BioDSL 1.0.0

data/test/BioDSL/commands/test_filter_rrna.rb

@@ -0,0 +1,128 @@
+#!/usr/bin/env ruby
+$LOAD_PATH.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                #
+#                                                                              #
+# This program is free software; you can redistribute it and/or                #
+# modify it under the terms of the GNU General Public License                  #
+# as published by the Free Software Foundation; either version 2               #
+# of the License, or (at your option) any later version.                       #
+#                                                                              #
+# This program is distributed in the hope that it will be useful,              #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of               #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                #
+# GNU General Public License for more details.                                 #
+#                                                                              #
+# You should have received a copy of the GNU General Public License            #
+# along with this program; if not, write to the Free Software                  #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301,    #
+# USA.                                                                         #
+#                                                                              #
+# http://www.gnu.org/copyleft/gpl.html                                         #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# This software is part of BioDSL (www.github.com/maasha/BioDSL).              #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+# Test class for FilterRrna.
+class TestFilterRrna < Test::Unit::TestCase
+  def setup
+    @tmp_dir = Dir.mktmpdir('filter_rrna')
+
+    omit('sortmerna not found')   unless BioDSL::Filesys.which('sortmerna')
+    omit('indexdb_rna not found') unless BioDSL::Filesys.which('indexdb_rna')
+
+    setup_test_streams
+    setup_test_data
+    setup_fasta_file
+    setup_indexdb
+
+    @p = BioDSL::Pipeline.new
+  end
+
+  def setup_test_streams
+    @input, @output   = BioDSL::Stream.pipe
+    @input2, @output2 = BioDSL::Stream.pipe
+  end
+
+  def setup_test_data
+    @hash1 = {
+      SEQ_NAME: 'test1',
+      SEQ: 'gatcagatcgtacgagcagcatctgacgtatcgatcgttgattagttgctagctatgcag',
+      SEQ_LEN: 60
+    }
+
+    @hash2 = {
+      SEQ_NAME: 'test2',
+      SEQ: 'ggttagtcagcgactgactgactacgatatatatcgatacgcggaggtatatatagagag',
+      SEQ_LEN: 60
+    }
+
+    @output.write @hash1
+    @output.write @hash2
+    @output.close
+  end
+
+  def setup_fasta_file
+    @ref_fasta = File.join(@tmp_dir, 'test.fna')
+    @ref_index = "#{@ref_fasta}.idx"
+
+    BioDSL::Fasta.open(@ref_fasta, 'w') do |ios|
+      ios.puts BioDSL::Seq.new_bp(@hash1).to_fasta
+    end
+  end
+
+  def setup_indexdb
+    cmd = "indexdb_rna --ref #{@ref_fasta},#{@ref_index}"
+    system(cmd)
+
+    fail "Running command failed: #{cmd}" unless $CHILD_STATUS.success?
+  end
+
+  def teardown
+    FileUtils.rm_rf(@tmp_dir)
+  end
+
+  test 'BioDSL::Pipeline::FilterRrna with invalid options raises' do
+    assert_raise(BioDSL::OptionError) do
+      @p.filter_rrna(ref_fasta: __FILE__, ref_index: __FILE__, foo: 'bar')
+    end
+  end
+
+  test 'BioDSL::Pipeline::FilterRrna with valid options don\'t raise' do
+    assert_nothing_raised do
+      @p.filter_rrna(ref_fasta: __FILE__, ref_index: __FILE__)
+    end
+  end
+
+  test 'BioDSL::Pipeline::FilterRrna returns correctly' do
+    @p.filter_rrna(ref_fasta: @ref_fasta, ref_index: "#{@ref_index}*").
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+|\|/, '').delete("\n")
+      |{:SEQ_NAME=>"test2",
+      | :SEQ=>"ggttagtcagcgactgactgactacgatatatatcgatacgcggaggtatatatagagag",
+      | :SEQ_LEN=>60}
+    EXP
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::FilterRrna status returns correctly' do
+    @p.filter_rrna(ref_fasta: @ref_fasta, ref_index: "#{@ref_index}*").
+      run(input: @input, output: @output2)
+
+    assert_equal(2,   @p.status.first[:records_in])
+    assert_equal(1,   @p.status.first[:records_out])
+    assert_equal(2,   @p.status.first[:sequences_in])
+    assert_equal(1,   @p.status.first[:sequences_out])
+    assert_equal(120, @p.status.first[:residues_in])
+    assert_equal(60,  @p.status.first[:residues_out])
+  end
+end

data/test/BioDSL/commands/test_genecall.rb

@@ -0,0 +1,50 @@
+#!/usr/bin/env ruby
+$LOAD_PATH.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                #
+#                                                                              #
+# This program is free software; you can redistribute it and/or                #
+# modify it under the terms of the GNU General Public License                  #
+# as published by the Free Software Foundation; either version 2               #
+# of the License, or (at your option) any later version.                       #
+#                                                                              #
+# This program is distributed in the hope that it will be useful,              #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of               #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                #
+# GNU General Public License for more details.                                 #
+#                                                                              #
+# You should have received a copy of the GNU General Public License            #
+# along with this program; if not, write to the Free Software                  #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301,    #
+# USA.                                                                         #
+#                                                                              #
+# http://www.gnu.org/copyleft/gpl.html                                         #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# This software is part of BioDSL (www.github.com/maasha/BioDSL).              #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+# Test class for Genecall.
+class TestGenecall < Test::Unit::TestCase
+  def setup
+    omit('prodigal not found')     unless BioDSL::Filesys.which('ray')
+
+    @p = BioDSL::Pipeline.new
+  end
+
+  test 'BioDSL::Pipeline::Genecall with invalid options raises' do
+    assert_raise(BioDSL::OptionError) { @p.assemble_seq_ray(foo: 'bar') }
+  end
+
+  test 'BioDSL::Pipeline::Genecall with valid options don\'t raise' do
+    assert_nothing_raised { @p.assemble_seq_ray(cpus: 1) }
+  end
+
+  # FIXME: tests missing!
+end

data/test/BioDSL/commands/test_grab.rb

@@ -0,0 +1,398 @@
+#!/usr/bin/env ruby
+$LOAD_PATH.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                #
+#                                                                              #
+# This program is free software; you can redistribute it and/or                #
+# modify it under the terms of the GNU General Public License                  #
+# as published by the Free Software Foundation; either version 2               #
+# of the License, or (at your option) any later version.                       #
+#                                                                              #
+# This program is distributed in the hope that it will be useful,              #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of               #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                #
+# GNU General Public License for more details.                                 #
+#                                                                              #
+# You should have received a copy of the GNU General Public License            #
+# along with this program; if not, write to the Free Software                  #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301,    #
+# USA.                                                                         #
+#                                                                              #
+# http://www.gnu.org/copyleft/gpl.html                                         #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# This software is part of BioDSL (www.github.com/maasha/BioDSL).              #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+# Test class for the grab command.
+# rubocop:disable ClassLength
+class TestGrab < Test::Unit::TestCase
+  def setup
+    @tmpdir = Dir.mktmpdir('BioDSL')
+
+    @input, @output   = BioDSL::Stream.pipe
+    @input2, @output2 = BioDSL::Stream.pipe
+
+    write_stream
+    write_test_file1
+    write_test_file2
+
+    @p = BioDSL::Pipeline.new
+    @e = BioDSL::OptionError
+  end
+
+  def write_stream
+    @output.write(SEQ_NAME: 'test1', SEQ: 'atcg', SEQ_LEN: 4)
+    @output.write(SEQ_NAME: 'test2', SEQ: 'DSEQM', SEQ_LEN: 5)
+    @output.write(FOO: 'SEQ')
+    @output.close
+  end
+
+  def write_test_file1
+    @pattern_file  = File.join(@tmpdir, 'patterns.txt')
+
+    File.open(@pattern_file, 'w') do |ios|
+      ios.puts 'test'
+      ios.puts 'seq'
+    end
+  end
+
+  def write_test_file2
+    @pattern_file2 = File.join(@tmpdir, 'patterns2.txt')
+
+    File.open(@pattern_file2, 'w') do |ios|
+      ios.puts 4
+      ios.puts 'SEQ'
+    end
+  end
+
+  def teardown
+    FileUtils.rm_r @tmpdir
+  end
+
+  test 'BioDSL::Pipeline::Grab with invalid options raises' do
+    assert_raise(@e) { @p.grab(foo: 'bar') }
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and reject raises' do
+    assert_raise(@e) { @p.grab(select: 'foo', reject: 'bar') }
+  end
+
+  test 'BioDSL::Pipeline::Grab with keys_only and values_only raises' do
+    assert_raise(@e) do
+      @p.grab(select: 'foo', keys_only: true, values_only: true)
+    end
+  end
+
+  test 'BioDSL::Pipeline::Grab with evaluate and conflicting keys raises' do
+    assert_raise(@e) { @p.grab(evaluate: 0, select: 'foo') }
+    assert_raise(@e) { @p.grab(evaluate: 0, reject: 'foo') }
+    assert_raise(@e) { @p.grab(evaluate: 0, keys: 'foo') }
+    assert_raise(@e) { @p.grab(evaluate: 0, keys_only: true) }
+    assert_raise(@e) { @p.grab(evaluate: 0, values_only: true) }
+    assert_raise(@e) { @p.grab(evaluate: 0, ignore_case: true) }
+    assert_raise(@e) { @p.grab(evaluate: 0, exact: true) }
+  end
+
+  test 'BioDSL::Pipeline::Grab with missing select_file raises' do
+    assert_raise(@e) { @p.grab(select_file: '___select') }
+  end
+
+  test 'BioDSL::Pipeline::Grab with missing reject_file raises' do
+    assert_raise(@e) { @p.grab(reject_file: '___reject') }
+  end
+
+  test 'BioDSL::Pipeline::Grab#to_s with select and symbol key return OK' do
+    @p.grab(select: :SEQ_NAME)
+    expected = 'BP.new.grab(select: :SEQ_NAME)'
+    assert_equal(expected, @p.to_s)
+  end
+
+  test 'BioDSL::Pipeline::Grab with no hits return OK' do
+    @p.grab(select: 'fish').run(input: @input, output: @output2)
+    assert_equal('', collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and key hit return OK' do
+    @p.grab(select: 'SEQ_NAME').run(input: @input, output: @output2)
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+    EXP
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab status returns correctly' do
+    @p.grab(select: 'SEQ_NAME').run(input: @input, output: @output2)
+
+    assert_equal(3, @p.status.first[:records_in])
+    assert_equal(2, @p.status.first[:records_out])
+  end
+
+  test 'BioDSL::Pipeline::Grab with multiple select patterns return OK' do
+    @p.grab(select: %w(est1 QM)).run(input: @input, output: @output2)
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+    EXP
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with multiple reject patterns return OK' do
+    @p.grab(reject: %w(est QM)).run(input: @input, output: @output2)
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject and key hit return OK' do
+    @p.grab(reject: 'SEQ_NAME').run(input: @input, output: @output2)
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject with symbol return OK' do
+    @p.grab(reject: :SEQ_NAME).run(input: @input, output: @output2)
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and value hit return OK' do
+    @p.grab(select: 'test1').run(input: @input, output: @output2)
+    expected = %({:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject and value hit return OK' do
+    @p.grab(reject: 'test1').run(input: @input, output: @output2)
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+      |{:FOO=>"SEQ"}
+    EXP
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and keys_only return OK' do
+    @p.grab(select: 'SEQ', keys_only: true).run(input: @input, output: @output2)
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+    EXP
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject and keys_only return OK' do
+    @p.grab(reject: 'SEQ', keys_only: true).run(input: @input, output: @output2)
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and values_only return OK' do
+    @p.grab(select: 'SEQ', values_only: true).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+      |{:FOO=>"SEQ"}
+    EXP
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject and values_only return OK' do
+    @p.grab(reject: 'SEQ', values_only: true).
+      run(input: @input, output: @output2)
+
+    expected = %({:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select and values_only and ^ return OK' do
+    @p.grab(select: '^SEQ', values_only: true).
+      run(input: @input, output: @output2)
+
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. reject and values_only and ^ return OK' do
+    @p.grab(reject: '^SEQ', values_only: true).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+    EXP
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and ignore_case return OK' do
+    @p.grab(select: 'ATCG', ignore_case: true).
+      run(input: @input, output: @output2)
+
+    expected = %({:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject and ignore_case return OK' do
+    @p.grab(reject: 'ATCG', ignore_case: true).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+      |{:FOO=>"SEQ"}
+    EXP
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and specified keys return OK' do
+    @p.grab(select: 'SEQ', keys: :FOO).run(input: @input, output: @output2)
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select and keys in Array return OK' do
+    @p.grab(select: 'SEQ', values_only: true, keys: [:FOO, :SEQ]).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+      |{:FOO=>"SEQ"}
+    EXP
+
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select and keys in String return OK' do
+    @p.grab(select: 'SEQ', values_only: true, keys: ':FOO, :SEQ').
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+      |{:FOO=>"SEQ"}
+    EXP
+
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject and specified keys return OK' do
+    @p.grab(reject: 'SEQ', keys: :FOO).run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+    EXP
+
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with evaluate return OK' do
+    @p.grab(evaluate: ':SEQ_LEN > 4').run(input: @input, output: @output2)
+
+    expected = %({:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with select_file return OK' do
+    @p.grab(select_file: @pattern_file).run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}
+      |{:SEQ_NAME=>"test2", :SEQ=>"DSEQM", :SEQ_LEN=>5}
+    EXP
+
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select and exact w/o match return OK' do
+    @p.grab(select: 'tcg', exact: true).run(input: @input, output: @output2)
+
+    assert_equal('', collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select and exact match return OK' do
+    @p.grab(select: 'atcg', exact: true).run(input: @input, output: @output2)
+
+    expected = %({:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select and exact number match return OK' do
+    @p.grab(select: 4, exact: true).run(input: @input, output: @output2)
+
+    expected = %({:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select, exact number and keys_only OK' do
+    @p.grab(select: 4, exact: true, keys_only: true).
+      run(input: @input, output: @output2)
+
+    assert_equal('', collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select, exact number and values_only OK' do
+    @p.grab(select: 4, exact: true, values_only: true).
+      run(input: @input, output: @output2)
+
+    expected = %({:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select, exact, keys and no match OK' do
+    @p.grab(select: 'atcg', exact: true, keys: :SEQ_LEN).
+      run(input: @input, output: @output2)
+
+    assert_equal('', collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select, exact, keys and match return OK' do
+    @p.grab(select: 'atcg', exact: true, keys: :SEQ).
+      run(input: @input, output: @output2)
+
+    expected = %({:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select, exact, keys_only and no match ' \
+       'return OK' do
+    @p.grab(select: 'atcg', exact: true, keys_only: true).
+      run(input: @input, output: @output2)
+
+    assert_equal('', collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select, exact, keys_only and String ' \
+       'match return OK' do
+    @p.grab(select: 'FOO', exact: true, keys_only: true).
+      run(input: @input, output: @output2)
+
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab w. select, exact, keys_only and Symbol ' \
+       'match return OK' do
+    @p.grab(select: :FOO, exact: true, keys_only: true).
+      run(input: @input, output: @output2)
+
+    expected = %({:FOO=>"SEQ"}\n)
+    assert_equal(expected, collect_result)
+  end
+
+  test 'BioDSL::Pipeline::Grab with reject_file return OK' do
+    @p.grab(reject_file: @pattern_file2, values_only: true, keys: :SEQ).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ_NAME=>"test1", :SEQ=>"atcg", :SEQ_LEN=>4}
+      |{:FOO=>"SEQ"}
+    EXP
+
+    assert_equal(expected, collect_result)
+  end
+end

data/test/BioDSL/commands/test_index_taxonomy.rb

@@ -0,0 +1,62 @@
+#!/usr/bin/env ruby
+$LOAD_PATH.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                #
+#                                                                              #
+# This program is free software; you can redistribute it and/or                #
+# modify it under the terms of the GNU General Public License                  #
+# as published by the Free Software Foundation; either version 2               #
+# of the License, or (at your option) any later version.                       #
+#                                                                              #
+# This program is distributed in the hope that it will be useful,              #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of               #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                #
+# GNU General Public License for more details.                                 #
+#                                                                              #
+# You should have received a copy of the GNU General Public License            #
+# along with this program; if not, write to the Free Software                  #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301,    #
+# USA.                                                                         #
+#                                                                              #
+# http://www.gnu.org/copyleft/gpl.html                                         #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# This software is part of BioDSL (www.github.com/maasha/BioDSL).              #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+# Test class for IndexTaxonomy.
+class TestIndexTaxonomy < Test::Unit::TestCase
+  def setup
+    @tmpdir = Dir.mktmpdir('BioDSL')
+
+    @input, @output   = BioDSL::Stream.pipe
+    @input2, @output2 = BioDSL::Stream.pipe
+
+    @p = BioDSL::Pipeline.new
+  end
+
+  def teardown
+    FileUtils.rm_r @tmpdir
+  end
+
+  test 'BioDSL::Pipeline::IndexTaxonomy with invalid options raises' do
+    assert_raise(BioDSL::OptionError) do
+      @p.index_taxonomy(output_dir: @tmpdir, foo: 'bar')
+    end
+  end
+
+  test 'BioDSL::Pipeline::IndexTaxonomy with valid options don\'t raise' do
+    assert_nothing_raised do
+      @p.index_taxonomy(output_dir: @tmpdir, kmer_size: 8, step_size: 1,
+                        prefix: 'foo')
+    end
+  end
+
+  # TODO: write some tests!
+end