kmer_size: 1 and score_min: 20 returns correctly" do
+    @entry.qual = "IIIIIIIII!IIIIIIIIII"
+    result = @entry.to_kmers(kmer_size: 1, scores_min: 20)
+    expected = [0, 1, 2, 3]
+    assert_equal(expected, result)
+  end
+
+  test "#to_kmers with kmer_size: 1 and score_min: 20 and step_size: 2 returns correctly" do
+    @entry.qual = "IIIIIIIII!IIIIIIIIII"
+    result = @entry.to_kmers(kmer_size: 1, scores_min: 20, step_size: 2)
+    expected = [0, 1, 2, 3]
+    assert_equal(expected, result)
+  end
+
+  test "#to_kmers with kmer_size: 5 and score_min: 20 returns correctly" do
+    @entry.qual = "IIIIIIIII!IIIIIIIIII"
+    result = @entry.to_kmers(kmer_size: 5, scores_min: 20)
+    expected = [72, 139, 172, 180, 290, 557, 690, 713, 722]
+    assert_equal(expected, result)
+  end
+
+  test "#to_kmers with kmer_size: 5 and score_min: 20 and step_size: 2 returns correctly" do
+    @entry.qual = "IIIIIIIII!IIIIIIIIII"
+    result = @entry.to_kmers(kmer_size: 5, scores_min: 20, step_size: 2)
+    expected = [72, 139, 172, 180, 713]
+    assert_equal(expected, result)
+  end
+
+  test "Kmer#to_oligos return correctly" do
+    kmers = @entry.to_kmers(kmer_size: 5)
+    result = %w{ataca acacg actga accga acgta tacac tgata cacgt ctgat ccgac cgact cgtac gatac gactg}
+    assert_equal(result, BioDSL::Kmer.to_oligos(kmers, 5))
+  end
+end

data/test/BioDSL/seq/test_translate.rb

@@ -0,0 +1,75 @@
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                  #
+#                                                                                #
+# This program is free software; you can redistribute it and/or                  #
+# modify it under the terms of the GNU General Public License                    #
+# as published by the Free Software Foundation; either version 2                 #
+# of the License, or (at your option) any later version.                         #
+#                                                                                #
+# This program is distributed in the hope that it will be useful,                #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of                 #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                  #
+# GNU General Public License for more details.                                   #
+#                                                                                #
+# You should have received a copy of the GNU General Public License              #
+# along with this program; if not, write to the Free Software                    #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. #
+#                                                                                #
+# http://www.gnu.org/copyleft/gpl.html                                           #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# This software is part of BioDSL (www.BioDSL.org).                        #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+class TestTranslate < Test::Unit::TestCase 
+  def setup
+    @entry = BioDSL::Seq.new(seq: "atcgatcgatcgtacggttga", type: :dna)
+  end
+
+  test "#tranlate with bad type raises" do
+    @entry.type = nil
+    assert_raise(BioDSL::SeqError) { @entry.translate }
+  end
+
+  test "#tranlate with bad length raises" do
+    @entry.seq = "atcgatcgatcgtacggtga"
+    assert_raise(BioDSL::SeqError) { @entry.translate }
+  end
+
+  test "#tranlate with bad translation table raises" do
+    @entry.seq = "atcgatcgatcgtacggttga"
+    assert_raise(BioDSL::SeqError) { @entry.translate(0) }
+  end
+
+  test "#tranlate with bad start codon raises" do
+    @entry.seq = "ttagatcgatcgtacggttga"
+    assert_raise(BioDSL::SeqError) { @entry.translate }
+  end
+
+  test "#tranlate with bad codon raises" do
+    @entry.seq = "atggatcgaxxxtcgtacggttga"
+    assert_raise(BioDSL::SeqError) { @entry.translate }
+  end
+
+  test "#tranlate returns correctly" do
+    entry = @entry.translate
+    assert_equal("MDRSYG", entry.seq)
+    assert_equal(:protein, entry.type)
+    assert_equal("atcgatcgatcgtacggttga", @entry.seq)
+    assert_equal(:dna, @entry.type)
+  end
+
+  test "#tranlate! returns correctly" do
+    @entry.translate!
+    assert_equal("MDRSYG", @entry.seq)
+    assert_equal(:protein, @entry.type)
+  end
+end

data/test/BioDSL/seq/test_trim.rb

@@ -0,0 +1,101 @@
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                  #
+#                                                                                #
+# This program is free software; you can redistribute it and/or                  #
+# modify it under the terms of the GNU General Public License                    #
+# as published by the Free Software Foundation; either version 2                 #
+# of the License, or (at your option) any later version.                         #
+#                                                                                #
+# This program is distributed in the hope that it will be useful,                #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of                 #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                  #
+# GNU General Public License for more details.                                   #
+#                                                                                #
+# You should have received a copy of the GNU General Public License              #
+# along with this program; if not, write to the Free Software                    #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. #
+#                                                                                #
+# http://www.gnu.org/copyleft/gpl.html                                           #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                                #
+# This software is part of BioDSL (www.BioDSL.org).                        #
+#                                                                                #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+class TestTrim < Test::Unit::TestCase 
+  def setup
+    @entry      = BioDSL::Seq.new
+    #                2         3         44         3         2
+    #              8901234567890123456789009876543210987654321098
+    @entry.qual = "3456789:;<=>?@3BCDEFGHIIHGFEDCB3@?>=<;:9876543"
+    @entry.seq  = "abcdefghijklmnopqrstuvxxvutsrqponmlkjihgfedcba"
+  end
+
+  test "#quality_trim with nil seq raises" do
+    @entry.seq = nil
+    assert_raise(BioDSL::TrimError) { @entry.quality_trim(20, 1) }
+  end
+
+  test "#quality_trim with nil qual raises" do
+    @entry.qual = nil
+    assert_raise(BioDSL::TrimError) { @entry.quality_trim(20, 1) }
+  end
+
+  test "#quality_trim with bad min_qual raises" do
+    assert_raise(BioDSL::TrimError) { @entry.quality_trim(-1, 1) }
+    assert_raise(BioDSL::TrimError) { @entry.quality_trim(41, 1) }
+  end
+
+  test "#quality_trim with bad min_len raises" do
+    assert_raise(BioDSL::TrimError) { @entry.quality_trim(20, 0) }
+  end
+
+  test "#quality_trim returns correctly" do
+    trimmed = @entry.quality_trim(30, 3)
+    assert_equal("pqrstuvxxvutsrqp", trimmed.seq)
+    assert_equal("BCDEFGHIIHGFEDCB", trimmed.qual)
+    assert_equal("abcdefghijklmnopqrstuvxxvutsrqponmlkjihgfedcba", @entry.seq)
+    assert_equal("3456789:;<=>?@3BCDEFGHIIHGFEDCB3@?>=<;:9876543", @entry.qual)
+  end
+
+  test "#quality_trim! returns correctly" do
+    @entry.quality_trim!(30, 3)
+    assert_equal("pqrstuvxxvutsrqp", @entry.seq)
+    assert_equal("BCDEFGHIIHGFEDCB", @entry.qual)
+  end
+
+  test "#quality_trim_left returns correctly" do
+    trimmed = @entry.quality_trim_left(30, 3)
+    assert_equal("pqrstuvxxvutsrqponmlkjihgfedcba", trimmed.seq)
+    assert_equal("BCDEFGHIIHGFEDCB3@?>=<;:9876543", trimmed.qual)
+    assert_equal("abcdefghijklmnopqrstuvxxvutsrqponmlkjihgfedcba", @entry.seq)
+    assert_equal("3456789:;<=>?@3BCDEFGHIIHGFEDCB3@?>=<;:9876543", @entry.qual)
+  end
+
+  test "#quality_trim_left! returns correctly" do
+    @entry.quality_trim_left!(30, 3)
+    assert_equal("pqrstuvxxvutsrqponmlkjihgfedcba", @entry.seq)
+    assert_equal("BCDEFGHIIHGFEDCB3@?>=<;:9876543", @entry.qual)
+  end
+
+  test "#quality_trim_rigth returns correctly" do
+    trimmed = @entry.quality_trim_right(30, 3)
+    assert_equal("abcdefghijklmnopqrstuvxxvutsrqpo", trimmed.seq)
+    assert_equal("3456789:;<=>?@3BCDEFGHIIHGFEDCB3", trimmed.qual)
+    assert_equal("abcdefghijklmnopqrstuvxxvutsrqponmlkjihgfedcba", @entry.seq)
+    assert_equal("3456789:;<=>?@3BCDEFGHIIHGFEDCB3@?>=<;:9876543", @entry.qual)
+  end
+
+  test "#quality_trim_right! returns correctly" do
+    @entry.quality_trim_right!(30, 3)
+    assert_equal("abcdefghijklmnopqrstuvxxvutsrqpo", @entry.seq)
+    assert_equal("3456789:;<=>?@3BCDEFGHIIHGFEDCB3", @entry.qual)
+  end
+end