jandot-bio 1.2.1

data/test/unit/bio/appl/blast/test_xmlparser.rb

@@ -0,0 +1,388 @@
+#
+# test/unit/bio/appl/blast/test_xmlparser.rb - Unit test for Bio::Blast::Report
+#
+# Copyright::  Copyright (C) 2005 Mitsuteru Nakao <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_xmlparser.rb,v 1.8 2008/05/12 12:01:20 ngoto Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib'))).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/appl/blast'
+
+
+module Bio::TestBlastXMLParser
+  class TestBlastFormat7XMLParserData
+    bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5)).cleanpath.to_s
+    TestDataBlast = Pathname.new(File.join(bioruby_root, 'test', 'data', 'blast')).cleanpath.to_s
+
+    def self.input
+      File.open(File.join(TestDataBlast, 'b0002.faa')).read
+    end
+
+    def self.output
+      File.open(File.join(TestDataBlast, 'b0002.faa.m7')).read 
+#      File.open(File.join(TestDataBlast, '2.2.15.blastp.m7')).read 
+    end
+  end
+
+    
+  class TestBlastReport < Test::Unit::TestCase
+    require 'bio/appl/blast/report'
+
+    def setup
+      @report = Bio::Blast::Report.new(TestBlastFormat7XMLParserData.output)
+    end
+    
+    def test_iterations
+      @report.iterations
+    end
+
+    def test_parameters
+      @report.parameters
+    end
+
+    def test_program
+      @report.program
+    end
+
+    def test_version
+      @report.version
+    end
+
+    def test_reference
+      @report.reference
+    end
+
+    def test_db
+      assert_equal("b0002.faa", @report.db)
+    end
+
+    def test_query_id
+      @report.query_id
+    end
+
+    def test_query_def
+      @report.query_def
+    end
+
+    def test_query_len
+      @report.query_len
+    end
+
+    def test_matrix
+      @report.matrix
+    end
+
+    def test_expect
+      @report.expect
+    end
+
+    def test_inclusion
+      @report.inclusion
+    end
+
+    def test_sc_match
+      @report.sc_match
+    end
+
+    def test_sc_mismatch
+      @report.sc_mismatch
+    end
+
+    def test_gap_open
+      @report.gap_open
+    end
+
+    def test_gap_extend
+      @report.gap_extend
+    end
+
+    def test_filter
+      @report.filter
+    end
+
+    def test_pattern
+      @report.pattern
+    end
+
+    def test_extrez_query
+      @report.entrez_query
+    end
+
+    def test_each_iteration
+    end
+
+    def test_each_hit
+    end
+
+    def test_hits
+    end
+
+    def test_statistics
+    end
+
+    def test_db_num
+      @report.db_num
+    end
+
+    def test_db_len
+      @report.db_len
+    end
+
+    def test_hsp_len
+      @report.hsp_len
+    end
+
+    def test_eff_space
+      @report.eff_space
+    end
+
+    def test_kappa
+      @report.kappa
+    end
+
+    def test_lambda
+      @report.lambda
+    end
+
+    def test_entropy
+      @report.entropy
+    end
+    
+    def test_message
+      @report.message
+    end
+  end
+  
+
+  class TestBlastReportIteration < Test::Unit::TestCase
+    def setup
+      data = TestBlastFormat7XMLParserData.output
+      report = Bio::Blast::Report.new(data)
+      @itr = report.iterations.first
+    end
+
+    def test_hits
+      @itr.hits
+    end
+
+    def test_statistics
+      @itr.statistics
+    end
+
+    def test_num
+      @itr.num
+    end
+
+    def test_message
+      @itr.message
+    end
+  end
+
+
+  class TestBlastReportHit < Test::Unit::TestCase
+    def setup
+      data = TestBlastFormat7XMLParserData.output
+      report = Bio::Blast::Report.new(data)
+      @hit = report.hits.first
+    end
+
+    def test_hsps
+      @hit.hsps
+    end
+
+    def test_query_id
+      @hit.query_id
+    end
+
+    def test_query_def
+      @hit.query_def
+    end
+
+    def test_query_len
+      @hit.query_len
+    end
+
+    def test_num
+      @hit.num
+    end
+
+    def test_hit_id
+      @hit.hit_id
+    end
+
+    def test_len
+      @hit.len
+    end
+
+    def test_target_len
+      @hit.target_len
+    end
+
+    def test_definition
+      @hit.definition
+    end
+
+    def test_taeget_def
+      @hit.target_def
+    end
+
+    def test_accession
+      @hit.accession
+    end
+
+    def test_target_id
+      @hit.target_id
+    end
+    
+    def test_evalue
+      @hit.evalue
+    end
+
+    def test_bit_score
+      @hit.bit_score
+    end
+
+    def test_identity
+      @hit.identity
+    end
+
+    def test_overlap
+      @hit.overlap
+    end
+
+    def test_query_seq
+      @hit.query_seq
+    end
+
+    def test_target_seq
+      @hit.target_seq
+    end
+
+    def test_midline
+      @hit.midline
+    end
+
+    def test_query_start
+      @hit.query_start
+    end
+
+    def test_query_end
+      @hit.query_end
+    end
+
+    def test_target_start
+      @hit.target_start
+    end
+
+    def test_target_end
+      @hit.target_end
+    end
+
+    def test_lap_at
+      @hit.lap_at
+    end
+  end
+
+
+  class TestBlastReportHsp < Test::Unit::TestCase
+    def setup
+      data = TestBlastFormat7XMLParserData.output
+      report = Bio::Blast::Report.new(data)
+      @hsp = report.hits.first.hsps.first
+    end
+    
+    def test_num
+      assert_equal(1, @hsp.num)
+    end
+
+    def test_hit_score
+      @hsp.bit_score
+    end
+
+    def test_score
+      @hsp.score
+    end
+
+    def test_evalue
+      @hsp.evalue
+    end
+
+    def test_identity
+      @hsp.identity
+    end
+
+    def test_gaps
+      @hsp.gaps
+    end
+
+    def test_positive
+      @hsp.positive
+    end
+
+    def test_align_len
+      @hsp.align_len
+    end
+
+    def test_density
+      @hsp.density
+    end
+
+    def test_query_frame
+      @hsp.query_frame
+    end
+
+    def test_query_from
+      @hsp.query_from
+    end
+
+    def test_query_to
+      @hsp.query_to
+    end
+
+    def test_hit_frame
+      @hsp.hit_frame
+    end
+
+    def test_hit_from
+      @hsp.hit_from
+    end
+
+    def test_hit_to
+      @hsp.hit_to
+    end
+
+    def test_pattern_from
+      @hsp.pattern_from
+    end
+
+    def test_pattern_to
+      @hsp.pattern_to 
+    end
+
+    def test_qseq
+      @hsp.qseq
+    end
+
+    def test_midline
+      @hsp.midline
+    end
+
+    def test_hseq
+      @hsp.hseq
+    end
+
+    def test_percent_identity
+      @hsp.percent_identity
+    end
+
+    def test_mismatch_count
+      @hsp.mismatch_count
+    end
+  end
+end

data/test/unit/bio/appl/genscan/test_report.rb

@@ -0,0 +1,182 @@
+#
+# test/unit/bio/appl/genscan/test_report.rb - Unit test for Bio::Genscan::Report
+#
+# Copyright::  Copyright (C) 2005 Mitsuteru Nakao <n@bioruby.org>
+# License::    The Ruby License
+#
+#  $Id: test_report.rb,v 1.4 2007/04/05 23:35:43 trevor Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio/appl/genscan/report'
+
+
+module Bio
+
+  class TestGenscanReport < Test::Unit::TestCase
+
+    def setup
+      bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5)).cleanpath.to_s
+      test_data = Pathname.new(File.join(bioruby_root, 'test', 'data', 'genscan')).cleanpath.to_s
+      report = File.open(File.join(test_data, 'sample.report')).read
+
+      @obj = Bio::Genscan::Report.new(report)
+    end
+
+    def test_genscan_version
+      assert_equal('1.0', @obj.genscan_version)
+    end
+
+    def test_date_run
+      assert_equal('30-May-103', @obj.date_run)
+    end
+
+    def test_time
+      assert_equal("14:06:28", @obj.time)
+    end
+
+    def test_query_name
+      assert_equal('HUMRASH', @obj.query_name)
+    end
+
+    def test_length
+      assert_equal(12942, @obj.length)
+    end
+
+    def test_gccontent
+      assert_equal(68.17, @obj.gccontent)
+    end
+
+    def test_isochore
+      assert_equal('4 (57 - 100 C+G%)', @obj.isochore)
+    end
+
+    def test_matrix
+      assert_equal('HumanIso.smat', @obj.matrix)
+    end
+
+    def test_predictions_size
+      assert_equal(2, @obj.predictions.size)
+    end
+
+  end # TestGenscanReport
+
+
+  class TestGenscanReportGene < Test::Unit::TestCase
+
+    def setup
+      bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5)).cleanpath.to_s
+      test_data = Pathname.new(File.join(bioruby_root, 'test', 'data', 'genscan')).cleanpath.to_s
+      report = File.open(File.join(test_data, 'sample.report')).read
+      @obj = Bio::Genscan::Report.new(report).predictions
+    end
+
+    def test_number
+      assert_equal(1, @obj.first.number)
+    end
+
+    def test_aaseq
+      assert_equal(Bio::FastaFormat, @obj.first.aaseq.class)
+      seq =  "MTEYKLVVVGAGGVGKSALTIQLIQNHFVDEYDPTIEDSYRKQVVIDGETCLLDILDTAGQEEYSAMRDQYMRTGEGFLCVFAINNTKSFEDIHQYREQIKRVKDSDDVPMVLVGNKCDLAARTVESRQAQDLARSYGIPYIETSAKTRQGVEDAFYTLVREIRQHKLRKLNPPDESGPGCMSCKCVLS"
+      assert_equal(seq, @obj.first.aaseq.seq)
+      definition = "HUMRASH|GENSCAN_predicted_peptide_1|189_aa"
+      assert_equal(definition, @obj.first.aaseq.definition)
+    end
+
+    def test_naseq
+      assert_equal(Bio::FastaFormat, @obj.first.naseq.class)
+      seq = "atgacggaatataagctggtggtggtgggcgccggcggtgtgggcaagagtgcgctgaccatccagctgatccagaaccattttgtggacgaatacgaccccactatagaggattcctaccggaagcaggtggtcattgatggggagacgtgcctgttggacatcctggataccgccggccaggaggagtacagcgccatgcgggaccagtacatgcgcaccggggagggcttcctgtgtgtgtttgccatcaacaacaccaagtcttttgaggacatccaccagtacagggagcagatcaaacgggtgaaggactcggatgacgtgcccatggtgctggtggggaacaagtgtgacctggctgcacgcactgtggaatctcggcaggctcaggacctcgcccgaagctacggcatcccctacatcgagacctcggccaagacccggcagggagtggaggatgccttctacacgttggtgcgtgagatccggcagcacaagctgcggaagctgaaccctcctgatgagagtggccccggctgcatgagctgcaagtgtgtgctctcctga"
+      assert_equal(seq, @obj.first.naseq.seq)
+      definition = "HUMRASH|GENSCAN_predicted_CDS_1|570_bp"
+      assert_equal(definition, @obj.first.naseq.definition)
+    end
+
+    def test_promoter
+      assert_equal(Bio::Genscan::Report::Exon, @obj.last.promoter.class)
+      assert_equal("Prom", @obj.last.promoter.exon_type)
+    end
+
+    def test_polyA
+      assert_equal(Bio::Genscan::Report::Exon, @obj.first.polyA.class)
+      assert_equal('PlyA', @obj.first.polyA.exon_type)
+    end
+
+  end # TestGenscanReportGene
+
+
+  class TestGenscanReportExon < Test::Unit::TestCase
+
+    def setup
+      bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 5)).cleanpath.to_s
+      test_data = Pathname.new(File.join(bioruby_root, 'test', 'data', 'genscan')).cleanpath.to_s
+      report = File.open(File.join(test_data, 'sample.report')).read
+      @obj = Bio::Genscan::Report.new(report).predictions.first.exons.first
+    end
+
+    def test_number
+      assert_equal(1, @obj.number)
+    end
+
+    def test_exon_type
+      assert_equal('Init', @obj.exon_type)
+    end
+
+    def test_exon_type_long
+      assert_equal('Initial exon',  @obj.exon_type_long)
+    end
+
+    def test_strand
+      assert_equal('+', @obj.strand)
+    end
+
+    def test_first
+      assert_equal(1664, @obj.first)
+    end
+
+    def test_last
+      assert_equal(1774, @obj.last)
+    end
+
+    def test_range
+      assert_equal(1664..1774, @obj.range)
+    end
+
+    def test_phase
+      assert_equal('0', @obj.phase)
+    end
+
+    def test_acceptor_score
+      assert_equal(94, @obj.acceptor_score)
+    end
+
+    def test_donor_score
+      assert_equal(83, @obj.donor_score)
+    end
+
+    def test_initiation_score
+      assert_equal(94, @obj.initiation_score)
+    end
+
+    def test_termination_score
+      assert_equal(83, @obj.termination_score)
+    end
+
+    def test_score
+      assert_equal(212, @obj.score)
+    end
+
+    def test_p_value
+      assert_equal(0.997, @obj.p_value)
+    end
+
+    def test_t_score
+      assert_equal(21.33, @obj.t_score)
+    end
+
+  end # TestGenscanReportExon
+
+end