jandot-bio 1.2.1

data/test/unit/bio/db/test_gff.rb

@@ -0,0 +1,127 @@
+#
+# test/unit/bio/db/test_gff.rb - Unit test for Bio::GFF
+#
+# Copyright::   Copyright (C) 2005 Mitsuteru Nakao <n@bioruby.org>
+# License::     The Ruby License
+#
+#  $Id: test_gff.rb,v 1.6 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/db/gff'
+
+module Bio
+  class TestGFF < Test::Unit::TestCase
+    
+    def setup
+      data = <<END
+I	sgd	CEN	151453	151591	.	+	.	CEN "CEN1" ; Note "CEN1\; Chromosome I Centromere"
+I	sgd	gene	147591	151163	.	-	.	Gene "TFC3" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene "FUN24" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	147591	151163	.	-	.	Gene "TSV115" ; Note "transcription factor tau (TFIIIC) subunit 138"
+I	sgd	ORF	147591	151163	.	-	.	ORF "YAL001C" ; Note "TFC3\; transcription factor tau (TFIIIC) subunit 138"
+I	sgd	gene	143998	147528	.	+	.	Gene "VPS8" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene "FUN15" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+I	sgd	gene	143998	147528	.	+	.	Gene "VPT8" ; Note "Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the RING finger Zn2+ binding motif."
+END
+      @obj = Bio::GFF.new(data)
+    end
+
+    def test_records
+      assert_equal(8, @obj.records.size)
+    end
+
+    def test_record_class
+      assert_equal(Bio::GFF::Record, @obj.records[0].class)
+    end
+
+  end # class TestGFF
+
+
+  class TestGFF2 < Test::Unit::TestCase
+    def test_version
+      assert_equal(2, Bio::GFF::GFF2::VERSION)
+    end
+  end
+
+
+  class TestGFF3 < Test::Unit::TestCase
+    def test_version
+      assert_equal(3, Bio::GFF::GFF3::VERSION)
+    end
+  end
+
+
+  class TestGFFRecord < Test::Unit::TestCase
+    
+    def setup
+      data =<<END
+I	sgd	gene	151453	151591	.	+	.	Gene "CEN1" ; Note "Chromosome I Centromere"
+END
+      @obj = Bio::GFF::Record.new(data)
+    end
+
+    def test_seqname
+      assert_equal('I', @obj.seqname)
+    end
+
+    def test_source
+      assert_equal('sgd', @obj.source)
+    end
+
+    def test_feature
+      assert_equal('gene', @obj.feature)
+    end
+
+    def test_start
+      assert_equal('151453', @obj.start)
+    end
+
+    def test_end
+      assert_equal('151591', @obj.end)
+    end
+
+    def test_score
+      assert_equal('.', @obj.score)
+    end
+
+    def test_strand
+      assert_equal('+', @obj.strand)
+    end
+
+    def test_frame
+      assert_equal('.', @obj.frame)
+    end
+
+    def test_attributes
+      at = {"Note"=>'"Chromosome I Centromere"', "Gene"=>'"CEN1"'}
+      assert_equal(at, @obj.attributes)
+    end
+
+    def test_comments
+      assert_equal(nil, @obj.comments)
+    end
+
+  end # class TestGFFRecord
+  
+  
+  class TestGFFRecordConstruct < Test::Unit::TestCase
+
+    def setup
+      @obj = Bio::GFF.new
+    end
+
+    def test_add_seqname
+      name = "test"
+      record = Bio::GFF::Record.new("")
+      record.seqname = name
+      @obj.records << record
+      assert_equal(name, @obj.records[0].seqname)
+    end
+
+  end # class TestGFFRecordConstruct
+end

data/test/unit/bio/db/test_lasergene.rb

@@ -0,0 +1,95 @@
+#
+# test/unit/bio/db/test_rebase.rb - Unit test for Bio::Lasergene
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2007 Center for Biomedical Research Informatics, University of Minnesota (http://cbri.umn.edu)
+# License::   The Ruby License
+#
+#  $Id: test_lasergene.rb,v 1.2 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio'
+require 'bio/db/lasergene'
+
+module Bio #:nodoc:
+  class TestLasergene < Test::Unit::TestCase #:nodoc:
+    
+    def setup
+      file_format_1 = <<END
+"Contig 1" (1,934)
+  Contig Length:                  934 bases
+  Average Length/Sequence:        467 bases
+  Total Sequence Length:         1869 bases
+  Top Strand:                       2 sequences
+  Bottom Strand:                    2 sequences
+  Total:                            4 sequences
+^^
+ATGACGTATCCAAAGAGGCGTTACCGGAGAAGAAGACACCGCCCCCGCAGTCCTCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCGTCCACCCCCGCCACAGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAWCACCCGCCTATCCCGCAYCTTCGGAWRTACTATCAAGCGAACCACAGTCAGAACGCCCTCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAATGGGCTCCAGTGCTGWTATTCTAGMTGATRRCTTKGTAACAAAGRCCACAGCCCTCACCTATGACCCCTATGTAAACTTCTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCRCTCCCGYTACTTTACCCCCAAACCTGTCCTWGATKCCACTATKGATKACTKCCAACCAAACAACAAAAGAAACCAGCTGTGGSTGAGACTACAWACTGCTGGAAATGTAGACCWCGTAGGCCTSGGCACTGCGTKCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTMACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCRCTTMACCCKTAATGAATAATAAMAACCATTACGAAGTGATAAAAWAGWCTCAGTAATTTATTYCATATGGAAATTCWSGGCATGGGGGGGAAAGGGTGACGAACKKGCCCCCTTCCTCCSTSGMYTKTTCYGTAGCATTCYTCCAMAAYACCWAGGCAGYAMTCCTCCSATCAAGAGcYTSYACAGCTGGGACAGCAGTTGAGGAGGACCATTCAAAGGGGGTCGGATTGCTGGTAATCAGA
+END
+
+      file_format_2 = <<END
+^^:                                  350,935
+Contig 1 (1,935)
+  Contig Length:                  935 bases
+  Average Length/Sequence:        580 bases
+  Total Sequence Length:         2323 bases
+  Top Strand:                       2 sequences
+  Bottom Strand:                    2 sequences
+  Total:                            4 sequences
+^^
+ATGTCGGGGAAATGCTTGACCGCGGGCTACTGCTCATCATTGCTTTCTTTGTGGTATATCGTGCCGTTCTGTTTTGCTGTGCTCGTCAACGCCAGCGGCGACAGCAGCTCTCATTTTCAGTCGATTTATAACTTGACGTTATGTGAGCTGAATGGCACGAACTGGCTGGCAGACAACTTTAACTGGGCTGTGGAGACTTTTGTCATCTTCCCCGTGTTGACTCACATTGTTTCCTATGGTGCACTCACTACCAGTCATTTTCTTGACACAGTTGGTCTAGTTACTGTGTCTACCGCCGGGTTTTATCACGGGCGGTACGTCTTGAGTAGCATCTACGCGGTCTGTGCTCTGGCTGCGTTGATTTGCTTCGCCATCAGGTTTGCGAAGAACTGCATGTCCTGGCGCTACTCTTGCACTAGATACACCAACTTCCTCCTGGACACCAAGGGCAGACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAAAGGGGGTAAGGTTGAGGTCGAAGGTCATCTGATCGATCTCAAAAGAGTTGTGCTTGATGGCTCTGTGGCGACACCTTTAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCCTAGACGACTTTTGCCATGATAGTACAGCCCCACAGAAGGTGCTCTTGGCGTTTTCCATCACCTACACGCCAGTGATGATATATGCCCTAAAGGTAAGCCGCGGCCGACTTTTGGGGCTTCTGCACCTTTTGATTTTTTTGAACTGTGCCTTTACTTTCGGGTACATGACATTCGTGCACTTTCGGAGCACGAACAAGGTCGCGCTCACTATGGGAGCAGTAGTCGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTG
+END
+
+      file_format_3 = <<END
+LOCUS       PRU87392               15411 bp    RNA     linear   VRL 17-NOV-2000
+DEFINITION  Porcine reproductive and respiratory syndrome virus strain VR-2332,
+            complete genome.
+ACCESSION   U87392 AF030244 U00153
+VERSION     U87392.3  GI:11192298
+[...cut...]
+     3'UTR           15261..15411
+     polyA_site      15409
+ORIGIN      
+^^
+atgacgtataggtgttggctctatgccttggcatttgtattgtcaggagctgtgaccattggcacagcccaaaacttgctgcacagaaacacccttctgtgatagcctccttcaggggagcttagggtttgtccctagcaccttgcttccggagttgcactgctttacggtctctccacccctttaaccatgtctgggatacttgatcggtgcacgtgtacccccaatgccagggtgtttatggcggagggccaagtctactgcacacgatgcctcagtgcacggtctctccttcccctgaacctccaagtttctgagctcggggtgctaggcctattctacaggcccgaagagccactccggtggacgttgccacgtgcattccccactgttgagtgctcccccgccggggcctgctggctttctgcaatctttccaatcgcacgaatgaccagtggaaacctgaacttccaacaaagaatggtacgggtcgcagctgagctttacagagccggccagctcacccctgcagtcttgaaggctctacaagtttatgaacggggttgccgctggtaccccattgttggacctgtccctggagtggccgttttcgccaattccctacatgtgagtgataaacctttcccgggagcaactcacgtgttgaccaacctgccgctcccgcagagacccaagcctgaagacttttgcccctttgagtgtgctatggctactgtctatgacattggtcatgacgccgtcatgtatgtggccgaaaggaaagtctcctgggcccctcgtggcggggatgaagtgaaatttgaagctgtccccggggagttgaagttgattgcgaaccggctccgcacctccttcccgccccaccacacagtggacatgtctaagttcgccttcacagcccctgggtgtggtgtttctatgcgggtcgaacgccaacacggctgccttcccgctgacactgtccctgaaggcaactgctggtggagcttgtttgacttgcttccactggaagttcagaacaaagaaattcgccatgctaaccaatttggctaccagaccaagcatggtgtctctggcaagtacctacagcggaggctgca
+END
+
+      @lc = Bio::Lasergene
+      @obj1 = @lc.new(file_format_1)
+      @obj2 = @lc.new(file_format_2)
+      @obj3 = @lc.new(file_format_3)
+    end
+
+    def test_methods
+      a1 = @obj1
+      a1_seq = 'atgacgtatccaaagaggcgttaccggagaagaagacaccgcccccgcagtcctcttggccagatcctccgccgccgcccctggctcgtccacccccgccacagttaccgctggagaaggaaaaatggcatcttcawcacccgcctatcccgcaycttcggawrtactatcaagcgaaccacagtcagaacgccctcctgggcggtggacatgatgagattcaatattaatgactttcttcccccaggagggggctcaaacccccgctctgtgccctttgaatactacagaataagaaaggttaaggttgaattctggccctgctccccgatcacccagggtgacaggggaatgggctccagtgctgwtattctagmtgatrrcttkgtaacaaagrccacagccctcacctatgacccctatgtaaacttctcctcccgccataccataacccagcccttctcctaccrctcccgytactttacccccaaacctgtcctwgatkccactatkgatkactkccaaccaaacaacaaaagaaaccagctgtggstgagactacawactgctggaaatgtagaccwcgtaggcctsggcactgcgtkcgaaaacagtatatacgaccaggaatacaatatccgtgtmaccatgtatgtacaattcagagaatttaatcttaaagaccccccrcttmacccktaatgaataataamaaccattacgaagtgataaaawagwctcagtaatttattycatatggaaattcwsggcatgggggggaaagggtgacgaackkgcccccttcctccstsgmytkttcygtagcattcytccamaayaccwaggcagyamtcctccsatcaagagcytsyacagctgggacagcagttgaggaggaccattcaaagggggtcggattgctggtaatcaga'
+      a2 = @obj2
+      a2_seq = 'atgtcggggaaatgcttgaccgcgggctactgctcatcattgctttctttgtggtatatcgtgccgttctgttttgctgtgctcgtcaacgccagcggcgacagcagctctcattttcagtcgatttataacttgacgttatgtgagctgaatggcacgaactggctggcagacaactttaactgggctgtggagacttttgtcatcttccccgtgttgactcacattgtttcctatggtgcactcactaccagtcattttcttgacacagttggtctagttactgtgtctaccgccgggttttatcacgggcggtacgtcttgagtagcatctacgcggtctgtgctctggctgcgttgatttgcttcgccatcaggtttgcgaagaactgcatgtcctggcgctactcttgcactagatacaccaacttcctcctggacaccaagggcagactctatcgttggcggtcgcctgtcatcatagagaaagggggtaaggttgaggtcgaaggtcatctgatcgatctcaaaagagttgtgcttgatggctctgtggcgacacctttaaccagagtttcagcggaacaatggggtcgtccctagacgacttttgccatgatagtacagccccacagaaggtgctcttggcgttttccatcacctacacgccagtgatgatatatgccctaaaggtaagccgcggccgacttttggggcttctgcaccttttgatttttttgaactgtgcctttactttcgggtacatgacattcgtgcactttcggagcacgaacaaggtcgcgctcactatgggagcagtagtcgcactcctttggggggtgtactcagccatagaaacctggaaattcatcacctccagatgccgttgtgcttgctaggccgcaagtacattctggcccctgcccaccacgttg'
+      a3 = @obj3
+      a3_seq = 'atgacgtataggtgttggctctatgccttggcatttgtattgtcaggagctgtgaccattggcacagcccaaaacttgctgcacagaaacacccttctgtgatagcctccttcaggggagcttagggtttgtccctagcaccttgcttccggagttgcactgctttacggtctctccacccctttaaccatgtctgggatacttgatcggtgcacgtgtacccccaatgccagggtgtttatggcggagggccaagtctactgcacacgatgcctcagtgcacggtctctccttcccctgaacctccaagtttctgagctcggggtgctaggcctattctacaggcccgaagagccactccggtggacgttgccacgtgcattccccactgttgagtgctcccccgccggggcctgctggctttctgcaatctttccaatcgcacgaatgaccagtggaaacctgaacttccaacaaagaatggtacgggtcgcagctgagctttacagagccggccagctcacccctgcagtcttgaaggctctacaagtttatgaacggggttgccgctggtaccccattgttggacctgtccctggagtggccgttttcgccaattccctacatgtgagtgataaacctttcccgggagcaactcacgtgttgaccaacctgccgctcccgcagagacccaagcctgaagacttttgcccctttgagtgtgctatggctactgtctatgacattggtcatgacgccgtcatgtatgtggccgaaaggaaagtctcctgggcccctcgtggcggggatgaagtgaaatttgaagctgtccccggggagttgaagttgattgcgaaccggctccgcacctccttcccgccccaccacacagtggacatgtctaagttcgccttcacagcccctgggtgtggtgtttctatgcgggtcgaacgccaacacggctgccttcccgctgacactgtccctgaaggcaactgctggtggagcttgtttgacttgcttccactggaagttcagaacaaagaaattcgccatgctaaccaatttggctaccagaccaagcatggtgtctctggcaagtacctacagcggaggctgca'
+      
+      assert_equal(a1_seq, a1.seq.seq)
+      assert_equal(a2_seq, a2.seq.seq)
+      assert_equal(a3_seq, a3.seq.seq)
+      
+      assert_equal('"Contig 1"', a1.entry_id)
+      assert_equal('Contig 1', a2.name)
+      assert_equal(nil, a3.name)
+      
+      assert_equal(4, a1.total_sequences)
+      assert_equal(4, a2.total_sequences)
+      assert_equal(nil, a3.total_sequences)
+
+      assert_equal(true, a1.standard_comment?)
+      assert_equal(true, a2.standard_comment?)
+      assert_equal(false, a3.standard_comment?) 
+    end
+
+  end
+
+end

data/test/unit/bio/db/test_newick.rb

@@ -0,0 +1,293 @@
+#
+# = test/bio/db/newick.rb - Unit test for Bio::Newick
+#
+# Copyright::   Copyright (C) 2004-2006
+#               Daniel Amelang <dan@amelang.net>
+#               Naohisa Goto <ng@bioruby.org>
+# License::     The Ruby License
+#
+# $Id: test_newick.rb,v 1.6 2007/12/12 16:06:22 ngoto Exp $
+#
+
+require 'test/unit'
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), [".."] * 4, "lib")).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'bio'
+require 'bio/tree'
+require 'bio/db/newick'
+
+module Bio
+  class TestNewick < Test::Unit::TestCase
+
+    TREE_STRING = <<-END_OF_TREE_STRING
+    (
+      (
+        HexLEZ35:0.00263,
+        HexMCZ42:0.00788
+      ):0.00854,
+      (
+        HexFLZ48:0.00457,
+        (
+          HexFLZ83:0.00217,
+          HexFLZ13:0.00574
+        ):0.00100
+      ):0.04692,
+      HexLEZ73:0.00268
+    )[0.1250];
+    END_OF_TREE_STRING
+
+    def test_string_tree
+      newick = Bio::Newick.new(TREE_STRING)
+      tree = newick.tree
+      assert_equal(3, tree.children(tree.root).size)
+      assert_equal(9, tree.descendents(tree.root).size)
+      assert_equal(6, tree.leaves.size)
+      leaf = tree.get_node_by_name('HexFLZ83')
+      assert_equal(3, tree.ancestors(leaf).size)
+      assert_equal(tree.path(tree.root, leaf)[1], tree.ancestors(leaf)[1])
+      assert_equal(0.00217, tree.get_edge(leaf, tree.parent(leaf)).distance)
+      assert_equal("HexFLZ83", leaf.name)
+    end
+
+  end #class TestNewick
+
+  class TestNewick2 < Test::Unit::TestCase
+
+    TREE_STRING = <<-END_OF_TREE_STRING
+    (
+      (
+        'this is test':0.0625,
+        'test2 (abc, def)':0.125
+      ) 'internal node''s name' : 0.25,
+      (
+        '''':0.03125,
+        (
+          'ABCAC_HUMAN [ABC superfamily]':0.015625,
+          hypothetical_protein:0.5
+        ) ABC : 0.25 [99]
+      ) test3 :0.5
+    )root;
+    END_OF_TREE_STRING
+
+    def test_string_tree
+      newick = Bio::Newick.new(TREE_STRING)
+      tree = newick.tree
+      assert_equal('root', tree.root.name)
+      assert_equal([ 
+                    "this is test",
+                    "test2 (abc, def)",
+                    "internal node\'s name",
+                    "\'",
+                    "ABCAC_HUMAN [ABC superfamily]",
+                    "hypothetical protein",
+                    "ABC",
+                    "test3",
+                    "root"
+                   ].sort,
+                   tree.nodes.collect { |x| x.name }.sort)
+
+      assert_equal(tree.children(tree.root).collect { |x| x.name }.sort,
+                   [ "internal node\'s name", "test3" ])
+
+      node = tree.get_node_by_name('ABC')
+      assert_equal(99, node.bootstrap)
+
+      assert_equal(1.5625,
+                   tree.distance(tree.get_node_by_name('hypothetical protein'),
+                                 tree.get_node_by_name('this is test')))
+    end
+
+  end #class TestNewick2
+
+  class TestNewickPrivate < Test::Unit::TestCase
+    def setup
+      @newick = Bio::Newick.new('') # dummy data
+    end
+
+    def test_parse_newick_leaf
+      leaf_tokens = [ "A:B _C(D,E)F\'s G[H]", :":", '0.5', :"[",
+                      "&&NHX", :":", "S=human", :":", "E=1.1.1.1", :"]" ]
+      node = Bio::Tree::Node.new
+      edge = Bio::Tree::Edge.new
+      options = {}
+
+      assert_equal(true,
+                   @newick.instance_eval do
+                     __parse_newick_leaf(leaf_tokens, node, edge, options)
+                   end)
+
+      assert_equal(:nhx, @newick.options[:original_format])
+      assert_equal("A:B _C(D,E)F\'s G[H]", node.name)
+      assert_equal("human", node.scientific_name)
+      assert_equal("1.1.1.1", node.ec_number)
+      assert_equal(0.5, edge.distance)
+    end
+
+    def test_parse_newick_get_tokens_for_leaf
+      input = [ "A:B _C(D,E)F\'s G[H]", :":", '0.5', :"[",
+                "&&NHX", :":", "S=human", :":", "E=1.1.1.1", :"]",
+                :",", :"(", "bbb", :":", "0.2", :")" ]
+      leaf_should_be = [ "A:B _C(D,E)F\'s G[H]", :":", '0.5', :"[",
+                "&&NHX", :":", "S=human", :":", "E=1.1.1.1", :"]" ]
+      rest_should_be = [ :",", :"(", "bbb", :":", "0.2", :")" ]
+
+      assert_equal(leaf_should_be, 
+                   @newick.instance_eval do
+                     __parse_newick_get_tokens_for_leaf(input)
+                   end)
+
+      assert_equal(rest_should_be, input)
+    end
+
+    def test_parse_newick_tokenize
+      examples =
+        [
+         [ 
+          '(a,b);', # input
+          [ :"(", 'a', :",", 'b', :")" ], # normal parser result
+          [ :"(", 'a', :",", 'b', :")" ], # naive parser result
+         ],
+         [
+          # input
+          "(\'A:B _C(D,E)F\'\'s G[H]\':0.5[&&NHX:S=human:E=1.1.1.1], \n(bbb:0.2, c_d_e[&&NHX:B=100]);",
+            # normal parser result
+            [ :"(", "A:B _C(D,E)F\'s G[H]", :":", '0.5', :"[",
+            "&&NHX", :":", "S=human", :":", "E=1.1.1.1", :"]",
+            :",", :"(", "bbb", :":", "0.2", :",", 
+            "c d e", :"[", "&&NHX", :":", "B=100", :"]", :")" ],
+            # naive parser result
+            [ :"(", "\'A", :":", "B _C", :"(", "D", :",", "E",
+            :")", "F\'\'s G", :"[", "H", :"]", "\'", :":", '0.5', :"[",
+            "&&NHX", :":", "S=human", :":", "E=1.1.1.1", :"]",
+            :",", :"(", "bbb", :":", "0.2", :",", 
+            "c_d_e", :"[", "&&NHX", :":", "B=100", :"]", :")" ]
+          ]
+        ]
+
+      examples.each do |a|
+        # normal parser
+        assert_equal(a[1],
+                     @newick.instance_eval do
+                       __parse_newick_tokenize(a[0], {})
+                     end)
+
+        # naive parser
+        assert_equal(a[2],
+                     @newick.instance_eval do
+                       __parse_newick_tokenize(a[0], { :parser => :naive })
+                     end)
+      end
+    end
+  end #class TestNewickPrivate
+
+  class TestBioTreeOutputPrivate < Test::Unit::TestCase
+
+    def setup
+      @tree = Bio::Tree.new
+    end
+
+    def test_to_newick_format_label
+      # unquoted_label
+      assert_equal('ABC', @tree.instance_eval do
+                     __to_newick_format_label('ABC', {})
+                   end)
+
+      # unquoted_label, replaces blank to underscore
+      assert_equal('A_B_C', @tree.instance_eval do
+                     __to_newick_format_label('A B C', {})
+                   end)
+
+      # quoted_label example 1
+      assert_equal("\'A B_C\'", @tree.instance_eval do
+                     __to_newick_format_label('A B_C', {})
+                   end)
+
+      # quoted_label example 2
+      assert_equal("\'A(B),C\'", @tree.instance_eval do
+                     __to_newick_format_label('A(B),C', {})
+                   end)
+
+      # normal formatter
+      assert_equal("\'A_B_C\'", @tree.instance_eval do
+                     __to_newick_format_label('A_B_C', {})
+                   end)
+      # naive formatter
+      assert_equal("A_B_C", @tree.instance_eval do
+                     __to_newick_format_label('A_B_C',
+                                              { :parser => :naive })
+                   end)
+    end
+
+
+    def test_to_newick_format_leaf
+      node = Bio::Tree::Node.new('ABC')
+      edge = Bio::Tree::Edge.new(0.5)
+
+      assert_equal('ABC:0.5', @tree.instance_eval do
+                     __to_newick_format_leaf(node, edge, {})
+                   end)
+
+      # disable branch length
+      assert_equal('ABC', @tree.instance_eval do
+                     __to_newick_format_leaf(node, edge,
+                                             { :branch_length_style =>
+                                               :disabled })
+                   end)
+
+      node.bootstrap = 98
+      # default: molphy style bootstrap
+      assert_equal('ABC:0.5[98]', @tree.instance_eval do
+                     __to_newick_format_leaf(node, edge, {})
+                   end)
+      # force molphy style bootstrap
+      assert_equal('ABC:0.5[98]', @tree.instance_eval do
+                     __to_newick_format_leaf(node, edge,
+                                             { :bootstrap_style => :molphy })
+                   end)
+      # disable bootstrap output
+      assert_equal('ABC:0.5', @tree.instance_eval do
+                     __to_newick_format_leaf(node, edge,
+                                             { :bootstrap_style =>
+                                               :disabled })
+                   end)
+
+      # force traditional bootstrap style
+      assert_equal('ABC98:0.5', @tree.instance_eval do
+                     __to_newick_format_leaf(node, edge,
+                                             { :bootstrap_style =>
+                                               :traditional })
+                   end)
+      # normally, when traditional style, no node name allowed for the node
+      node2 = Bio::Tree::Node.new
+      node2.bootstrap = 98
+      assert_equal('98:0.5', @tree.instance_eval do
+                     __to_newick_format_leaf(node2, edge,
+                                             { :bootstrap_style =>
+                                               :traditional })
+                   end)
+      
+    end
+
+    def test_to_newick_format_leaf_NHX
+      node = Bio::Tree::Node.new('ADH')
+      edge = Bio::Tree::Edge.new(0.5)
+      node.bootstrap = 98
+      node.ec_number = '1.1.1.1'
+      node.scientific_name = 'human'
+      node.taxonomy_id = '9606'
+      node.events.push :gene_duplication
+      edge.log_likelihood = 1.5
+      edge.width = 3
+
+      str = 'ADH:0.5[&&NHX:B=98:D=Y:E=1.1.1.1:L=1.5:S=human:T=9606:W=3]'
+      assert_equal(str, @tree.instance_eval do
+                     __to_newick_format_leaf_NHX(node, edge, {})
+                   end)
+    end
+
+  end #class TestBioTreeOutputPrivate
+
+end #module Bio