jandot-bio 1.2.1

data/test/unit/bio/data/test_codontable.rb

@@ -0,0 +1,107 @@
+#
+# test/unit/bio/data/test_codontable.rb - Unit test for Bio::CodonTable
+#
+# Copyright::  Copyright (C) 2005 Mitsuteru Nakao <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_codontable.rb,v 1.6 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+
+require 'test/unit'
+require 'bio/data/codontable'
+
+module Bio
+  class TestCodonTableConstants < Test::Unit::TestCase
+    def test_Definitions
+      assert(Bio::CodonTable::DEFINITIONS)
+      assert(Bio::CodonTable::DEFINITIONS[1], "Standard (Eukaryote)")
+    end
+
+    def test_Starts
+      assert(Bio::CodonTable::STARTS)
+      assert_equal(['ttg', 'ctg', 'atg', 'gtg'], Bio::CodonTable::STARTS[1])
+    end
+
+    def test_stops
+      assert(Bio::CodonTable::STOPS)
+      assert_equal(['taa', 'tag', 'tga'], Bio::CodonTable::STOPS[1])
+    end
+
+    def test_Tables
+      assert(Bio::CodonTable::TABLES)
+    end
+  end
+
+
+  class TestCodonTable < Test::Unit::TestCase
+    
+    def setup
+      @ct = Bio::CodonTable[1]
+    end
+
+    def test_self_accessor
+      assert(Bio::CodonTable[1])
+    end
+
+    def test_self_copy
+      assert(Bio::CodonTable.copy(1))
+    end
+
+    def test_table
+      assert(@ct.table)
+    end
+
+    def test_definition
+      assert_equal("Standard (Eukaryote)", @ct.definition)
+    end
+    
+    def test_start
+      assert_equal(['ttg', 'ctg', 'atg', 'gtg'], @ct.start)
+    end
+
+    def test_stop
+      assert_equal(['taa', 'tag', 'tga'], @ct.stop)
+    end
+
+    def test_accessor #[]
+      assert_equal('M', @ct['atg'])
+    end
+
+    def test_set_accessor #[]=
+      alternative = 'Y'
+      @ct['atg'] = alternative
+      assert_equal(alternative, @ct['atg'])
+      @ct['atg'] = 'M'
+      assert_equal('M', @ct['atg'])
+    end
+
+    def test_each
+      assert(@ct.each {|x| })
+    end
+
+    def test_revtrans
+      assert_equal(['atg'], @ct.revtrans('M'))
+    end
+
+    def test_start_codon?
+      assert_equal(true, @ct.start_codon?('atg'))
+      assert_equal(false, @ct.start_codon?('taa'))
+    end
+
+    def test_stop_codon?
+      assert_equal(false, @ct.stop_codon?('atg'))
+      assert_equal(true, @ct.stop_codon?('taa'))
+    end
+
+
+    def test_Tables
+      assert_equal(@ct.table, Bio::CodonTable::TABLES[1])
+    end
+
+  end
+end # module Bio

data/test/unit/bio/data/test_na.rb

@@ -0,0 +1,80 @@
+#
+# test/unit/bio/data/test_na.rb - Unit test for Bio::NucleicAcid
+#
+# Copyright::  Copyright (C) 2005,2006 Mitsuteru Nakao <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_na.rb,v 1.9 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/data/na'
+
+module Bio
+
+  class TestNAConstants  < Test::Unit::TestCase
+    def test_NAMES
+      assert_equal('a', Bio::NucleicAcid::NAMES['a'])
+    end
+
+    def test_NAMES_1_to_name
+      assert_equal('Adenine', Bio::NucleicAcid::NAMES['A'])
+    end
+
+    def test_WEIGHT
+      mw = 135.15
+      assert_equal(mw, Bio::NucleicAcid::WEIGHT['a'])
+      assert_equal(mw, Bio::NucleicAcid::WEIGHT[:adenine])
+    end
+  end
+
+
+  class TestNA < Test::Unit::TestCase
+
+    def setup
+      @obj = Bio::NucleicAcid.new
+    end
+
+    def test_to_re
+      re = /[tcy][agr][atw][gcw][tgk][acm][tgcyskb][atgrwkd][agcmrsv][atgcyrwskmbdhvn]atgc/
+      str = 'yrwskmbdvnatgc'
+      str0 = str.clone
+      assert_equal(re, @obj.to_re(str))
+      assert_equal(str0, str)
+      assert_equal(re, Bio::NucleicAcid.to_re(str))
+    end
+
+
+    def test_weight
+      mw = 135.15
+      assert_equal(mw, @obj.weight('a'))
+      assert_equal(mw, Bio::NucleicAcid.weight('a'))
+    end
+
+    def test_weight_rna
+      mw = 135.15
+      assert_equal(mw, @obj.weight('A', true))
+      assert_equal(mw, Bio::NucleicAcid.weight('A', true))
+    end
+
+    
+    def test_accessor
+      assert_equal('Adenine', @obj['A'])
+    end
+    
+    def test_names
+      assert_equal(Bio::NucleicAcid::NAMES, @obj.names)
+    end
+    def test_na
+      assert_equal(Bio::NucleicAcid::NAMES, @obj.na)
+    end
+
+    def test_name
+      assert_equal('Adenine', @obj.name('A'))
+    end
+  end
+end

data/test/unit/bio/db/embl/test_common.rb

@@ -0,0 +1,117 @@
+#
+# test/unit/bio/db/embl/common.rb - Unit test for Bio::EMBL::COMMON module
+#
+# Copyright::  Copyright (C) 2005 Mitsuteru Nakao <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_common.rb,v 1.4 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/db/embl/common'
+
+
+module Bio
+
+  # TestClass EMBLDB Inherited 
+  class EMBL_API < EMBLDB
+    include Bio::EMBLDB::Common
+  end
+
+
+  class TestEMBLCommon < Test::Unit::TestCase
+
+    def setup
+      @obj = Bio::EMBLDB::Common
+    end
+
+    def test_ac
+      assert(@obj.instance_methods.find {|x| x ==  'ac' })
+    end
+
+    def test_accessions
+      assert(@obj.instance_methods.find {|x| x ==  'accessions' })
+    end
+    
+    def test_accession
+      assert(@obj.instance_methods.find {|x| x ==  'accession' })
+    end
+
+    def test_de
+      assert(@obj.instance_methods.find {|x| x ==  'de' })
+    end
+    
+    def test_description
+      assert(@obj.instance_methods.find {|x| x ==  'description' })
+    end
+
+    def test_definition
+      assert(@obj.instance_methods.find {|x| x ==  'definition' })
+    end
+
+    def test_os
+      assert(@obj.instance_methods.find {|x| x ==  'os' })
+    end
+
+    def test_og
+      assert(@obj.instance_methods.find {|x| x ==  'og' })
+    end
+    
+    def test_oc
+      assert(@obj.instance_methods.find {|x| x ==  'oc' })
+    end
+    
+    def test_kw
+      assert(@obj.instance_methods.find {|x| x ==  'kw' })
+    end
+
+    def test_keywords
+      assert(@obj.instance_methods.find {|x| x ==  'keywords' })
+    end
+
+    def test_ref
+      assert(@obj.instance_methods.find {|x| x ==  'ref' })
+    end
+
+    def test_references
+      assert(@obj.instance_methods.find {|x| x ==  'references' })
+    end
+
+    def test_dr
+      assert(@obj.instance_methods.find {|x| x ==  'dr' })
+    end
+  end
+
+
+  class TestEMBLAPI < Test::Unit::TestCase
+
+    def setup
+      data =<<END
+AC   A12345; B23456;
+DE   Dummy data for Bio::EMBL::Common APIs.
+OS   Ruby Class Library for Bioinformatics (BioRuby) (open-bio).
+OC   
+OG
+KW
+R
+DR
+END
+      @obj = Bio::EMBL_API.new(data)
+    end
+
+    def test_ac
+      assert_equal(["A12345", "B23456"], @obj.ac)
+    end
+
+    def test_accessions
+      assert_equal(["A12345", "B23456"], @obj.accessions)
+    end
+
+  end
+
+  
+end

data/test/unit/bio/db/embl/test_embl.rb

@@ -0,0 +1,214 @@
+#
+# test/unit/bio/db/embl/test_embl.rb - Unit test for Bio::EMBL
+#
+# Copyright::  Copyright (C) 2005 Mitsuteru Nakao <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_embl.rb,v 1.5 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+
+require 'test/unit'
+require 'bio/db/embl/embl'
+
+module Bio
+  class TestEMBL < Test::Unit::TestCase
+    
+    def setup
+    bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5)).cleanpath.to_s
+      output = File.open(File.join(bioruby_root, 'test', 'data', 'embl', 'AB090716.embl')).read
+      @obj = Bio::EMBL.new(output)
+    end
+
+    def test_id_line
+      assert(@obj.id_line)
+    end
+
+    def test_id_line_iterator
+      assert(@obj.id_line {|key, value| })
+    end
+
+    def test_id_line_entry_name
+      assert_equal('AB090716', @obj.id_line('ENTRY_NAME'))
+    end
+
+    def test_id_line_data_class
+      assert_equal('standard', @obj.id_line('DATA_CLASS'))
+    end
+
+    def test_id_line_molecule_type
+      assert_equal('genomic DNA', @obj.id_line('MOLECULE_TYPE'))
+    end
+
+    def test_id_line_division
+      assert_equal('VRT', @obj.id_line('DIVISION'))
+    end
+
+    def test_id_line_sequence_length
+      assert_equal(166, @obj.id_line('SEQUENCE_LENGTH'))
+    end
+    
+    def test_entry
+      entry_id = 'AB090716'
+      assert_equal(entry_id, @obj.entry)
+      assert_equal(entry_id, @obj.entry_name)
+      assert_equal(entry_id, @obj.entry_id)
+    end
+
+    def test_molecule
+      molecule = 'genomic DNA'
+      assert_equal(molecule, @obj.molecule)
+      assert_equal(molecule, @obj.molecule_type)
+    end
+
+    def test_division
+      assert_equal('VRT', @obj.division)
+    end
+    
+    def test_sequence_length
+      seqlen = 166
+      assert_equal(seqlen, @obj.sequence_length)
+      assert_equal(seqlen, @obj.seqlen)
+    end
+
+    # Bio::EMBLDB::COMMON#ac
+    def test_ac 
+      ac = ['AB090716']
+      assert_equal(ac, @obj.ac)
+      assert_equal(ac, @obj.accessions)
+    end
+
+    # Bio::EMBLDB::COMMON#accession
+    def test_accession
+      assert_equal('AB090716', @obj.accession)
+    end
+
+    def test_sv
+      assert_equal('AB090716.1', @obj.sv)
+    end
+
+    def test_version
+      assert_equal(1, @obj.version)
+    end
+
+    def test_dt
+      assert(@obj.dt)
+    end
+
+    def test_dt_iterator
+      assert(@obj.dt {|key, value| })
+    end
+
+    def test_dt_created
+      assert_equal('25-OCT-2002 (Rel. 73, Created)', @obj.dt('created'))
+    end
+
+    def test_dt_updated
+      assert_equal('29-NOV-2002 (Rel. 73, Last updated, Version 2)', @obj.dt('updated'))
+    end
+
+    # Bio::EMBLDB::COMMON#de
+    def test_de
+      assert_equal("Haplochromis sp. 'muzu, rukwa' LWS gene for long wavelength-sensitive opsin, partial cds, specimen_voucher:specimen No. HT-9361.", @obj.de)
+    end
+
+    # Bio::EMBLDB::COMMON#kw
+    def test_kw 
+      k = []
+      assert_equal([], @obj.kw)
+      assert_equal([], @obj.keywords)
+    end
+
+    def test_os
+#      assert_equal('', @obj.os)
+      assert_raises(RuntimeError) { @obj.os }
+    end
+
+    def test_os_valid
+      @obj.instance_eval { @data['OS'] = "Haplochromis sp. 'muzu rukwa'" }
+      assert_equal("Haplochromis sp. 'muzu rukwa'", @obj.os)
+    end
+
+    # Bio::EMBLDB::COMMON#oc
+    def test_oc 
+      assert_equal('Eukaryota', @obj.oc.first)
+    end
+
+    # Bio::EMBLDB::COMMON#og
+    def test_og 
+      assert_equal([], @obj.og)
+    end
+
+    # Bio::EMBLDB::COMMON#ref
+    def test_ref
+      assert_equal(2, @obj.ref.size)
+    end
+
+    # Bio::EMBLDB::COMMON#references
+    def test_references 
+      assert_equal(Bio::References, @obj.references.class)
+    end
+
+    # Bio::EMBLDB::COMMON#dr
+    def test_dr
+      assert_equal({}, @obj.dr)
+    end
+
+    def test_fh
+      assert_equal('Key Location/Qualifiers', @obj.fh)
+    end
+
+    def test_ft
+      assert_equal(Bio::Features, @obj.ft.class)
+    end
+
+    def test_ft_iterator
+      @obj.ft.each do |feature|
+        assert_equal(Bio::Feature, feature.class)
+      end
+    end
+
+    def test_ft_accessor
+      assert_equal('CDS', @obj.ft.features[1].feature)
+    end
+
+    def test_each_cds
+      @obj.each_cds do |x|
+        assert_equal('CDS', x.feature)
+      end
+    end
+
+    def test_each_gene
+      @obj.each_gene do |x| 
+        assert_equal('gene', x.feature)
+      end
+    end
+
+    def test_cc
+      assert_equal('', @obj.cc)
+    end
+
+#    def test_xx
+#    end
+
+    def test_sq
+      data = {"a"=>29, "c"=>42, "ntlen"=>166, "g"=>41, "t"=>54, "other"=>0}
+      assert_equal(data, @obj.sq)
+    end
+
+    def test_sq_get
+      assert_equal(29, @obj.sq("a"))
+    end
+
+    def test_seq
+      seq = 'gttctggcctcatggactgaagacttcctgtggacctgatgtgttcagtggaagtgaagaccctggagtacagtcctacatgattgttctcatgattacttgctgtttcatccccctggctatcatcatcctgtgctaccttgctgtgtggatggccatccgtgct'
+      assert_equal(seq, @obj.seq)
+      assert_equal(seq, @obj.naseq)
+      assert_equal(seq, @obj.ntseq)
+    end
+  end
+end