benchling-v3-sdk-python 5.0.0__py3-none-any.whl

benchling_v3_sdk/rna_sequence/client.py

@@ -0,0 +1,2698 @@
+# This file was auto-generated by Fern from our API Definition.
+
+import typing
+
+from ..core.client_wrapper import AsyncClientWrapper, SyncClientWrapper
+from ..core.pagination import AsyncPager, SyncPager
+from ..core.request_options import RequestOptions
+from ..types.async_task_link import AsyncTaskLink
+from ..types.create_rna_sequence_input import CreateRnaSequenceInput
+from ..types.create_rna_sequence_input_naming_strategy import CreateRnaSequenceInputNamingStrategy
+from ..types.field_value_input import FieldValueInput
+from ..types.modified_nucleotide import ModifiedNucleotide
+from ..types.modified_nucleotide_paginated_list import ModifiedNucleotidePaginatedList
+from ..types.nucleotide_alignment_unpaginated_list import NucleotideAlignmentUnpaginatedList
+from ..types.nucleotide_annotation import NucleotideAnnotation
+from ..types.nucleotide_annotation_paginated_list import NucleotideAnnotationPaginatedList
+from ..types.primer import Primer
+from ..types.primer_input import PrimerInput
+from ..types.primer_paginated_list import PrimerPaginatedList
+from ..types.principal_unpaginated_list import PrincipalUnpaginatedList
+from ..types.rna_annotation_input import RnaAnnotationInput
+from ..types.rna_part import RnaPart
+from ..types.rna_part_input import RnaPartInput
+from ..types.rna_part_paginated_list import RnaPartPaginatedList
+from ..types.rna_sequence import RnaSequence
+from ..types.rna_sequence_paginated_list import RnaSequencePaginatedList
+from ..types.rna_translation_input import RnaTranslationInput
+from ..types.translation import Translation
+from ..types.translation_paginated_list import TranslationPaginatedList
+from ..types.update_rna_sequence_input_with_path_params import UpdateRnaSequenceInputWithPathParams
+from .raw_client import AsyncRawRnaSequenceClient, RawRnaSequenceClient
+from .types.batch_create_rna_sequence_response import BatchCreateRnaSequenceResponse
+from .types.batch_update_rna_sequence_response import BatchUpdateRnaSequenceResponse
+from .types.list_rna_sequence_request_sort import ListRnaSequenceRequestSort
+from .types.update_rna_sequence_input_naming_strategy import UpdateRnaSequenceInputNamingStrategy
+
+# this is used as the default value for optional parameters
+OMIT = typing.cast(typing.Any, ...)
+
+
+class RnaSequenceClient:
+    def __init__(self, *, client_wrapper: SyncClientWrapper):
+        self._raw_client = RawRnaSequenceClient(client_wrapper=client_wrapper)
+
+    @property
+    def with_raw_response(self) -> RawRnaSequenceClient:
+        """
+        Retrieves a raw implementation of this client that returns raw responses.
+
+        Returns
+        -------
+        RawRnaSequenceClient
+        """
+        return self._raw_client
+
+    def create(
+        self,
+        *,
+        folder_id: str,
+        name: str,
+        aliases: typing.Optional[typing.Sequence[str]] = OMIT,
+        annotations: typing.Optional[typing.Sequence[RnaAnnotationInput]] = OMIT,
+        author_ids: typing.Optional[typing.Sequence[str]] = OMIT,
+        bases: typing.Optional[str] = OMIT,
+        custom_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        custom_notation: typing.Optional[str] = OMIT,
+        custom_notation_id: typing.Optional[str] = OMIT,
+        entity_registry_id: typing.Optional[str] = OMIT,
+        helm: typing.Optional[str] = OMIT,
+        naming_strategy: typing.Optional[CreateRnaSequenceInputNamingStrategy] = OMIT,
+        parts: typing.Optional[typing.Sequence[RnaPartInput]] = OMIT,
+        primers: typing.Optional[typing.Sequence[PrimerInput]] = OMIT,
+        registry_id: typing.Optional[str] = OMIT,
+        schema_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        schema_id: typing.Optional[str] = OMIT,
+        translations: typing.Optional[typing.Sequence[RnaTranslationInput]] = OMIT,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> RnaSequence:
+        """
+        Create an RNA sequence in a folder. `name` and `folderId` are required.
+
+        ## Sequence specification
+
+        Provide exactly one of the following:
+        - `bases` — plain nucleotide sequence
+        - `helm` — HELM notation (requires the modified nucleotides feature to be enabled)
+        - `customNotation` with `customNotationId` — vendor-specific notation (requires custom syntaxes to be enabled; both fields must be set together)
+
+        Parameters
+        ----------
+        folder_id : str
+
+        name : str
+            Name of the item.
+
+        aliases : typing.Optional[typing.Sequence[str]]
+            Array of aliases
+
+        annotations : typing.Optional[typing.Sequence[RnaAnnotationInput]]
+            Annotations on the RNA sequence, not including translations or primers. Annotations on parts are
+            not included.
+
+        author_ids : typing.Optional[typing.Sequence[str]]
+
+        bases : typing.Optional[str]
+            Bases of the RNA sequence. Mutually exclusive with `helm` and `customNotation`.
+
+        custom_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+            Custom fields set on the RNA sequence.
+
+        custom_notation : typing.Optional[str]
+            Sequence in a vendor-specific custom notation syntax. Requires custom syntaxes to be enabled. When `customNotation` is set, `customNotationId` is required. Mutually exclusive with `bases` and `helm`.
+
+        custom_notation_id : typing.Optional[str]
+            ID of the custom notation syntax used to interpret `customNotation`. When `customNotation` is set, `customNotationId` is required; omit both when using `bases` or `helm`.
+
+        entity_registry_id : typing.Optional[str]
+            Registry ID to assign to the entity. If one is specified, the labeling_strategy must be unspecified.
+
+        helm : typing.Optional[str]
+            HELM notation for the RNA sequence and chemical modifications. Requires the modified nucleotides feature to be enabled. Mutually exclusive with `bases` and `customNotation`.
+
+        naming_strategy : typing.Optional[CreateRnaSequenceInputNamingStrategy]
+            Strategy to use for labeling the item in the registry. If one is specified, the entity_registry_id must be unspecified.
+
+        parts : typing.Optional[typing.Sequence[RnaPartInput]]
+            Part features linking regions of this sequence to other RNA sequences.
+
+        primers : typing.Optional[typing.Sequence[PrimerInput]]
+            Primer bind features on the RNA sequence. Primers on parts are not included.
+
+        registry_id : typing.Optional[str]
+            A not null value means the entity should be registered. If not null, the value must match the registry of the item's schema.
+
+        schema_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+
+        schema_id : typing.Optional[str]
+
+        translations : typing.Optional[typing.Sequence[RnaTranslationInput]]
+            Translation annotations present on the RNA sequence. Translations may be one region or split
+            across multiple regions. Translations on parts are not included.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        RnaSequence
+            Created
+
+        Examples
+        --------
+        from benchling_v3_sdk import (
+            Benchling,
+            CustomFieldInput,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+        )
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.create(
+            annotations=[
+                RnaAnnotationInput(
+                    color="#FF6B6B",
+                    end=8,
+                    name="Target region",
+                    notes="Gene silencing target",
+                    start=2,
+                    type="target",
+                )
+            ],
+            bases="AUCGAUCGAUCGAUCGAUCGAU",
+            folder_id="lib_o2thOLlq",
+            name="CRISPR guide RNA",
+            parts=[
+                RnaPartInput(
+                    end=4,
+                    sequence_id="seq_jdf8BV24",
+                    start=0,
+                )
+            ],
+            primers=[
+                PrimerInput(
+                    location=LocationInput(
+                        location_type="start_and_end",
+                        end=4,
+                        start=0,
+                    ),
+                    oligo_id="seq_laGnl8vB",
+                    strand="FORWARD",
+                )
+            ],
+            schema_fields={
+                "application": FieldValueInput(
+                    value="CRISPR",
+                ),
+                "target_gene": FieldValueInput(
+                    value="BRCA1",
+                ),
+            },
+            schema_id="ts_ztQQGSSF",
+            translations=[
+                RnaTranslationInput(
+                    custom_fields=[
+                        CustomFieldInput(
+                            name="reading_frame",
+                            value="1",
+                        )
+                    ],
+                    genetic_code="STANDARD",
+                    name="ORF fragment",
+                    regions=[
+                        TranslationRegionInput(
+                            end=7,
+                            start=1,
+                        )
+                    ],
+                    translate_first_codon_to_methionine=True,
+                )
+            ],
+        )
+        """
+        _response = self._raw_client.create(
+            folder_id=folder_id,
+            name=name,
+            aliases=aliases,
+            annotations=annotations,
+            author_ids=author_ids,
+            bases=bases,
+            custom_fields=custom_fields,
+            custom_notation=custom_notation,
+            custom_notation_id=custom_notation_id,
+            entity_registry_id=entity_registry_id,
+            helm=helm,
+            naming_strategy=naming_strategy,
+            parts=parts,
+            primers=primers,
+            registry_id=registry_id,
+            schema_fields=schema_fields,
+            schema_id=schema_id,
+            translations=translations,
+            request_options=request_options,
+        )
+        return _response.data
+
+    def list(
+        self,
+        *,
+        archive_reason_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        archived_any_of: typing.Optional[typing.Union[bool, typing.Sequence[bool]]] = None,
+        authors_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        bases_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        created_at_gt: typing.Optional[str] = None,
+        created_at_gte: typing.Optional[str] = None,
+        created_at_lt: typing.Optional[str] = None,
+        created_at_lte: typing.Optional[str] = None,
+        creator_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        entity_registry_ids_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        fieldset_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        folder_eq: typing.Optional[str] = None,
+        id_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        mentioned_in_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        modified_at_gt: typing.Optional[str] = None,
+        modified_at_gte: typing.Optional[str] = None,
+        modified_at_lt: typing.Optional[str] = None,
+        modified_at_lte: typing.Optional[str] = None,
+        name_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        name_any_of_case_sensitive: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        next_token: typing.Optional[str] = None,
+        omit: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        page_size: typing.Optional[int] = None,
+        project_eq: typing.Optional[str] = None,
+        registry_eq: typing.Optional[str] = None,
+        returning: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        schema_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        schema_eq: typing.Optional[str] = None,
+        system_category_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        sort: typing.Optional[ListRnaSequenceRequestSort] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> SyncPager[RnaSequence, RnaSequencePaginatedList]:
+        """
+        List RnaSequence items.
+
+        Parameters
+        ----------
+        archive_reason_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts items to those with any of the specified archive reasons. Use "NOT_ARCHIVED" to filter for unarchived items. Use "ANY_ARCHIVED" to filter for archived items regardless of reason. Use "ANY_ARCHIVED_OR_NOT_ARCHIVED" to return items for both archived and unarchived. Comma-separated list.
+
+        archived_any_of : typing.Optional[typing.Union[bool, typing.Sequence[bool]]]
+            If true, returns archived items. If false, returns unarchived items. If both true and false, returns archived and unarchived items. Comma-separated list.
+
+        authors_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose author matches any of the specified user or author IDs. Comma-separated list.
+
+        bases_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose sequence exactly matches any of the specified DNA base sequences (case-insensitive, accounting for circular and reverse complement). Comma-separated list.
+
+        created_at_gt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created after the specified time. e.g. > 2017-04-30.
+
+        created_at_gte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created at or after the specified time. e.g. >= 2017-04-30.
+
+        created_at_lt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created before the specified time. e.g. < 2017-04-30.
+
+        created_at_lte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created at or before the specified time. e.g. <= 2017-04-30.
+
+        creator_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those created by any of the specified user IDs. Comma-separated list.
+
+        entity_registry_ids_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified entity registry IDs. Comma-separated list.
+
+        fieldset_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose schema implements any of the specified fieldset API IDs (custom schema interfaces). Comma-separated list.
+
+        folder_eq : typing.Optional[str]
+            ID of a folder. Restricts results to its direct children.
+
+        id_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those matching any of the specified IDs. Comma-separated list.
+
+        mentioned_in_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to items mentioned in entries matching any of the specified entry IDs. Comma-separated list.
+
+        modified_at_gt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified after the specified time. e.g. > 2017-04-30.
+
+        modified_at_gte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified at or after the specified time. e.g. >= 2017-04-30.
+
+        modified_at_lt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified before the specified time. e.g. < 2017-04-30.
+
+        modified_at_lte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified at or before the specified time. e.g. <= 2017-04-30.
+
+        name_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified names. Case insensitive. Warning - this filter can be non-performant due to case insensitivity. Ensure only one name filter is used at a time. Comma-separated list.
+
+        name_any_of_case_sensitive : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified names. Case sensitive. Ensure only one name filter is used at a time. Comma-separated list.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        omit : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to omit from each returned item. Cannot overlap with returning.
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        project_eq : typing.Optional[str]
+            ID of a project. Restricts results to those in the project.
+
+        registry_eq : typing.Optional[str]
+            ID of a registry. Restricts results to those registered in this registry. Specifying "null" returns unregistered items.
+
+        returning : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to include in each returned item. Cannot overlap with omit.
+
+        schema_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified schema IDs. Use only one `schema` filter arg at a time. Comma-separated list.
+
+        schema_eq : typing.Optional[str]
+            Single schema ID. Restricts results to those that match the specified schema exactly. Use only one `schema` filter arg at a time.
+
+        system_category_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose schema implements any of the specified system category API IDs (non-exclusive static schema interfaces). Comma-separated list.
+
+        sort : typing.Optional[ListRnaSequenceRequestSort]
+            Method by which to order results. Valid sorts are: createdAt (created time, oldest first) and modifiedAt (modified time, oldest first). Use :asc or :desc to specify ascending or descending order. Default is modifiedAt:desc.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        SyncPager[RnaSequence, RnaSequencePaginatedList]
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        response = client.rna_sequence.list()
+        for item in response:
+            yield item
+        # alternatively, you can paginate page-by-page
+        for page in response.iter_pages():
+            yield page
+        """
+        return self._raw_client.list(
+            archive_reason_any_of=archive_reason_any_of,
+            archived_any_of=archived_any_of,
+            authors_any_of=authors_any_of,
+            bases_any_of=bases_any_of,
+            created_at_gt=created_at_gt,
+            created_at_gte=created_at_gte,
+            created_at_lt=created_at_lt,
+            created_at_lte=created_at_lte,
+            creator_any_of=creator_any_of,
+            entity_registry_ids_any_of=entity_registry_ids_any_of,
+            fieldset_any_of=fieldset_any_of,
+            folder_eq=folder_eq,
+            id_any_of=id_any_of,
+            mentioned_in_any_of=mentioned_in_any_of,
+            modified_at_gt=modified_at_gt,
+            modified_at_gte=modified_at_gte,
+            modified_at_lt=modified_at_lt,
+            modified_at_lte=modified_at_lte,
+            name_any_of=name_any_of,
+            name_any_of_case_sensitive=name_any_of_case_sensitive,
+            next_token=next_token,
+            omit=omit,
+            page_size=page_size,
+            project_eq=project_eq,
+            registry_eq=registry_eq,
+            returning=returning,
+            schema_any_of=schema_any_of,
+            schema_eq=schema_eq,
+            system_category_any_of=system_category_any_of,
+            sort=sort,
+            request_options=request_options,
+        )
+
+    def get(
+        self,
+        rna_sequence_id: str,
+        *,
+        returning: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        omit: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> RnaSequence:
+        """
+        Get a single RnaSequence by ID.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        returning : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to include in each returned item. Cannot overlap with omit.
+
+        omit : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to omit from each returned item. Cannot overlap with returning.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        RnaSequence
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.get(
+            rna_sequence_id="rna_sequence_id",
+        )
+        """
+        _response = self._raw_client.get(
+            rna_sequence_id, returning=returning, omit=omit, request_options=request_options
+        )
+        return _response.data
+
+    def update(
+        self,
+        rna_sequence_id: str,
+        *,
+        aliases: typing.Optional[typing.Sequence[str]] = OMIT,
+        annotations: typing.Optional[typing.Sequence[RnaAnnotationInput]] = OMIT,
+        archive_reason: typing.Optional[str] = OMIT,
+        archived: typing.Optional[bool] = OMIT,
+        author_ids: typing.Optional[typing.Sequence[str]] = OMIT,
+        bases: typing.Optional[str] = OMIT,
+        custom_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        custom_notation: typing.Optional[str] = OMIT,
+        custom_notation_id: typing.Optional[str] = OMIT,
+        entity_registry_id: typing.Optional[str] = OMIT,
+        folder_id: typing.Optional[str] = OMIT,
+        helm: typing.Optional[str] = OMIT,
+        name: typing.Optional[str] = OMIT,
+        naming_strategy: typing.Optional[UpdateRnaSequenceInputNamingStrategy] = OMIT,
+        parts: typing.Optional[typing.Sequence[RnaPartInput]] = OMIT,
+        primers: typing.Optional[typing.Sequence[PrimerInput]] = OMIT,
+        registry_id: typing.Optional[str] = OMIT,
+        schema_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        schema_id: typing.Optional[str] = OMIT,
+        translations: typing.Optional[typing.Sequence[RnaTranslationInput]] = OMIT,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> RnaSequence:
+        """
+        Update an RNA sequence. The `id` path parameter identifies the RNA sequence to update.
+
+        ## Sequence specification
+
+        To replace the sequence, provide exactly one of the following. Omit all sequence fields to keep the existing sequence.
+        - `bases` — plain nucleotide sequence
+        - `helm` — HELM notation (requires the modified nucleotides feature to be enabled)
+        - `customNotation` with `customNotationId` — vendor-specific notation (requires custom syntaxes to be enabled; both fields must be set together)
+
+        ## Updating bases
+
+        When replacing `bases`, include every sequence feature collection that already exists on the sequence: `annotations`, `translations`, `primers`, and `parts`. Provide the updated values or an empty array (`[]`) to clear a collection. Omitting a key that has existing data returns `400`.
+
+        ## Chemical modifications
+
+        When switching from HELM or custom notation to plain `bases` on a sequence with chemical modifications, include an empty `helm` or `customNotation` string to clear the existing modifications. Updating `bases` alone returns `400`.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        aliases : typing.Optional[typing.Sequence[str]]
+            Array of aliases
+
+        annotations : typing.Optional[typing.Sequence[RnaAnnotationInput]]
+            Annotations on the RNA sequence, not including translations or primers. Annotations on parts are
+            not included.
+
+        archive_reason : typing.Optional[str]
+
+        archived : typing.Optional[bool]
+
+        author_ids : typing.Optional[typing.Sequence[str]]
+
+        bases : typing.Optional[str]
+            Bases of the RNA sequence. Mutually exclusive with `helm` and `customNotation`.
+
+        custom_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+            Custom fields set on the RNA sequence.
+
+        custom_notation : typing.Optional[str]
+            Sequence in a vendor-specific custom notation syntax. Requires custom syntaxes to be enabled. When `customNotation` is set, `customNotationId` is required. Mutually exclusive with `bases` and `helm`.
+
+        custom_notation_id : typing.Optional[str]
+            ID of the custom notation syntax used to interpret `customNotation`. When `customNotation` is set, `customNotationId` is required; omit both when using `bases` or `helm`.
+
+        entity_registry_id : typing.Optional[str]
+            Registry ID to assign to the entity. When registering, specifying this value sets the registry ID of the entity. When already registered, specifying this value updates the entity's registry ID. If set, naming_strategy must be unspecified.
+
+        folder_id : typing.Optional[str]
+
+        helm : typing.Optional[str]
+            HELM notation for the RNA sequence and chemical modifications. Requires the modified nucleotides feature to be enabled. Mutually exclusive with `bases` and `customNotation`.
+
+        name : typing.Optional[str]
+            Name of the item.
+
+        naming_strategy : typing.Optional[UpdateRnaSequenceInputNamingStrategy]
+            Strategy to use for labeling the item in the registry if registering. If one is specified, the entity_registry_id must be unspecified.
+
+        parts : typing.Optional[typing.Sequence[RnaPartInput]]
+            Part features linking regions of this sequence to other RNA sequences.
+
+        primers : typing.Optional[typing.Sequence[PrimerInput]]
+            Primer bind features on the RNA sequence. Primers on parts are not included.
+
+        registry_id : typing.Optional[str]
+            A not null value means the entity should be registered. A null value means it should be unregistered. If not null, the value must match the registry of the item's schema.
+
+        schema_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+
+        schema_id : typing.Optional[str]
+
+        translations : typing.Optional[typing.Sequence[RnaTranslationInput]]
+            Translation annotations present on the RNA sequence. Translations may be one region or split
+            across multiple regions. Translations on parts are not included.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        RnaSequence
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import (
+            Benchling,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+        )
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.update(
+            rna_sequence_id="rna_sequence_id",
+            annotations=[
+                RnaAnnotationInput(
+                    color="#4ECDC4",
+                    end=10,
+                    name="Updated target region",
+                    notes="Updated silencing target",
+                    start=0,
+                    type="target",
+                )
+            ],
+            bases="AUCGAUCGAUCGAUCGAUCGAUCG",
+            name="Updated CRISPR guide RNA",
+            parts=[
+                RnaPartInput(
+                    end=6,
+                    sequence_id="seq_jdf8BV24",
+                    start=0,
+                )
+            ],
+            primers=[
+                PrimerInput(
+                    location=LocationInput(
+                        location_type="start_and_end",
+                        end=8,
+                        start=2,
+                    ),
+                    oligo_id="seq_laGnl8vB",
+                    strand="REVERSE",
+                )
+            ],
+            schema_fields={
+                "application": FieldValueInput(
+                    value="CRISPR",
+                ),
+                "target_gene": FieldValueInput(
+                    value="BRCA1",
+                ),
+            },
+            translations=[
+                RnaTranslationInput(
+                    genetic_code="STANDARD",
+                    name="Updated ORF fragment",
+                    regions=[
+                        TranslationRegionInput(
+                            end=9,
+                            start=1,
+                        )
+                    ],
+                    translate_first_codon_to_methionine=False,
+                )
+            ],
+        )
+        """
+        _response = self._raw_client.update(
+            rna_sequence_id,
+            aliases=aliases,
+            annotations=annotations,
+            archive_reason=archive_reason,
+            archived=archived,
+            author_ids=author_ids,
+            bases=bases,
+            custom_fields=custom_fields,
+            custom_notation=custom_notation,
+            custom_notation_id=custom_notation_id,
+            entity_registry_id=entity_registry_id,
+            folder_id=folder_id,
+            helm=helm,
+            name=name,
+            naming_strategy=naming_strategy,
+            parts=parts,
+            primers=primers,
+            registry_id=registry_id,
+            schema_fields=schema_fields,
+            schema_id=schema_id,
+            translations=translations,
+            request_options=request_options,
+        )
+        return _response.data
+
+    def list_annotations(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> SyncPager[NucleotideAnnotation, NucleotideAnnotationPaginatedList]:
+        """
+        List NucleotideAnnotation items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        SyncPager[NucleotideAnnotation, NucleotideAnnotationPaginatedList]
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        response = client.rna_sequence.list_annotations(
+            rna_sequence_id="rna_sequence_id",
+        )
+        for item in response:
+            yield item
+        # alternatively, you can paginate page-by-page
+        for page in response.iter_pages():
+            yield page
+        """
+        return self._raw_client.list_annotations(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    def list_authors(
+        self, rna_sequence_id: str, *, request_options: typing.Optional[RequestOptions] = None
+    ) -> PrincipalUnpaginatedList:
+        """
+        List Principal items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        PrincipalUnpaginatedList
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.list_authors(
+            rna_sequence_id="rna_sequence_id",
+        )
+        """
+        _response = self._raw_client.list_authors(rna_sequence_id, request_options=request_options)
+        return _response.data
+
+    def list_modified_nucleotides(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> SyncPager[ModifiedNucleotide, ModifiedNucleotidePaginatedList]:
+        """
+        List ModifiedNucleotide items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        SyncPager[ModifiedNucleotide, ModifiedNucleotidePaginatedList]
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        response = client.rna_sequence.list_modified_nucleotides(
+            rna_sequence_id="rna_sequence_id",
+        )
+        for item in response:
+            yield item
+        # alternatively, you can paginate page-by-page
+        for page in response.iter_pages():
+            yield page
+        """
+        return self._raw_client.list_modified_nucleotides(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    def list_nucleotide_alignments(
+        self, rna_sequence_id: str, *, request_options: typing.Optional[RequestOptions] = None
+    ) -> NucleotideAlignmentUnpaginatedList:
+        """
+        List NucleotideAlignment items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        NucleotideAlignmentUnpaginatedList
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.list_nucleotide_alignments(
+            rna_sequence_id="rna_sequence_id",
+        )
+        """
+        _response = self._raw_client.list_nucleotide_alignments(rna_sequence_id, request_options=request_options)
+        return _response.data
+
+    def list_parts(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> SyncPager[RnaPart, RnaPartPaginatedList]:
+        """
+        List RnaPart items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        SyncPager[RnaPart, RnaPartPaginatedList]
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        response = client.rna_sequence.list_parts(
+            rna_sequence_id="rna_sequence_id",
+        )
+        for item in response:
+            yield item
+        # alternatively, you can paginate page-by-page
+        for page in response.iter_pages():
+            yield page
+        """
+        return self._raw_client.list_parts(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    def list_primers(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> SyncPager[Primer, PrimerPaginatedList]:
+        """
+        List Primer items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        SyncPager[Primer, PrimerPaginatedList]
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        response = client.rna_sequence.list_primers(
+            rna_sequence_id="rna_sequence_id",
+        )
+        for item in response:
+            yield item
+        # alternatively, you can paginate page-by-page
+        for page in response.iter_pages():
+            yield page
+        """
+        return self._raw_client.list_primers(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    def list_translations(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> SyncPager[Translation, TranslationPaginatedList]:
+        """
+        List Translation items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        SyncPager[Translation, TranslationPaginatedList]
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        response = client.rna_sequence.list_translations(
+            rna_sequence_id="rna_sequence_id",
+        )
+        for item in response:
+            yield item
+        # alternatively, you can paginate page-by-page
+        for page in response.iter_pages():
+            yield page
+        """
+        return self._raw_client.list_translations(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    def batch_create(
+        self, *, items: typing.Sequence[CreateRnaSequenceInput], request_options: typing.Optional[RequestOptions] = None
+    ) -> BatchCreateRnaSequenceResponse:
+        """
+        Batch create RNA sequences synchronously in one transaction. Maximum 25 items per request.
+
+        Each item follows the same field requirements as the single-create endpoint. If any item fails validation, the transaction fails and no RNA sequences are created.
+
+        Parameters
+        ----------
+        items : typing.Sequence[CreateRnaSequenceInput]
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        BatchCreateRnaSequenceResponse
+            Created
+
+        Examples
+        --------
+        from benchling_v3_sdk import (
+            Benchling,
+            CreateRnaSequenceInput,
+            CustomFieldInput,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+        )
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.batch_create(
+            items=[
+                CreateRnaSequenceInput(
+                    annotations=[
+                        RnaAnnotationInput(
+                            color="#FF6B6B",
+                            end=8,
+                            name="Target region",
+                            notes="Gene silencing target",
+                            start=2,
+                            type="target",
+                        )
+                    ],
+                    bases="AUCGAUCGAUCGAUCGAUCGAU",
+                    folder_id="lib_o2thOLlq",
+                    name="CRISPR guide RNA",
+                    parts=[
+                        RnaPartInput(
+                            end=4,
+                            sequence_id="seq_jdf8BV24",
+                            start=0,
+                        )
+                    ],
+                    primers=[
+                        PrimerInput(
+                            location=LocationInput(
+                                location_type="start_and_end",
+                                end=4,
+                                start=0,
+                            ),
+                            oligo_id="seq_laGnl8vB",
+                            strand="FORWARD",
+                        )
+                    ],
+                    schema_fields={
+                        "application": FieldValueInput(
+                            value="CRISPR",
+                        ),
+                        "target_gene": FieldValueInput(
+                            value="BRCA1",
+                        ),
+                    },
+                    schema_id="ts_ztQQGSSF",
+                    translations=[
+                        RnaTranslationInput(
+                            custom_fields=[
+                                CustomFieldInput(
+                                    name="reading_frame",
+                                    value="1",
+                                )
+                            ],
+                            genetic_code="STANDARD",
+                            name="ORF fragment",
+                            regions=[
+                                TranslationRegionInput(
+                                    end=7,
+                                    start=1,
+                                )
+                            ],
+                            translate_first_codon_to_methionine=True,
+                        )
+                    ],
+                )
+            ],
+        )
+        """
+        _response = self._raw_client.batch_create(items=items, request_options=request_options)
+        return _response.data
+
+    def batch_update(
+        self,
+        *,
+        items: typing.Sequence[UpdateRnaSequenceInputWithPathParams],
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> BatchUpdateRnaSequenceResponse:
+        """
+        Batch update RNA sequences synchronously in one transaction. Maximum 25 items per request.
+
+        Each item follows the same field requirements and archive constraints as the single-update endpoint. If any item fails validation, the transaction fails and no RNA sequences are updated.
+
+        Parameters
+        ----------
+        items : typing.Sequence[UpdateRnaSequenceInputWithPathParams]
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        BatchUpdateRnaSequenceResponse
+            OK
+
+        Examples
+        --------
+        from benchling_v3_sdk import (
+            Benchling,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+            UpdateRnaSequenceInputWithPathParams,
+        )
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.batch_update(
+            items=[
+                UpdateRnaSequenceInputWithPathParams(
+                    annotations=[
+                        RnaAnnotationInput(
+                            color="#4ECDC4",
+                            end=10,
+                            name="Updated target region",
+                            notes="Updated silencing target",
+                            start=0,
+                            type="target",
+                        )
+                    ],
+                    bases="AUCGAUCGAUCGAUCGAUCGAUCG",
+                    id="seq_9CYiCggY",
+                    name="Updated CRISPR guide RNA",
+                    parts=[
+                        RnaPartInput(
+                            end=6,
+                            sequence_id="seq_jdf8BV24",
+                            start=0,
+                        )
+                    ],
+                    primers=[
+                        PrimerInput(
+                            location=LocationInput(
+                                location_type="start_and_end",
+                                end=8,
+                                start=2,
+                            ),
+                            oligo_id="seq_laGnl8vB",
+                            strand="REVERSE",
+                        )
+                    ],
+                    schema_fields={
+                        "application": FieldValueInput(
+                            value="CRISPR",
+                        ),
+                        "target_gene": FieldValueInput(
+                            value="BRCA1",
+                        ),
+                    },
+                    translations=[
+                        RnaTranslationInput(
+                            genetic_code="STANDARD",
+                            name="Updated ORF fragment",
+                            regions=[
+                                TranslationRegionInput(
+                                    end=9,
+                                    start=1,
+                                )
+                            ],
+                            translate_first_codon_to_methionine=False,
+                        )
+                    ],
+                )
+            ],
+        )
+        """
+        _response = self._raw_client.batch_update(items=items, request_options=request_options)
+        return _response.data
+
+    def bulk_create(self, *, file_id: str, request_options: typing.Optional[RequestOptions] = None) -> AsyncTaskLink:
+        """
+        Bulk create RNA sequences asynchronously.
+
+        Each item follows the same field requirements as the single-create endpoint. The response returns an async task; poll the task to inspect row-level successes and validation errors.
+
+        If any item uses `customNotation`, all items in the bulk request that use `customNotation` must use the same `customNotationId`.
+
+        Parameters
+        ----------
+        file_id : str
+            The API ID of the scratch file (`scrfile_XXXXXXXX`) containing the items to import. The referenced file must be a scratch file whose upload has completed successfully.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncTaskLink
+            Task started
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.bulk_create(
+            file_id="scrfile_jdf8BV24kLmN",
+        )
+        """
+        _response = self._raw_client.bulk_create(file_id=file_id, request_options=request_options)
+        return _response.data
+
+    def bulk_update(self, *, file_id: str, request_options: typing.Optional[RequestOptions] = None) -> AsyncTaskLink:
+        """
+        Bulk update RNA sequences asynchronously.
+
+        Each item follows the same field requirements and archive constraints as the single-update endpoint. The response returns an async task; poll the task to inspect row-level successes and validation errors.
+
+        If any item uses `customNotation`, all items in the bulk request that use `customNotation` must use the same `customNotationId`.
+
+        Parameters
+        ----------
+        file_id : str
+            The API ID of the scratch file (`scrfile_XXXXXXXX`) containing the items to import. The referenced file must be a scratch file whose upload has completed successfully.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncTaskLink
+            Task started
+
+        Examples
+        --------
+        from benchling_v3_sdk import Benchling
+
+        client = Benchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+        client.rna_sequence.bulk_update(
+            file_id="scrfile_jdf8BV24kLmN",
+        )
+        """
+        _response = self._raw_client.bulk_update(file_id=file_id, request_options=request_options)
+        return _response.data
+
+
+class AsyncRnaSequenceClient:
+    def __init__(self, *, client_wrapper: AsyncClientWrapper):
+        self._raw_client = AsyncRawRnaSequenceClient(client_wrapper=client_wrapper)
+
+    @property
+    def with_raw_response(self) -> AsyncRawRnaSequenceClient:
+        """
+        Retrieves a raw implementation of this client that returns raw responses.
+
+        Returns
+        -------
+        AsyncRawRnaSequenceClient
+        """
+        return self._raw_client
+
+    async def create(
+        self,
+        *,
+        folder_id: str,
+        name: str,
+        aliases: typing.Optional[typing.Sequence[str]] = OMIT,
+        annotations: typing.Optional[typing.Sequence[RnaAnnotationInput]] = OMIT,
+        author_ids: typing.Optional[typing.Sequence[str]] = OMIT,
+        bases: typing.Optional[str] = OMIT,
+        custom_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        custom_notation: typing.Optional[str] = OMIT,
+        custom_notation_id: typing.Optional[str] = OMIT,
+        entity_registry_id: typing.Optional[str] = OMIT,
+        helm: typing.Optional[str] = OMIT,
+        naming_strategy: typing.Optional[CreateRnaSequenceInputNamingStrategy] = OMIT,
+        parts: typing.Optional[typing.Sequence[RnaPartInput]] = OMIT,
+        primers: typing.Optional[typing.Sequence[PrimerInput]] = OMIT,
+        registry_id: typing.Optional[str] = OMIT,
+        schema_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        schema_id: typing.Optional[str] = OMIT,
+        translations: typing.Optional[typing.Sequence[RnaTranslationInput]] = OMIT,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> RnaSequence:
+        """
+        Create an RNA sequence in a folder. `name` and `folderId` are required.
+
+        ## Sequence specification
+
+        Provide exactly one of the following:
+        - `bases` — plain nucleotide sequence
+        - `helm` — HELM notation (requires the modified nucleotides feature to be enabled)
+        - `customNotation` with `customNotationId` — vendor-specific notation (requires custom syntaxes to be enabled; both fields must be set together)
+
+        Parameters
+        ----------
+        folder_id : str
+
+        name : str
+            Name of the item.
+
+        aliases : typing.Optional[typing.Sequence[str]]
+            Array of aliases
+
+        annotations : typing.Optional[typing.Sequence[RnaAnnotationInput]]
+            Annotations on the RNA sequence, not including translations or primers. Annotations on parts are
+            not included.
+
+        author_ids : typing.Optional[typing.Sequence[str]]
+
+        bases : typing.Optional[str]
+            Bases of the RNA sequence. Mutually exclusive with `helm` and `customNotation`.
+
+        custom_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+            Custom fields set on the RNA sequence.
+
+        custom_notation : typing.Optional[str]
+            Sequence in a vendor-specific custom notation syntax. Requires custom syntaxes to be enabled. When `customNotation` is set, `customNotationId` is required. Mutually exclusive with `bases` and `helm`.
+
+        custom_notation_id : typing.Optional[str]
+            ID of the custom notation syntax used to interpret `customNotation`. When `customNotation` is set, `customNotationId` is required; omit both when using `bases` or `helm`.
+
+        entity_registry_id : typing.Optional[str]
+            Registry ID to assign to the entity. If one is specified, the labeling_strategy must be unspecified.
+
+        helm : typing.Optional[str]
+            HELM notation for the RNA sequence and chemical modifications. Requires the modified nucleotides feature to be enabled. Mutually exclusive with `bases` and `customNotation`.
+
+        naming_strategy : typing.Optional[CreateRnaSequenceInputNamingStrategy]
+            Strategy to use for labeling the item in the registry. If one is specified, the entity_registry_id must be unspecified.
+
+        parts : typing.Optional[typing.Sequence[RnaPartInput]]
+            Part features linking regions of this sequence to other RNA sequences.
+
+        primers : typing.Optional[typing.Sequence[PrimerInput]]
+            Primer bind features on the RNA sequence. Primers on parts are not included.
+
+        registry_id : typing.Optional[str]
+            A not null value means the entity should be registered. If not null, the value must match the registry of the item's schema.
+
+        schema_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+
+        schema_id : typing.Optional[str]
+
+        translations : typing.Optional[typing.Sequence[RnaTranslationInput]]
+            Translation annotations present on the RNA sequence. Translations may be one region or split
+            across multiple regions. Translations on parts are not included.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        RnaSequence
+            Created
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import (
+            AsyncBenchling,
+            CustomFieldInput,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+        )
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.create(
+                annotations=[
+                    RnaAnnotationInput(
+                        color="#FF6B6B",
+                        end=8,
+                        name="Target region",
+                        notes="Gene silencing target",
+                        start=2,
+                        type="target",
+                    )
+                ],
+                bases="AUCGAUCGAUCGAUCGAUCGAU",
+                folder_id="lib_o2thOLlq",
+                name="CRISPR guide RNA",
+                parts=[
+                    RnaPartInput(
+                        end=4,
+                        sequence_id="seq_jdf8BV24",
+                        start=0,
+                    )
+                ],
+                primers=[
+                    PrimerInput(
+                        location=LocationInput(
+                            location_type="start_and_end",
+                            end=4,
+                            start=0,
+                        ),
+                        oligo_id="seq_laGnl8vB",
+                        strand="FORWARD",
+                    )
+                ],
+                schema_fields={
+                    "application": FieldValueInput(
+                        value="CRISPR",
+                    ),
+                    "target_gene": FieldValueInput(
+                        value="BRCA1",
+                    ),
+                },
+                schema_id="ts_ztQQGSSF",
+                translations=[
+                    RnaTranslationInput(
+                        custom_fields=[
+                            CustomFieldInput(
+                                name="reading_frame",
+                                value="1",
+                            )
+                        ],
+                        genetic_code="STANDARD",
+                        name="ORF fragment",
+                        regions=[
+                            TranslationRegionInput(
+                                end=7,
+                                start=1,
+                            )
+                        ],
+                        translate_first_codon_to_methionine=True,
+                    )
+                ],
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.create(
+            folder_id=folder_id,
+            name=name,
+            aliases=aliases,
+            annotations=annotations,
+            author_ids=author_ids,
+            bases=bases,
+            custom_fields=custom_fields,
+            custom_notation=custom_notation,
+            custom_notation_id=custom_notation_id,
+            entity_registry_id=entity_registry_id,
+            helm=helm,
+            naming_strategy=naming_strategy,
+            parts=parts,
+            primers=primers,
+            registry_id=registry_id,
+            schema_fields=schema_fields,
+            schema_id=schema_id,
+            translations=translations,
+            request_options=request_options,
+        )
+        return _response.data
+
+    async def list(
+        self,
+        *,
+        archive_reason_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        archived_any_of: typing.Optional[typing.Union[bool, typing.Sequence[bool]]] = None,
+        authors_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        bases_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        created_at_gt: typing.Optional[str] = None,
+        created_at_gte: typing.Optional[str] = None,
+        created_at_lt: typing.Optional[str] = None,
+        created_at_lte: typing.Optional[str] = None,
+        creator_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        entity_registry_ids_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        fieldset_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        folder_eq: typing.Optional[str] = None,
+        id_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        mentioned_in_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        modified_at_gt: typing.Optional[str] = None,
+        modified_at_gte: typing.Optional[str] = None,
+        modified_at_lt: typing.Optional[str] = None,
+        modified_at_lte: typing.Optional[str] = None,
+        name_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        name_any_of_case_sensitive: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        next_token: typing.Optional[str] = None,
+        omit: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        page_size: typing.Optional[int] = None,
+        project_eq: typing.Optional[str] = None,
+        registry_eq: typing.Optional[str] = None,
+        returning: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        schema_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        schema_eq: typing.Optional[str] = None,
+        system_category_any_of: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        sort: typing.Optional[ListRnaSequenceRequestSort] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> AsyncPager[RnaSequence, RnaSequencePaginatedList]:
+        """
+        List RnaSequence items.
+
+        Parameters
+        ----------
+        archive_reason_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts items to those with any of the specified archive reasons. Use "NOT_ARCHIVED" to filter for unarchived items. Use "ANY_ARCHIVED" to filter for archived items regardless of reason. Use "ANY_ARCHIVED_OR_NOT_ARCHIVED" to return items for both archived and unarchived. Comma-separated list.
+
+        archived_any_of : typing.Optional[typing.Union[bool, typing.Sequence[bool]]]
+            If true, returns archived items. If false, returns unarchived items. If both true and false, returns archived and unarchived items. Comma-separated list.
+
+        authors_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose author matches any of the specified user or author IDs. Comma-separated list.
+
+        bases_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose sequence exactly matches any of the specified DNA base sequences (case-insensitive, accounting for circular and reverse complement). Comma-separated list.
+
+        created_at_gt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created after the specified time. e.g. > 2017-04-30.
+
+        created_at_gte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created at or after the specified time. e.g. >= 2017-04-30.
+
+        created_at_lt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created before the specified time. e.g. < 2017-04-30.
+
+        created_at_lte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those created at or before the specified time. e.g. <= 2017-04-30.
+
+        creator_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those created by any of the specified user IDs. Comma-separated list.
+
+        entity_registry_ids_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified entity registry IDs. Comma-separated list.
+
+        fieldset_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose schema implements any of the specified fieldset API IDs (custom schema interfaces). Comma-separated list.
+
+        folder_eq : typing.Optional[str]
+            ID of a folder. Restricts results to its direct children.
+
+        id_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those matching any of the specified IDs. Comma-separated list.
+
+        mentioned_in_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to items mentioned in entries matching any of the specified entry IDs. Comma-separated list.
+
+        modified_at_gt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified after the specified time. e.g. > 2017-04-30.
+
+        modified_at_gte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified at or after the specified time. e.g. >= 2017-04-30.
+
+        modified_at_lt : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified before the specified time. e.g. < 2017-04-30.
+
+        modified_at_lte : typing.Optional[str]
+            Datetime, in RFC 3339 format. Time zone defaults to UTC. Restricts results to those modified at or before the specified time. e.g. <= 2017-04-30.
+
+        name_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified names. Case insensitive. Warning - this filter can be non-performant due to case insensitivity. Ensure only one name filter is used at a time. Comma-separated list.
+
+        name_any_of_case_sensitive : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified names. Case sensitive. Ensure only one name filter is used at a time. Comma-separated list.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        omit : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to omit from each returned item. Cannot overlap with returning.
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        project_eq : typing.Optional[str]
+            ID of a project. Restricts results to those in the project.
+
+        registry_eq : typing.Optional[str]
+            ID of a registry. Restricts results to those registered in this registry. Specifying "null" returns unregistered items.
+
+        returning : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to include in each returned item. Cannot overlap with omit.
+
+        schema_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those that match any of the specified schema IDs. Use only one `schema` filter arg at a time. Comma-separated list.
+
+        schema_eq : typing.Optional[str]
+            Single schema ID. Restricts results to those that match the specified schema exactly. Use only one `schema` filter arg at a time.
+
+        system_category_any_of : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Restricts results to those whose schema implements any of the specified system category API IDs (non-exclusive static schema interfaces). Comma-separated list.
+
+        sort : typing.Optional[ListRnaSequenceRequestSort]
+            Method by which to order results. Valid sorts are: createdAt (created time, oldest first) and modifiedAt (modified time, oldest first). Use :asc or :desc to specify ascending or descending order. Default is modifiedAt:desc.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncPager[RnaSequence, RnaSequencePaginatedList]
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            response = await client.rna_sequence.list()
+            async for item in response:
+                yield item
+
+            # alternatively, you can paginate page-by-page
+            async for page in response.iter_pages():
+                yield page
+
+
+        asyncio.run(main())
+        """
+        return await self._raw_client.list(
+            archive_reason_any_of=archive_reason_any_of,
+            archived_any_of=archived_any_of,
+            authors_any_of=authors_any_of,
+            bases_any_of=bases_any_of,
+            created_at_gt=created_at_gt,
+            created_at_gte=created_at_gte,
+            created_at_lt=created_at_lt,
+            created_at_lte=created_at_lte,
+            creator_any_of=creator_any_of,
+            entity_registry_ids_any_of=entity_registry_ids_any_of,
+            fieldset_any_of=fieldset_any_of,
+            folder_eq=folder_eq,
+            id_any_of=id_any_of,
+            mentioned_in_any_of=mentioned_in_any_of,
+            modified_at_gt=modified_at_gt,
+            modified_at_gte=modified_at_gte,
+            modified_at_lt=modified_at_lt,
+            modified_at_lte=modified_at_lte,
+            name_any_of=name_any_of,
+            name_any_of_case_sensitive=name_any_of_case_sensitive,
+            next_token=next_token,
+            omit=omit,
+            page_size=page_size,
+            project_eq=project_eq,
+            registry_eq=registry_eq,
+            returning=returning,
+            schema_any_of=schema_any_of,
+            schema_eq=schema_eq,
+            system_category_any_of=system_category_any_of,
+            sort=sort,
+            request_options=request_options,
+        )
+
+    async def get(
+        self,
+        rna_sequence_id: str,
+        *,
+        returning: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        omit: typing.Optional[typing.Union[str, typing.Sequence[str]]] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> RnaSequence:
+        """
+        Get a single RnaSequence by ID.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        returning : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to include in each returned item. Cannot overlap with omit.
+
+        omit : typing.Optional[typing.Union[str, typing.Sequence[str]]]
+            Comma-separated list of top-level fields to omit from each returned item. Cannot overlap with returning.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        RnaSequence
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.get(
+                rna_sequence_id="rna_sequence_id",
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.get(
+            rna_sequence_id, returning=returning, omit=omit, request_options=request_options
+        )
+        return _response.data
+
+    async def update(
+        self,
+        rna_sequence_id: str,
+        *,
+        aliases: typing.Optional[typing.Sequence[str]] = OMIT,
+        annotations: typing.Optional[typing.Sequence[RnaAnnotationInput]] = OMIT,
+        archive_reason: typing.Optional[str] = OMIT,
+        archived: typing.Optional[bool] = OMIT,
+        author_ids: typing.Optional[typing.Sequence[str]] = OMIT,
+        bases: typing.Optional[str] = OMIT,
+        custom_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        custom_notation: typing.Optional[str] = OMIT,
+        custom_notation_id: typing.Optional[str] = OMIT,
+        entity_registry_id: typing.Optional[str] = OMIT,
+        folder_id: typing.Optional[str] = OMIT,
+        helm: typing.Optional[str] = OMIT,
+        name: typing.Optional[str] = OMIT,
+        naming_strategy: typing.Optional[UpdateRnaSequenceInputNamingStrategy] = OMIT,
+        parts: typing.Optional[typing.Sequence[RnaPartInput]] = OMIT,
+        primers: typing.Optional[typing.Sequence[PrimerInput]] = OMIT,
+        registry_id: typing.Optional[str] = OMIT,
+        schema_fields: typing.Optional[typing.Dict[str, FieldValueInput]] = OMIT,
+        schema_id: typing.Optional[str] = OMIT,
+        translations: typing.Optional[typing.Sequence[RnaTranslationInput]] = OMIT,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> RnaSequence:
+        """
+        Update an RNA sequence. The `id` path parameter identifies the RNA sequence to update.
+
+        ## Sequence specification
+
+        To replace the sequence, provide exactly one of the following. Omit all sequence fields to keep the existing sequence.
+        - `bases` — plain nucleotide sequence
+        - `helm` — HELM notation (requires the modified nucleotides feature to be enabled)
+        - `customNotation` with `customNotationId` — vendor-specific notation (requires custom syntaxes to be enabled; both fields must be set together)
+
+        ## Updating bases
+
+        When replacing `bases`, include every sequence feature collection that already exists on the sequence: `annotations`, `translations`, `primers`, and `parts`. Provide the updated values or an empty array (`[]`) to clear a collection. Omitting a key that has existing data returns `400`.
+
+        ## Chemical modifications
+
+        When switching from HELM or custom notation to plain `bases` on a sequence with chemical modifications, include an empty `helm` or `customNotation` string to clear the existing modifications. Updating `bases` alone returns `400`.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        aliases : typing.Optional[typing.Sequence[str]]
+            Array of aliases
+
+        annotations : typing.Optional[typing.Sequence[RnaAnnotationInput]]
+            Annotations on the RNA sequence, not including translations or primers. Annotations on parts are
+            not included.
+
+        archive_reason : typing.Optional[str]
+
+        archived : typing.Optional[bool]
+
+        author_ids : typing.Optional[typing.Sequence[str]]
+
+        bases : typing.Optional[str]
+            Bases of the RNA sequence. Mutually exclusive with `helm` and `customNotation`.
+
+        custom_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+            Custom fields set on the RNA sequence.
+
+        custom_notation : typing.Optional[str]
+            Sequence in a vendor-specific custom notation syntax. Requires custom syntaxes to be enabled. When `customNotation` is set, `customNotationId` is required. Mutually exclusive with `bases` and `helm`.
+
+        custom_notation_id : typing.Optional[str]
+            ID of the custom notation syntax used to interpret `customNotation`. When `customNotation` is set, `customNotationId` is required; omit both when using `bases` or `helm`.
+
+        entity_registry_id : typing.Optional[str]
+            Registry ID to assign to the entity. When registering, specifying this value sets the registry ID of the entity. When already registered, specifying this value updates the entity's registry ID. If set, naming_strategy must be unspecified.
+
+        folder_id : typing.Optional[str]
+
+        helm : typing.Optional[str]
+            HELM notation for the RNA sequence and chemical modifications. Requires the modified nucleotides feature to be enabled. Mutually exclusive with `bases` and `customNotation`.
+
+        name : typing.Optional[str]
+            Name of the item.
+
+        naming_strategy : typing.Optional[UpdateRnaSequenceInputNamingStrategy]
+            Strategy to use for labeling the item in the registry if registering. If one is specified, the entity_registry_id must be unspecified.
+
+        parts : typing.Optional[typing.Sequence[RnaPartInput]]
+            Part features linking regions of this sequence to other RNA sequences.
+
+        primers : typing.Optional[typing.Sequence[PrimerInput]]
+            Primer bind features on the RNA sequence. Primers on parts are not included.
+
+        registry_id : typing.Optional[str]
+            A not null value means the entity should be registered. A null value means it should be unregistered. If not null, the value must match the registry of the item's schema.
+
+        schema_fields : typing.Optional[typing.Dict[str, FieldValueInput]]
+
+        schema_id : typing.Optional[str]
+
+        translations : typing.Optional[typing.Sequence[RnaTranslationInput]]
+            Translation annotations present on the RNA sequence. Translations may be one region or split
+            across multiple regions. Translations on parts are not included.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        RnaSequence
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import (
+            AsyncBenchling,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+        )
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.update(
+                rna_sequence_id="rna_sequence_id",
+                annotations=[
+                    RnaAnnotationInput(
+                        color="#4ECDC4",
+                        end=10,
+                        name="Updated target region",
+                        notes="Updated silencing target",
+                        start=0,
+                        type="target",
+                    )
+                ],
+                bases="AUCGAUCGAUCGAUCGAUCGAUCG",
+                name="Updated CRISPR guide RNA",
+                parts=[
+                    RnaPartInput(
+                        end=6,
+                        sequence_id="seq_jdf8BV24",
+                        start=0,
+                    )
+                ],
+                primers=[
+                    PrimerInput(
+                        location=LocationInput(
+                            location_type="start_and_end",
+                            end=8,
+                            start=2,
+                        ),
+                        oligo_id="seq_laGnl8vB",
+                        strand="REVERSE",
+                    )
+                ],
+                schema_fields={
+                    "application": FieldValueInput(
+                        value="CRISPR",
+                    ),
+                    "target_gene": FieldValueInput(
+                        value="BRCA1",
+                    ),
+                },
+                translations=[
+                    RnaTranslationInput(
+                        genetic_code="STANDARD",
+                        name="Updated ORF fragment",
+                        regions=[
+                            TranslationRegionInput(
+                                end=9,
+                                start=1,
+                            )
+                        ],
+                        translate_first_codon_to_methionine=False,
+                    )
+                ],
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.update(
+            rna_sequence_id,
+            aliases=aliases,
+            annotations=annotations,
+            archive_reason=archive_reason,
+            archived=archived,
+            author_ids=author_ids,
+            bases=bases,
+            custom_fields=custom_fields,
+            custom_notation=custom_notation,
+            custom_notation_id=custom_notation_id,
+            entity_registry_id=entity_registry_id,
+            folder_id=folder_id,
+            helm=helm,
+            name=name,
+            naming_strategy=naming_strategy,
+            parts=parts,
+            primers=primers,
+            registry_id=registry_id,
+            schema_fields=schema_fields,
+            schema_id=schema_id,
+            translations=translations,
+            request_options=request_options,
+        )
+        return _response.data
+
+    async def list_annotations(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> AsyncPager[NucleotideAnnotation, NucleotideAnnotationPaginatedList]:
+        """
+        List NucleotideAnnotation items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncPager[NucleotideAnnotation, NucleotideAnnotationPaginatedList]
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            response = await client.rna_sequence.list_annotations(
+                rna_sequence_id="rna_sequence_id",
+            )
+            async for item in response:
+                yield item
+
+            # alternatively, you can paginate page-by-page
+            async for page in response.iter_pages():
+                yield page
+
+
+        asyncio.run(main())
+        """
+        return await self._raw_client.list_annotations(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    async def list_authors(
+        self, rna_sequence_id: str, *, request_options: typing.Optional[RequestOptions] = None
+    ) -> PrincipalUnpaginatedList:
+        """
+        List Principal items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        PrincipalUnpaginatedList
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.list_authors(
+                rna_sequence_id="rna_sequence_id",
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.list_authors(rna_sequence_id, request_options=request_options)
+        return _response.data
+
+    async def list_modified_nucleotides(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> AsyncPager[ModifiedNucleotide, ModifiedNucleotidePaginatedList]:
+        """
+        List ModifiedNucleotide items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncPager[ModifiedNucleotide, ModifiedNucleotidePaginatedList]
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            response = await client.rna_sequence.list_modified_nucleotides(
+                rna_sequence_id="rna_sequence_id",
+            )
+            async for item in response:
+                yield item
+
+            # alternatively, you can paginate page-by-page
+            async for page in response.iter_pages():
+                yield page
+
+
+        asyncio.run(main())
+        """
+        return await self._raw_client.list_modified_nucleotides(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    async def list_nucleotide_alignments(
+        self, rna_sequence_id: str, *, request_options: typing.Optional[RequestOptions] = None
+    ) -> NucleotideAlignmentUnpaginatedList:
+        """
+        List NucleotideAlignment items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        NucleotideAlignmentUnpaginatedList
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.list_nucleotide_alignments(
+                rna_sequence_id="rna_sequence_id",
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.list_nucleotide_alignments(rna_sequence_id, request_options=request_options)
+        return _response.data
+
+    async def list_parts(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> AsyncPager[RnaPart, RnaPartPaginatedList]:
+        """
+        List RnaPart items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncPager[RnaPart, RnaPartPaginatedList]
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            response = await client.rna_sequence.list_parts(
+                rna_sequence_id="rna_sequence_id",
+            )
+            async for item in response:
+                yield item
+
+            # alternatively, you can paginate page-by-page
+            async for page in response.iter_pages():
+                yield page
+
+
+        asyncio.run(main())
+        """
+        return await self._raw_client.list_parts(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    async def list_primers(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> AsyncPager[Primer, PrimerPaginatedList]:
+        """
+        List Primer items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncPager[Primer, PrimerPaginatedList]
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            response = await client.rna_sequence.list_primers(
+                rna_sequence_id="rna_sequence_id",
+            )
+            async for item in response:
+                yield item
+
+            # alternatively, you can paginate page-by-page
+            async for page in response.iter_pages():
+                yield page
+
+
+        asyncio.run(main())
+        """
+        return await self._raw_client.list_primers(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    async def list_translations(
+        self,
+        rna_sequence_id: str,
+        *,
+        next_token: typing.Optional[str] = None,
+        page_size: typing.Optional[int] = None,
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> AsyncPager[Translation, TranslationPaginatedList]:
+        """
+        List Translation items.
+
+        Parameters
+        ----------
+        rna_sequence_id : str
+            ID of the RnaSequence.
+
+        next_token : typing.Optional[str]
+            Token for pagination
+
+        page_size : typing.Optional[int]
+            Number of results to return. Defaults to 50, maximum of 100.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncPager[Translation, TranslationPaginatedList]
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            response = await client.rna_sequence.list_translations(
+                rna_sequence_id="rna_sequence_id",
+            )
+            async for item in response:
+                yield item
+
+            # alternatively, you can paginate page-by-page
+            async for page in response.iter_pages():
+                yield page
+
+
+        asyncio.run(main())
+        """
+        return await self._raw_client.list_translations(
+            rna_sequence_id, next_token=next_token, page_size=page_size, request_options=request_options
+        )
+
+    async def batch_create(
+        self, *, items: typing.Sequence[CreateRnaSequenceInput], request_options: typing.Optional[RequestOptions] = None
+    ) -> BatchCreateRnaSequenceResponse:
+        """
+        Batch create RNA sequences synchronously in one transaction. Maximum 25 items per request.
+
+        Each item follows the same field requirements as the single-create endpoint. If any item fails validation, the transaction fails and no RNA sequences are created.
+
+        Parameters
+        ----------
+        items : typing.Sequence[CreateRnaSequenceInput]
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        BatchCreateRnaSequenceResponse
+            Created
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import (
+            AsyncBenchling,
+            CreateRnaSequenceInput,
+            CustomFieldInput,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+        )
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.batch_create(
+                items=[
+                    CreateRnaSequenceInput(
+                        annotations=[
+                            RnaAnnotationInput(
+                                color="#FF6B6B",
+                                end=8,
+                                name="Target region",
+                                notes="Gene silencing target",
+                                start=2,
+                                type="target",
+                            )
+                        ],
+                        bases="AUCGAUCGAUCGAUCGAUCGAU",
+                        folder_id="lib_o2thOLlq",
+                        name="CRISPR guide RNA",
+                        parts=[
+                            RnaPartInput(
+                                end=4,
+                                sequence_id="seq_jdf8BV24",
+                                start=0,
+                            )
+                        ],
+                        primers=[
+                            PrimerInput(
+                                location=LocationInput(
+                                    location_type="start_and_end",
+                                    end=4,
+                                    start=0,
+                                ),
+                                oligo_id="seq_laGnl8vB",
+                                strand="FORWARD",
+                            )
+                        ],
+                        schema_fields={
+                            "application": FieldValueInput(
+                                value="CRISPR",
+                            ),
+                            "target_gene": FieldValueInput(
+                                value="BRCA1",
+                            ),
+                        },
+                        schema_id="ts_ztQQGSSF",
+                        translations=[
+                            RnaTranslationInput(
+                                custom_fields=[
+                                    CustomFieldInput(
+                                        name="reading_frame",
+                                        value="1",
+                                    )
+                                ],
+                                genetic_code="STANDARD",
+                                name="ORF fragment",
+                                regions=[
+                                    TranslationRegionInput(
+                                        end=7,
+                                        start=1,
+                                    )
+                                ],
+                                translate_first_codon_to_methionine=True,
+                            )
+                        ],
+                    )
+                ],
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.batch_create(items=items, request_options=request_options)
+        return _response.data
+
+    async def batch_update(
+        self,
+        *,
+        items: typing.Sequence[UpdateRnaSequenceInputWithPathParams],
+        request_options: typing.Optional[RequestOptions] = None,
+    ) -> BatchUpdateRnaSequenceResponse:
+        """
+        Batch update RNA sequences synchronously in one transaction. Maximum 25 items per request.
+
+        Each item follows the same field requirements and archive constraints as the single-update endpoint. If any item fails validation, the transaction fails and no RNA sequences are updated.
+
+        Parameters
+        ----------
+        items : typing.Sequence[UpdateRnaSequenceInputWithPathParams]
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        BatchUpdateRnaSequenceResponse
+            OK
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import (
+            AsyncBenchling,
+            FieldValueInput,
+            LocationInput,
+            PrimerInput,
+            RnaAnnotationInput,
+            RnaPartInput,
+            RnaTranslationInput,
+            TranslationRegionInput,
+            UpdateRnaSequenceInputWithPathParams,
+        )
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.batch_update(
+                items=[
+                    UpdateRnaSequenceInputWithPathParams(
+                        annotations=[
+                            RnaAnnotationInput(
+                                color="#4ECDC4",
+                                end=10,
+                                name="Updated target region",
+                                notes="Updated silencing target",
+                                start=0,
+                                type="target",
+                            )
+                        ],
+                        bases="AUCGAUCGAUCGAUCGAUCGAUCG",
+                        id="seq_9CYiCggY",
+                        name="Updated CRISPR guide RNA",
+                        parts=[
+                            RnaPartInput(
+                                end=6,
+                                sequence_id="seq_jdf8BV24",
+                                start=0,
+                            )
+                        ],
+                        primers=[
+                            PrimerInput(
+                                location=LocationInput(
+                                    location_type="start_and_end",
+                                    end=8,
+                                    start=2,
+                                ),
+                                oligo_id="seq_laGnl8vB",
+                                strand="REVERSE",
+                            )
+                        ],
+                        schema_fields={
+                            "application": FieldValueInput(
+                                value="CRISPR",
+                            ),
+                            "target_gene": FieldValueInput(
+                                value="BRCA1",
+                            ),
+                        },
+                        translations=[
+                            RnaTranslationInput(
+                                genetic_code="STANDARD",
+                                name="Updated ORF fragment",
+                                regions=[
+                                    TranslationRegionInput(
+                                        end=9,
+                                        start=1,
+                                    )
+                                ],
+                                translate_first_codon_to_methionine=False,
+                            )
+                        ],
+                    )
+                ],
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.batch_update(items=items, request_options=request_options)
+        return _response.data
+
+    async def bulk_create(
+        self, *, file_id: str, request_options: typing.Optional[RequestOptions] = None
+    ) -> AsyncTaskLink:
+        """
+        Bulk create RNA sequences asynchronously.
+
+        Each item follows the same field requirements as the single-create endpoint. The response returns an async task; poll the task to inspect row-level successes and validation errors.
+
+        If any item uses `customNotation`, all items in the bulk request that use `customNotation` must use the same `customNotationId`.
+
+        Parameters
+        ----------
+        file_id : str
+            The API ID of the scratch file (`scrfile_XXXXXXXX`) containing the items to import. The referenced file must be a scratch file whose upload has completed successfully.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncTaskLink
+            Task started
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.bulk_create(
+                file_id="scrfile_jdf8BV24kLmN",
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.bulk_create(file_id=file_id, request_options=request_options)
+        return _response.data
+
+    async def bulk_update(
+        self, *, file_id: str, request_options: typing.Optional[RequestOptions] = None
+    ) -> AsyncTaskLink:
+        """
+        Bulk update RNA sequences asynchronously.
+
+        Each item follows the same field requirements and archive constraints as the single-update endpoint. The response returns an async task; poll the task to inspect row-level successes and validation errors.
+
+        If any item uses `customNotation`, all items in the bulk request that use `customNotation` must use the same `customNotationId`.
+
+        Parameters
+        ----------
+        file_id : str
+            The API ID of the scratch file (`scrfile_XXXXXXXX`) containing the items to import. The referenced file must be a scratch file whose upload has completed successfully.
+
+        request_options : typing.Optional[RequestOptions]
+            Request-specific configuration.
+
+        Returns
+        -------
+        AsyncTaskLink
+            Task started
+
+        Examples
+        --------
+        import asyncio
+
+        from benchling_v3_sdk import AsyncBenchling
+
+        client = AsyncBenchling(
+            client_id="YOUR_CLIENT_ID",
+            client_secret="YOUR_CLIENT_SECRET",
+        )
+
+
+        async def main() -> None:
+            await client.rna_sequence.bulk_update(
+                file_id="scrfile_jdf8BV24kLmN",
+            )
+
+
+        asyncio.run(main())
+        """
+        _response = await self._raw_client.bulk_update(file_id=file_id, request_options=request_options)
+        return _response.data