jandot-bio 1.2.1

data/test/unit/bio/util/restriction_enzyme/test_single_strand_complement.rb

@@ -0,0 +1,147 @@
+#
+# test/unit/bio/util/restriction_enzyme/test_single_strand_complement.rb - Unit test for Bio::RestrictionEnzyme::SingleStrandComplement
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com)
+# License::   The Ruby License
+#
+#  $Id: test_single_strand_complement.rb,v 1.3 2007/04/05 23:35:44 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/util/restriction_enzyme/single_strand_complement'
+
+module Bio #:nodoc:
+
+class TestSingleStrandComplement < Test::Unit::TestCase #:nodoc:
+
+  def setup
+    @t = Bio::RestrictionEnzyme::SingleStrandComplement
+    @cl = Bio::RestrictionEnzyme::SingleStrand::CutLocationsInEnzymeNotation
+    @s = Bio::Sequence::NA
+
+    @obj_1 = @t.new(@s.new('gata'), @cl.new(-2,1,3))
+    @obj_2 = @t.new('gata', -2, 1, 3)
+    @obj_3 = @t.new('garraxt', [-2, 1, 7])
+    @obj_4 = @t.new('nnnnnnngarraxtnn', [-2, 1, 7])
+
+    @obj_5 = @t.new('ga^rr^axt')
+    @obj_6 = @t.new('^ga^rr^axt')
+    @obj_7 = @t.new('n^ngar^raxtnn^n')
+  end
+
+  def test_pattern_palindromic?
+    assert_equal(true, @t.new('atgcat', 1).palindromic?)
+    assert_equal(false, @t.new('atgcgta', 1).palindromic?)
+
+    assert_equal(false, @obj_1.palindromic?)
+    assert_equal(false, @obj_2.palindromic?)
+    assert_equal(false, @obj_3.palindromic?)
+    assert_equal(false, @obj_4.palindromic?)
+  end
+
+  def test_stripped
+    assert_equal('gata', @obj_1.stripped)
+    assert_equal('gata', @obj_2.stripped)
+    assert_equal('garraxt', @obj_3.stripped)
+    assert_equal('garraxt', @obj_4.stripped)
+  end
+
+  def test_pattern
+    assert_equal('nngata', @obj_1.pattern)
+    assert_equal('nngata', @obj_2.pattern)
+    assert_equal('nngarraxtn', @obj_3.pattern)
+    assert_equal('nngarraxtn', @obj_4.pattern)
+
+    assert_equal('nngata', @obj_1)
+    assert_equal('nngata', @obj_2)
+    assert_equal('nngarraxtn', @obj_3)
+    assert_equal('nngarraxtn', @obj_4)
+  end
+
+  def test_with_cut_symbols
+    assert_equal('n^ng^at^a', @obj_1.with_cut_symbols)
+    assert_equal('n^ng^at^a', @obj_2.with_cut_symbols)
+    assert_equal('n^ng^arraxt^n', @obj_3.with_cut_symbols)
+    assert_equal('n^ng^arraxt^n', @obj_4.with_cut_symbols)
+  end
+
+  def test_with_spaces
+    assert_equal('n^n g^a t^a', @obj_1.with_spaces)
+    assert_equal('n^n g^a t^a', @obj_2.with_spaces)
+    assert_equal('n^n g^a r r a x t^n', @obj_3.with_spaces)
+    assert_equal('n^n g^a r r a x t^n', @obj_4.with_spaces)
+  end
+
+  def test_cut_locations_in_enzyme_notation
+    assert_equal([-2,1,3], @obj_1.cut_locations_in_enzyme_notation)
+    assert_equal([-2,1,3], @obj_2.cut_locations_in_enzyme_notation)
+    assert_equal([-2,1,7], @obj_3.cut_locations_in_enzyme_notation)
+    assert_equal([-2,1,7], @obj_4.cut_locations_in_enzyme_notation)
+
+    assert_equal([2,4], @obj_5.cut_locations_in_enzyme_notation)
+    assert_equal([-1,2,4], @obj_6.cut_locations_in_enzyme_notation)
+    assert_equal([-2,3,9], @obj_7.cut_locations_in_enzyme_notation)
+  end
+
+  def test_cut_locations
+    assert_equal([0,2,4], @obj_1.cut_locations)
+    assert_equal([0,2,4], @obj_2.cut_locations)
+    assert_equal([0,2,8], @obj_3.cut_locations)
+    assert_equal([0,2,8], @obj_4.cut_locations)
+
+    assert_equal([1,3], @obj_5.cut_locations)
+    assert_equal([0,2,4], @obj_6.cut_locations)
+    assert_equal([0,4,10], @obj_7.cut_locations)
+  end
+
+  def test_orientation
+    assert_equal([3,5], @obj_1.orientation)
+    assert_equal([3,5], @obj_2.orientation)
+    assert_equal([3,5], @obj_3.orientation)
+    assert_equal([3,5], @obj_4.orientation)
+  end
+
+  def test_creation_with_no_cuts
+    @obj_8 = @t.new('garraxt')
+    assert_equal([3,5], @obj_8.orientation)
+    assert_equal([], @obj_8.cut_locations)
+    assert_equal([], @obj_8.cut_locations_in_enzyme_notation)
+    assert_equal('garraxt', @obj_8.pattern)
+  end
+
+  # NOTE
+  def test_to_re
+  end
+
+  def test_argument_error
+    assert_raise(ArgumentError) { @t.new('a', [0,1,2]) }
+    assert_raise(ArgumentError) { @t.new('a', 0,1,2,0) }
+
+    assert_raise(ArgumentError) { @t.new('a', [nil,1,2]) }
+    assert_raise(ArgumentError) { @t.new('a', nil,1,2,nil) }
+
+    assert_raise(ArgumentError) { @t.new('a', [1,1,2]) }
+    assert_raise(ArgumentError) { @t.new('a', 1,1,2,2) }
+
+    assert_raise(ArgumentError) { @t.new(1, [1,2,3]) }
+    assert_raise(ArgumentError) { @t.new('gaat^aca', [1,2,3]) }
+    assert_raise(ArgumentError) { @t.new('gaat^^aca') }
+    assert_raise(ArgumentError) { @t.new('z', [1,2,3]) }
+
+    assert_raise(ArgumentError) { @t.new('g', [0,1,2]) }
+    assert_raise(ArgumentError) { @t.new('g', 0,1,2,0) }
+    assert_raise(ArgumentError) { @t.new('g', [0,1,1,2]) }
+    assert_raise(ArgumentError) { @t.new('g', 0,1,1,2,2) }
+    assert_raise(ArgumentError) { @t.new(1,2,3) }
+    assert_raise(ArgumentError) { @t.new(1,2,'g') }
+  end
+
+
+end
+
+end

data/test/unit/bio/util/restriction_enzyme/test_string_formatting.rb

@@ -0,0 +1,60 @@
+#
+# test/unit/bio/util/restriction_enzyme/test_string_formatting.rb - Unit test for Bio::RestrictionEnzyme::StringFormatting
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com)
+# License::   The Ruby License
+#
+#  $Id: test_string_formatting.rb,v 1.3 2007/04/05 23:35:44 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/util/restriction_enzyme/string_formatting'
+
+module Bio #:nodoc:
+
+class TestStringFormatting < Test::Unit::TestCase #:nodoc:
+
+  include Bio::RestrictionEnzyme::StringFormatting
+
+  def setup
+    @t = String
+    @obj_1 = @t.new('gata')
+    @obj_2 = @t.new('garraxt')
+    @obj_3 = @t.new('gArraXT')
+    @obj_4 = @t.new('nnnnnnngarraxtnn')
+  end
+
+  def test_strip_padding
+    assert_equal('gata', strip_padding(@obj_1))
+    assert_equal('garraxt', strip_padding(@obj_2))
+    assert_equal('gArraXT', strip_padding(@obj_3))
+    assert_equal('garraxt', strip_padding(@obj_4))
+  end
+
+  def test_left_padding
+    assert_equal('', left_padding(@obj_1))
+    assert_equal('', left_padding(@obj_2))
+    assert_equal('', left_padding(@obj_3))
+    assert_equal('nnnnnnn', left_padding(@obj_4))
+  end
+
+  def test_right_padding
+    assert_equal('', right_padding(@obj_1))
+    assert_equal('', right_padding(@obj_2))
+    assert_equal('', right_padding(@obj_3))
+    assert_equal('nn', right_padding(@obj_4))
+  end
+
+  def test_add_spacing
+    assert_equal('n^n g^a t^a', add_spacing('n^ng^at^a') )
+    assert_equal('n^n g^a r r a x t^n', add_spacing('n^ng^arraxt^n') )
+  end
+
+end
+
+end

data/test/unit/bio/util/test_color_scheme.rb

@@ -0,0 +1,33 @@
+#
+# test/unit/bio/util/test_color_scheme.rb - Unit test for Bio::ColorScheme
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com)
+# License::   The Ruby License
+#
+#  $Id: test_color_scheme.rb,v 1.3 2007/04/05 23:35:44 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4 , 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/util/color_scheme'
+
+module Bio #:nodoc:
+  class TestColorScheme < Test::Unit::TestCase #:nodoc:
+
+    def test_buried
+      s = Bio::ColorScheme::Buried
+      assert_equal('00DC22', s['A'])
+      assert_equal('00BF3F', s[:c])
+      assert_equal(nil, s[nil])
+      assert_equal('FFFFFF', s['-'])
+      assert_equal('FFFFFF', s[7])
+      assert_equal('FFFFFF', s['junk'])
+      assert_equal('00CC32', s['t'])
+    end
+
+  end
+end

data/test/unit/bio/util/test_contingency_table.rb

@@ -0,0 +1,94 @@
+#
+# test/unit/bio/util/test_contingency_table.rb - Unit test for Bio::ContingencyTable
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com)
+# License::   The Ruby License
+#
+#  $Id: test_contingency_table.rb,v 1.4 2007/04/05 23:35:44 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4 , 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/util/contingency_table'
+
+module Bio #:nodoc:
+  class TestContingencyTable < Test::Unit::TestCase #:nodoc:
+ 
+    def lite_example(sequences, max_length, characters)
+
+      output = []
+
+      0.upto(max_length - 1) do |i|
+        (i+1).upto(max_length - 1) do |j|
+          ctable = Bio::ContingencyTable.new( characters )
+          sequences.each do |seq|
+            i_char = seq[i].chr
+            j_char = seq[j].chr
+            ctable.table[i_char][j_char] += 1
+          end
+          chi_square = ctable.chi_square
+          contingency_coefficient = ctable.contingency_coefficient
+          output << [(i+1), (j+1), chi_square, contingency_coefficient]
+        end
+      end
+
+      return output
+    end
+
+
+    def test_lite_example
+      ctable = Bio::ContingencyTable
+      allowed_letters = 'abcdefghijk'.split('')
+
+      seqs = Array.new
+      seqs << 'abcde'
+      seqs << 'abcde'
+      seqs << 'kacje'
+      seqs << 'aacae'
+      seqs << 'akcfa'
+      seqs << 'akcfe'
+
+      length_of_every_sequence = seqs[0].size  # 5 letters long
+
+      results = lite_example(seqs, length_of_every_sequence, allowed_letters)
+
+=begin
+  i           j           chi_square  contingency_coefficient
+  1           2           2.4         0.534522483824849
+  1           3           0.0         0.0
+  1           4           6.0         0.707106781186548
+  1           5           0.24        0.196116135138184
+  2           3           0.0         0.0
+  2           4           12.0        0.816496580927726
+  2           5           2.4         0.534522483824849
+  3           4           0.0         0.0
+  3           5           0.0         0.0
+  4           5           2.4         0.534522483824849
+=end
+
+
+      #assert_equal(2.4, results[0][2])
+      assert_equal('2.4', results[0][2].to_s)
+      assert_equal('0.534522483824849', results[0][3].to_s)
+
+      assert_equal('12.0', results[5][2].to_s)
+      assert_equal('0.816496580927726', results[5][3].to_s)
+
+      assert_equal('2.4', results[9][2].to_s)
+      assert_equal('0.534522483824849', results[9][3].to_s)
+
+      ctable = Bio::ContingencyTable.new
+      ctable.table['a']['t'] = 4
+      ctable.table['a']['g'] = 2
+      ctable.table['g']['t'] = 3
+      assert_equal('1.28571428571429', ctable.chi_square.to_s)
+      assert_equal(ctable.column_sum_all, ctable.row_sum_all)
+      assert_equal(ctable.column_sum_all, ctable.table_sum_all)
+    end
+
+  end
+end

data/test/unit/bio/util/test_restriction_enzyme.rb

@@ -0,0 +1,42 @@
+#
+# test/unit/bio/util/restriction_enzyme.rb - Unit test for Bio::RestrictionEnzyme
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2005-2007 Midwinter Laboratories, LLC (http://midwinterlabs.com)
+# License::   The Ruby License
+#
+#  $Id: test_restriction_enzyme.rb,v 1.3 2007/04/05 23:35:44 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/util/restriction_enzyme.rb'
+
+module Bio #:nodoc:
+
+class TestRestrictionEnzyme < Test::Unit::TestCase #:nodoc:
+
+  def setup
+    @t = Bio::RestrictionEnzyme
+  end
+  
+  def test_rebase
+    assert_equal(@t.rebase.respond_to?(:enzymes), true)
+    assert_not_nil @t.rebase['AarI']
+    assert_nil @t.rebase['blah']
+  end
+  
+  def test_enzyme_name
+    assert_equal(@t.enzyme_name?('AarI'), true)
+    assert_equal(@t.enzyme_name?('atgc'), false)
+    assert_equal(@t.enzyme_name?('aari'), true)
+    assert_equal(@t.enzyme_name?('EcoRI'), true)
+    assert_equal(@t.enzyme_name?('EcoooRI'), false)
+  end
+
+end
+
+end

data/test/unit/bio/util/test_sirna.rb

@@ -0,0 +1,245 @@
+#
+# test/unit/bio/util/test_sirna.rb - Unit test for Bio::SiRNA.
+#
+# Copyright::  Copyright (C) 2005 Mitsuteru C. Nakap <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_sirna.rb,v 1.4 2007/04/05 23:35:44 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4 , 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/util/sirna'
+
+module Bio
+
+  RANDOM_SEQ = "ctttcggtgcggacgtaaggagtattcctgtactaactaaatggagttaccaaggtaggaccacggtaaaatcgcgagcagcctcgatacaagcgttgtgctgaagcctatcgctgacctgaaggggggcgtaagcaaggcagcggttcaccttcatcagttctgctagaaatcacctagcaccccttatcatccgcgtcaggtccattacccttcccattatgtcggactcaattgaggtgcttgtgaacttatacttgaatccaaaacgtctactgtattggcgactaaaaagcacttgtggggagtcggcttgatcagcctccattagggccaggcactgaggatcatccagttaacgtcagattcaaggtctggctcttagcactcggagttgcac"
+
+  class TestSiRNANew < Test::Unit::TestCase
+    def test_new
+      naseq = Bio::Sequence::NA.new(RANDOM_SEQ)
+      assert(Bio::SiRNA.new(naseq))
+      assert(Bio::SiRNA.new(naseq, 21))
+      assert(Bio::SiRNA.new(naseq, 21, 60.0))
+      assert(Bio::SiRNA.new(naseq, 21, 60.0, 40.0))
+      assert_raise(ArgumentError) { Bio::SiRNA.new(naseq, 21, 60.0, 40.0, 10.0) }
+    end
+
+  end
+
+  class TestSiRNA < Test::Unit::TestCase
+    def setup
+      naseq = Bio::Sequence::NA.new(RANDOM_SEQ)
+      @obj = Bio::SiRNA.new(naseq)
+    end
+
+    def test_antisense_size
+      assert_equal(21, @obj.antisense_size)
+    end
+
+    def test_max_gc_percent
+      assert_equal(60.0, @obj.max_gc_percent)
+    end
+
+    def test_min_gc_percent
+      assert_equal(40.0, @obj.min_gc_percent)
+    end
+
+    def test_uitei?
+      target = "aaGaa"
+      assert_equal(false, @obj.uitei?(target))
+      target = "aaAaa"
+      assert_equal(false, @obj.uitei?(target))
+      target = "G" * 9
+      assert_equal(false, @obj.uitei?(target))
+    end
+
+    def test_reynolds?
+      target = "G" * 9
+      assert_equal(false, @obj.reynolds?(target))
+      target = "aaaaAaaaaaaUaaAaaaaaAaa"
+      assert_equal(true, @obj.reynolds?(target))
+    end
+
+    def test_uitei
+      assert(@obj.uitei)
+    end
+
+    def test_reynolds
+      assert(@obj.reynolds)
+    end
+
+    def test_design
+      assert(@obj.design)
+    end
+
+
+    def test_design_uitei
+      assert(@obj.design('uitei'))
+    end
+
+    def test_design_reynolds
+      assert(@obj.design('reynolds'))
+    end
+  end
+
+  class TestSiRNAPairNew < Test::Unit::TestCase
+    def test_new
+      target = ""
+      sense = ""
+      antisense = ""
+      start = 0
+      stop = 1
+      rule = 'rule'
+      gc_percent = 60.0
+      assert_raise(ArgumentError) { Bio::SiRNA::Pair.new(target, sense, antisense, start, stop, rule) }
+      assert(Bio::SiRNA::Pair.new(target, sense, antisense, start, stop, rule, gc_percent))
+      assert_raise(ArgumentError) { Bio::SiRNA::Pair.new(target, sense, antisense, start, stop, rule, gc_percent, "") }
+    end
+  end
+
+
+  class TestSiRNAPair < Test::Unit::TestCase
+    def setup
+      naseq = Bio::Sequence::NA.new(RANDOM_SEQ)
+      @obj = Bio::SiRNA.new(naseq).design.first
+    end
+
+    def test_target
+      assert_equal("gcggacguaaggaguauuccugu", @obj.target)
+    end
+
+    def test_sense
+      assert_equal("ggacguaaggaguauuccugu", @obj.sense)
+    end
+
+    def test_antisense
+      assert_equal("aggaauacuccuuacguccgc", @obj.antisense)
+    end
+
+    def test_start
+      assert_equal(9, @obj.start)
+    end
+
+    def test_stop
+      assert_equal(32, @obj.stop)
+    end
+
+    def test_rule
+      assert_equal("uitei", @obj.rule)
+    end
+
+    def test_gc_percent
+      assert_equal(52.0, @obj.gc_percent)
+    end
+
+    def test_report
+report =<<END
+### siRNA
+Start: 9
+Stop:  32
+Rule:  uitei
+GC %:  52
+Target:    GCGGACGUAAGGAGUAUUCCUGU
+Sense:       GGACGUAAGGAGUAUUCCUGU
+Antisense: CGCCUGCAUUCCUCAUAAGGA
+END
+      assert_equal(report, @obj.report)
+    end
+  end
+
+  class TestShRNANew < Test::Unit::TestCase
+    def test_new
+      pair = ""
+      assert(Bio::SiRNA::ShRNA.new(pair))
+      assert_raise(ArgumentError) { Bio::SiRNA::ShRNA.new }
+      assert_raise(ArgumentError) { Bio::SiRNA::ShRNA.new(pair, "") }
+    end
+  end
+
+  class TestShRNA < Test::Unit::TestCase
+    def setup
+      naseq = Bio::Sequence::NA.new(RANDOM_SEQ)
+      sirna = Bio::SiRNA.new(naseq)
+      pairs = sirna.design
+      @obj = Bio::SiRNA::ShRNA.new(pairs.first)
+    end
+
+    def test_top_strand
+      @obj.design
+      assert_equal("caccggacguaaggaguauuccugugtgtgctgtccacaggaauacuccuuacgucc", @obj.top_strand)
+    end
+
+    def test_top_strand_class
+      @obj.design
+      assert_equal(Bio::Sequence::NA, @obj.top_strand.class)
+    end
+
+    def test_top_strand_nil
+      assert_equal(nil, @obj.top_strand)
+    end
+
+    def test_bottom_strand
+      @obj.design
+      assert_equal("aaaaggacguaaggaguauuccuguggacagcacacacaggaauacuccuuacgucc", @obj.bottom_strand)
+    end
+
+    def test_bottom_strand_class
+      @obj.design
+      assert_equal(Bio::Sequence::NA, @obj.bottom_strand.class)
+    end
+
+    def test_bottom_strand_nil
+      assert_equal(nil, @obj.bottom_strand)
+    end
+
+    def test_design
+      assert(@obj.design)
+    end
+
+    def test_design_BLOCK_IT
+      assert_raises(NotImplementedError) { @obj.design('BLOCK-IT') }
+    end
+
+    def test_blocK_it
+      assert_equal("aaaaggacguaaggaguauuccuguggacagcacacacaggaauacuccuuacgucc", @obj.block_it)
+    end
+
+    def test_blocK_it_BLOCK_iT
+      assert_equal("aaaaggacguaaggaguauuccuguggacagcacacacaggaauacuccuuacgucc", @obj.block_it)
+    end
+
+    def test_blocK_it_BLOCK_IT
+      assert_raises(NotImplementedError) { @obj.block_it('BLOCK-IT') }
+    end
+
+    def test_blocK_it_piGene
+      assert_equal("aaaaggacguaaggaguauuccuguggacagcacacacaggaauacuccuuacgucc", @obj.block_it('piGENE'))
+    end
+
+    def test_blocK_it_
+      assert_raises(NotImplementedError) { @obj.block_it("") }
+    end
+    
+    def test_report
+      report =<<END
+### shRNA
+Top strand shRNA (57 nt):
+  5'-CACCGGACGUAAGGAGUAUUCCUGUGTGTGCTGTCCACAGGAAUACUCCUUACGUCC-3'
+Bottom strand shRNA (57 nt):
+      3'-CCUGCAUUCCUCAUAAGGACACACACGACAGGUGUCCUUAUGAGGAAUGCAGGAAAA-5'
+END
+      #@obj.design
+      @obj.block_it
+      assert_equal(report, @obj.report)
+    end
+
+    def test_report_before_design
+      assert_raises(NoMethodError) { @obj.report }
+    end
+  end
+
+end