BioDSL 1.0.0

data/test/BioDSL/commands/test_trim_primer.rb

@@ -0,0 +1,329 @@
+#!/usr/bin/env ruby
+$LOAD_PATH.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                #
+#                                                                              #
+# This program is free software; you can redistribute it and/or                #
+# modify it under the terms of the GNU General Public License                  #
+# as published by the Free Software Foundation; either version 2               #
+# of the License, or (at your option) any later version.                       #
+#                                                                              #
+# This program is distributed in the hope that it will be useful,              #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of               #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                #
+# GNU General Public License for more details.                                 #
+#                                                                              #
+# You should have received a copy of the GNU General Public License            #
+# along with this program; if not, write to the Free Software                  #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301,    #
+# USA.                                                                         #
+#                                                                              #
+# http://www.gnu.org/copyleft/gpl.html                                         #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# This software is part of BioDSL (www.github.com/maasha/BioDSL).              #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+# Test class for TrimPrimer.
+#
+# rubocop: disable ClassLength
+class TestTrimPrimer < Test::Unit::TestCase
+  def setup
+    @input, @output   = BioDSL::Stream.pipe
+    @input2, @output2 = BioDSL::Stream.pipe
+
+    @p = BioDSL::Pipeline.new
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with invalid options raises' do
+    assert_raise(BioDSL::OptionError) { @p.trim_primer(foo: 'bar') }
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with valid options dont raise' do
+    assert_nothing_raised do
+      @p.trim_primer(primer: 'atcg', direction: :forward)
+    end
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with forward and pattern longer than ' \
+    'sequence returns correctly' do
+    @output.write(SEQ: 'TATG')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :forward, overlap_min: 1).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"",
+      | :SEQ_LEN=>0,
+      | :TRIM_PRIMER_DIR=>"FORWARD",
+      | :TRIM_PRIMER_POS=>0,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TATG"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with reverse and pattern longer than ' \
+    'sequence returns correctly' do
+    @output.write(SEQ: 'TCGT')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :reverse, overlap_min: 1).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"",
+      | :SEQ_LEN=>0,
+      | :TRIM_PRIMER_DIR=>"REVERSE",
+      | :TRIM_PRIMER_POS=>0,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TCGT"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with forward and internal match ' \
+    'returns correctly' do
+    @output.write(SEQ: 'aTCGTATGactgactgatcgca')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :forward).
+      run(input: @input, output: @output2)
+
+    expected = '{:SEQ=>"aTCGTATGactgactgatcgca"}'
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with reverse and internal match ' \
+    'returns correctly' do
+    @output.write(SEQ: 'ctgactgatcgcaaTCGTATGa')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :reverse).
+      run(input: @input, output: @output2)
+
+    expected = '{:SEQ=>"ctgactgatcgcaaTCGTATGa"}'
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer w. forward and full match returns OK' do
+    @output.write(SEQ: 'TCGTATGactgactgatcgca')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :forward).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"actgactgatcgca",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"FORWARD",
+      | :TRIM_PRIMER_POS=>0,
+      | :TRIM_PRIMER_LEN=>7,
+      | :TRIM_PRIMER_PAT=>"TCGTATG"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer w. reverse and full match returns OK' do
+    @output.write(SEQ: 'ctgactgatcgcaaTCGTATG')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :reverse).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"ctgactgatcgcaa",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"REVERSE",
+      | :TRIM_PRIMER_POS=>14,
+      | :TRIM_PRIMER_LEN=>7,
+      | :TRIM_PRIMER_PAT=>"TCGTATG"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer w. forward and partial match returns ' \
+    'correctly' do
+    @output.write(SEQ: 'TATGactgactgatcgca')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :forward).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"actgactgatcgca",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"FORWARD",
+      | :TRIM_PRIMER_POS=>0,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TATG"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with forward and partial match and ' \
+    'reverse_complment: true returns correctly' do
+    @output.write(SEQ: 'TATGactgactgatcgca')
+    @output.close
+    @p.trim_primer(primer: 'CATACGA', direction: :forward,
+                   reverse_complement: true).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"actgactgatcgca",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"FORWARD",
+      | :TRIM_PRIMER_POS=>0,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TATG"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer w. reverse and partial match returns ' \
+    'correctly' do
+    @output.write(SEQ: 'ctgactgatcgcaaTCGT')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :reverse).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"ctgactgatcgcaa",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"REVERSE",
+      | :TRIM_PRIMER_POS=>14,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TCGT"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with reverse and partial match and ' \
+    'reverse_complment: true returns correctly' do
+    @output.write(SEQ: 'ctgactgatcgcaaTCGT')
+    @output.close
+    @p.trim_primer(primer: 'CATACGA', direction: :reverse,
+                   reverse_complement: true).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"ctgactgatcgcaa",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"REVERSE",
+      | :TRIM_PRIMER_POS=>14,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TCGT"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with forward and minimum match ' \
+    'returns correctly' do
+    @output.write(SEQ: 'Gactgactgatcgca')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :forward).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"actgactgatcgca",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"FORWARD",
+      | :TRIM_PRIMER_POS=>0,
+      | :TRIM_PRIMER_LEN=>1,
+      | :TRIM_PRIMER_PAT=>"G"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with reverse and minimum match ' \
+    'returns correctly' do
+    @output.write(SEQ: 'ctgactgatcgcaaT')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :reverse).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"ctgactgatcgcaa",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"REVERSE",
+      | :TRIM_PRIMER_POS=>14,
+      | :TRIM_PRIMER_LEN=>1,
+      | :TRIM_PRIMER_PAT=>"T"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with forward and partial match and ' \
+    'overlap_min returns correctly' do
+    @output.write(SEQ: 'TATGactgactgatcgca')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :forward, overlap_min: 4).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"actgactgatcgca",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"FORWARD",
+      | :TRIM_PRIMER_POS=>0,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TATG"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with reverse and partial match and ' \
+    'overlap_min returns correctly' do
+    @output.write(SEQ: 'ctgactgatcgcaaTCGT')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :reverse, overlap_min: 4).
+      run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:SEQ=>"ctgactgatcgcaa",
+      | :SEQ_LEN=>14,
+      | :TRIM_PRIMER_DIR=>"REVERSE",
+      | :TRIM_PRIMER_POS=>14,
+      | :TRIM_PRIMER_LEN=>4,
+      | :TRIM_PRIMER_PAT=>"TCGT"}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with forward and partial miss due ' \
+    'to overlap_min returns correctly' do
+    @output.write(SEQ: 'TATGactgactgatcgca')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :forward, overlap_min: 5).
+      run(input: @input, output: @output2)
+
+    expected = '{:SEQ=>"TATGactgactgatcgca"}'
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::TrimPrimer with reverse and partial miss due ' \
+    'to overlap_min returns correctly' do
+    @output.write(SEQ: 'ctgactgatcgcaaTCGT')
+    @output.close
+    @p.trim_primer(primer: 'TCGTATG', direction: :reverse, overlap_min: 5).
+      run(input: @input, output: @output2)
+
+    expected = '{:SEQ=>"ctgactgatcgcaaTCGT"}'
+
+    assert_equal(expected, collect_result.chomp)
+  end
+end

data/test/BioDSL/commands/test_trim_seq.rb

@@ -0,0 +1,150 @@
+#!/usr/bin/env ruby
+$LOAD_PATH.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                #
+#                                                                              #
+# This program is free software; you can redistribute it and/or                #
+# modify it under the terms of the GNU General Public License                  #
+# as published by the Free Software Foundation; either version 2               #
+# of the License, or (at your option) any later version.                       #
+#                                                                              #
+# This program is distributed in the hope that it will be useful,              #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of               #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                #
+# GNU General Public License for more details.                                 #
+#                                                                              #
+# You should have received a copy of the GNU General Public License            #
+# along with this program; if not, write to the Free Software                  #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301,    #
+# USA.                                                                         #
+#                                                                              #
+# http://www.gnu.org/copyleft/gpl.html                                         #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# This software is part of BioDSL (www.github.com/maasha/BioDSL).              #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+# Test class for TrimSeq.
+class TestTrimSeq < Test::Unit::TestCase
+  def setup
+    @input, @output   = BioDSL::Stream.pipe
+    @input2, @output2 = BioDSL::Stream.pipe
+
+    hash = {
+      SEQ_NAME: 'test',
+
+      SEQ: 'gatcgatcgtacgagcagcatctgacgtatcgatcgttgtctacgacgagcatgctagctag',
+      SEQ_LEN: 42,
+      SCORES: %q[!"#$%&'()*+,-./0123456789:;<=>?@ABCDEF876543210/.-,+*)('&%$III]
+    }
+
+    @output.write hash
+    @output.close
+
+    @p = BioDSL::Pipeline.new
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq with invalid options raises' do
+    assert_raise(BioDSL::OptionError) { @p.trim_seq(foo: 'bar') }
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq with valid options don\'t raise' do
+    assert_nothing_raised { @p.trim_seq(mode: :left) }
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq returns correctly' do
+    @p.trim_seq.run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '').tr("\n", ' ')[0..-2]
+      |{:SEQ_NAME=>"test",
+      |:SEQ=>"tctgacgtatcgatcgttgtctacgacgagcatgctagctag",
+      |:SEQ_LEN=>42,
+      |:SCORES=>"56789:;<=>?@ABCDEF876543210/.-,+*)('&%$III"}
+    EXP
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq status returns correctly' do
+    @p.trim_seq.run(input: @input, output: @output2)
+
+    assert_equal(1,  @p.status.first[:records_in])
+    assert_equal(1,  @p.status.first[:records_out])
+    assert_equal(1,  @p.status.first[:sequences_in])
+    assert_equal(1,  @p.status.first[:sequences_out])
+    assert_equal(62, @p.status.first[:residues_in])
+    assert_equal(42, @p.status.first[:residues_out])
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq with :quality_min returns correctly' do
+    @p.trim_seq(quality_min: 25).run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '').tr("\n", ' ')[0..-2]
+      |{:SEQ_NAME=>"test",
+      |:SEQ=>"cgtatcgatcgttgtctacgacgagcatgctagctag",
+      |:SEQ_LEN=>37,
+      |:SCORES=>":;<=>?@ABCDEF876543210/.-,+*)('&%$III"}
+    EXP
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq with mode: both: returns correctly' do
+    @p.trim_seq(mode: :both).run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '').tr("\n", ' ')[0..-2]
+      |{:SEQ_NAME=>"test",
+      |:SEQ=>"tctgacgtatcgatcgttgtctacgacgagcatgctagctag",
+      |:SEQ_LEN=>42,
+      |:SCORES=>"56789:;<=>?@ABCDEF876543210/.-,+*)('&%$III"}
+    EXP
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq with mode: :left returns correctly' do
+    @p.trim_seq(mode: :left).run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '').tr("\n", ' ')[0..-2]
+      |{:SEQ_NAME=>"test",
+      |:SEQ=>"tctgacgtatcgatcgttgtctacgacgagcatgctagctag",
+      |:SEQ_LEN=>42,
+      |:SCORES=>"56789:;<=>?@ABCDEF876543210/.-,+*)('&%$III"}
+    EXP
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  # rubocop:disable LineLength
+  test 'BioDSL::Pipeline::TrimSeq with mode: :right returns correctly' do
+    @p.trim_seq(mode: :right).run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '').tr("\n", ' ')[0..-2]
+      |{:SEQ_NAME=>"test",
+      |:SEQ=>"gatcgatcgtacgagcagcatctgacgtatcgatcgttgtctacgacgagcatgctagctag",
+      |:SEQ_LEN=>62,
+      |:SCORES=>"!\\"\\#\$%&'()*+,-./0123456789:;<=>?@ABCDEF876543210/.-,+*)('&%$III"}
+    EXP
+
+    assert_equal(expected, collect_result.chomp)
+  end
+
+  test 'BioDSL::Pipeline::TrimSeq with :length_min returns correctly' do
+    @p.trim_seq(length_min: 4).run(input: @input, output: @output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '').tr("\n", ' ')[0..-2]
+      |{:SEQ_NAME=>"test",
+      |:SEQ=>"tctgacgtatcgatcgttgtct",
+      |:SEQ_LEN=>22,
+      |:SCORES=>"56789:;<=>?@ABCDEF8765"}
+    EXP
+
+    assert_equal(expected, collect_result.chomp)
+  end
+end

data/test/BioDSL/commands/test_uchime_ref.rb

@@ -0,0 +1,113 @@
+#!/usr/bin/env ruby
+$LOAD_PATH.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# Copyright (C) 2007-2015 Martin Asser Hansen (mail@maasha.dk).                #
+#                                                                              #
+# This program is free software; you can redistribute it and/or                #
+# modify it under the terms of the GNU General Public License                  #
+# as published by the Free Software Foundation; either version 2               #
+# of the License, or (at your option) any later version.                       #
+#                                                                              #
+# This program is distributed in the hope that it will be useful,              #
+# but WITHOUT ANY WARRANTY; without even the implied warranty of               #
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the                #
+# GNU General Public License for more details.                                 #
+#                                                                              #
+# You should have received a copy of the GNU General Public License            #
+# along with this program; if not, write to the Free Software                  #
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301,    #
+# USA.                                                                         #
+#                                                                              #
+# http://www.gnu.org/copyleft/gpl.html                                         #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+#                                                                              #
+# This software is part of BioDSL (www.github.com/maasha/BioDSL).              #
+#                                                                              #
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< #
+
+require 'test/helper'
+
+# Test class for UchimeRef.
+class TestUchimeRef < Test::Unit::TestCase
+  require 'tempfile'
+
+  def setup
+    omit('usearch not found') unless BioDSL::Filesys.which('usearch')
+
+    data = <<-DAT.gsub(/^\s+\|/, '')
+      |>test1
+      |gtgtgtagctacgatcagctagcgatcgagctatatgttt
+    DAT
+
+    @db = Tempfile.new('database')
+
+    File.open(@db, 'w') do |ios|
+      ios << data
+    end
+  end
+
+  def teardown
+    @db.close
+    @db.unlink
+  end
+
+  test 'BioDSL::Pipeline#uchime_ref with disallowed option raises' do
+    p = BioDSL::Pipeline.new
+    assert_raise(BioDSL::OptionError) { p.uchime_ref(foo: 'bar') }
+  end
+
+  test 'BioDSL::Pipeline#uchime_ref with allowed option dont raise' do
+    p = BioDSL::Pipeline.new
+    assert_nothing_raised { p.uchime_ref(database: @db.path) }
+  end
+
+  test 'BioDSL::Pipeline#uchime_ref outputs correctly' do
+    input, output   = BioDSL::Stream.pipe
+    @input2, output2 = BioDSL::Stream.pipe
+
+    output.write(one: 1, two: 2, three: 3)
+    output.write(SEQ_COUNT: 5, SEQ: 'atcgaAcgatcgatcgatcgatcgatcgtacgacgtagct')
+    output.write(SEQ_COUNT: 4, SEQ: 'atcgatcgatcgatcgatcgatcgatcgtacgacgtagct')
+    output.close
+
+    p = BioDSL::Pipeline.new
+    p.uchime_ref(database: @db.path).run(input: input, output: output2)
+
+    expected = <<-EXP.gsub(/^\s+\|/, '')
+      |{:one=>1,
+      | :two=>2,
+      | :three=>3}
+      |{:SEQ_NAME=>"1",
+      | :SEQ=>"atcgaAcgatcgatcgatcgatcgatcgtacgacgtagct",
+      | :SEQ_LEN=>40}
+      |{:SEQ_NAME=>"2",
+      | :SEQ=>"atcgatcgatcgatcgatcgatcgatcgtacgacgtagct",
+      | :SEQ_LEN=>40}
+    EXP
+
+    assert_equal(expected.delete("\n"), collect_result.delete("\n"))
+  end
+
+  test 'BioDSL::Pipeline#uchime_ref status outputs correctly' do
+    input, output   = BioDSL::Stream.pipe
+    @input2, output2 = BioDSL::Stream.pipe
+
+    output.write(one: 1, two: 2, three: 3)
+    output.write(SEQ_COUNT: 5, SEQ: 'atcgaAcgatcgatcgatcgatcgatcgtacgacgtagct')
+    output.write(SEQ_COUNT: 4, SEQ: 'atcgatcgatcgatcgatcgatcgatcgtacgacgtagct')
+    output.close
+
+    p = BioDSL::Pipeline.new
+    p.uchime_ref(database: @db.path).run(input: input, output: output2)
+
+    assert_equal(3,  p.status.first[:records_in])
+    assert_equal(3,  p.status.first[:records_out])
+    assert_equal(2,  p.status.first[:sequences_in])
+    assert_equal(2,  p.status.first[:sequences_out])
+    assert_equal(80, p.status.first[:residues_in])
+    assert_equal(80, p.status.first[:residues_out])
+  end
+end