bio 1.0.0 → 1.1.0

data/lib/bio/db/lasergene.rb

@@ -0,0 +1,209 @@
+#
+# bio/db/lasergene.rb - Interface for DNAStar Lasergene sequence file format
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2007 Center for Biomedical Research Informatics, University of Minnesota (http://cbri.umn.edu)
+# License::   The Ruby License
+#
+#  $Id: lasergene.rb,v 1.3 2007/04/05 23:35:40 trevor Exp $
+#
+
+module Bio #:nodoc:
+
+#
+# bio/db/lasergene.rb - Interface for DNAStar Lasergene sequence file format
+#
+# Author::    Trevor Wennblom  <mailto:trevor@corevx.com>
+# Copyright:: Copyright (c) 2007 Center for Biomedical Research Informatics, University of Minnesota (http://cbri.umn.edu)
+# License::   The Ruby License
+#
+# = Description
+#
+# Bio::Lasergene reads DNAStar Lasergene formatted sequence files, or +.seq+ 
+# files.  It only expects to find one sequence per file.
+#
+# = Usage
+#
+#   require 'bio'
+#   filename = 'MyFile.seq'
+#   lseq = Bio::Lasergene.new( IO.readlines(filename) )
+#   lseq.entry_id  # => "Contig 1"
+#   lseq.seq  # => ATGACGTATCCAAAGAGGCGTTACC
+#
+# = Comments
+# 
+# I'm only aware of the following three kinds of Lasergene file formats.  Feel
+# free to send me other examples that may not currently be accounted for.
+#
+# File format 1:
+# 
+#   ## begin ##
+#   "Contig 1" (1,934)
+#     Contig Length:                  934 bases
+#     Average Length/Sequence:        467 bases
+#     Total Sequence Length:         1869 bases
+#     Top Strand:                       2 sequences
+#     Bottom Strand:                    2 sequences
+#     Total:                            4 sequences
+#   ^^
+#   ATGACGTATCCAAAGAGGCGTTACCGGAGAAGAAGACACCGCCCCCGCAGTCCTCTTGGCCAGATCCTCCGCCGCCGCCCCTGGCTCGTCCACCCCCGCCACAGTTACCGCTGGAGAAGGAAAAATGGCATCTTCAWCACCCGCCTATCCCGCAYCTTCGGAWRTACTATCAAGCGAACCACAGTCAGAACGCCCTCCTGGGCGGTGGACATGATGAGATTCAATATTAATGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCCCTTTGAATACTACAGAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAATGGGCTCCAGTGCTGWTATTCTAGMTGATRRCTTKGTAACAAAGRCCACAGCCCTCACCTATGACCCCTATGTAAACTTCTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCRCTCCCGYTACTTTACCCCCAAACCTGTCCTWGATKCCACTATKGATKACTKCCAACCAAACAACAAAAGAAACCAGCTGTGGSTGAGACTACAWACTGCTGGAAATGTAGACCWCGTAGGCCTSGGCACTGCGTKCGAAAACAGTATATACGACCAGGAATACAATATCCGTGTMACCATGTATGTACAATTCAGAGAATTTAATCTTAAAGACCCCCCRCTTMACCCKTAATGAATAATAAMAACCATTACGAAGTGATAAAAWAGWCTCAGTAATTTATTYCATATGGAAATTCWSGGCATGGGGGGGAAAGGGTGACGAACKKGCCCCCTTCCTCCSTSGMYTKTTCYGTAGCATTCYTCCAMAAYACCWAGGCAGYAMTCCTCCSATCAAGAGcYTSYACAGCTGGGACAGCAGTTGAGGAGGACCATTCAAAGGGGGTCGGATTGCTGGTAATCAGA
+#   ## end ##
+# 
+# 
+# File format 2:
+# 
+#   ## begin ##
+#   ^^:                                  350,935
+#   Contig 1 (1,935)
+#     Contig Length:                  935 bases
+#     Average Length/Sequence:        580 bases
+#     Total Sequence Length:         2323 bases
+#     Top Strand:                       2 sequences
+#     Bottom Strand:                    2 sequences
+#     Total:                            4 sequences
+#   ^^
+#   ATGTCGGGGAAATGCTTGACCGCGGGCTACTGCTCATCATTGCTTTCTTTGTGGTATATCGTGCCGTTCTGTTTTGCTGTGCTCGTCAACGCCAGCGGCGACAGCAGCTCTCATTTTCAGTCGATTTATAACTTGACGTTATGTGAGCTGAATGGCACGAACTGGCTGGCAGACAACTTTAACTGGGCTGTGGAGACTTTTGTCATCTTCCCCGTGTTGACTCACATTGTTTCCTATGGTGCACTCACTACCAGTCATTTTCTTGACACAGTTGGTCTAGTTACTGTGTCTACCGCCGGGTTTTATCACGGGCGGTACGTCTTGAGTAGCATCTACGCGGTCTGTGCTCTGGCTGCGTTGATTTGCTTCGCCATCAGGTTTGCGAAGAACTGCATGTCCTGGCGCTACTCTTGCACTAGATACACCAACTTCCTCCTGGACACCAAGGGCAGACTCTATCGTTGGCGGTCGCCTGTCATCATAGAGAAAGGGGGTAAGGTTGAGGTCGAAGGTCATCTGATCGATCTCAAAAGAGTTGTGCTTGATGGCTCTGTGGCGACACCTTTAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCCTAGACGACTTTTGCCATGATAGTACAGCCCCACAGAAGGTGCTCTTGGCGTTTTCCATCACCTACACGCCAGTGATGATATATGCCCTAAAGGTAAGCCGCGGCCGACTTTTGGGGCTTCTGCACCTTTTGATTTTTTTGAACTGTGCCTTTACTTTCGGGTACATGACATTCGTGCACTTTCGGAGCACGAACAAGGTCGCGCTCACTATGGGAGCAGTAGTCGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTG
+#   ## end ##
+# 
+# File format 3 (non-standard Lasergene header):
+# 
+#   ## begin ##
+#   LOCUS       PRU87392               15411 bp    RNA     linear   VRL 17-NOV-2000
+#   DEFINITION  Porcine reproductive and respiratory syndrome virus strain VR-2332,
+#               complete genome.
+#   ACCESSION   U87392 AF030244 U00153
+#   VERSION     U87392.3  GI:11192298
+#   [...cut...]
+#        3'UTR           15261..15411
+#        polyA_site      15409
+#   ORIGIN      
+#   ^^
+#   atgacgtataggtgttggctctatgccttggcatttgtattgtcaggagctgtgaccattggcacagcccaaaacttgctgcacagaaacacccttctgtgatagcctccttcaggggagcttagggtttgtccctagcaccttgcttccggagttgcactgctttacggtctctccacccctttaaccatgtctgggatacttgatcggtgcacgtgtacccccaatgccagggtgtttatggcggagggccaagtctactgcacacgatgcctcagtgcacggtctctccttcccctgaacctccaagtttctgagctcggggtgctaggcctattctacaggcccgaagagccactccggtggacgttgccacgtgcattccccactgttgagtgctcccccgccggggcctgctggctttctgcaatctttccaatcgcacgaatgaccagtggaaacctgaacttccaacaaagaatggtacgggtcgcagctgagctttacagagccggccagctcacccctgcagtcttgaaggctctacaagtttatgaacggggttgccgctggtaccccattgttggacctgtccctggagtggccgttttcgccaattccctacatgtgagtgataaacctttcccgggagcaactcacgtgttgaccaacctgccgctcccgcagagacccaagcctgaagacttttgcccctttgagtgtgctatggctactgtctatgacattggtcatgacgccgtcatgtatgtggccgaaaggaaagtctcctgggcccctcgtggcggggatgaagtgaaatttgaagctgtccccggggagttgaagttgattgcgaaccggctccgcacctccttcccgccccaccacacagtggacatgtctaagttcgccttcacagcccctgggtgtggtgtttctatgcgggtcgaacgccaacacggctgccttcccgctgacactgtccctgaaggcaactgctggtggagcttgtttgacttgcttccactggaagttcagaacaaagaaattcgccatgctaaccaatttggctaccagaccaagcatggtgtctctggcaagtacctacagcggaggctgca[...cut...]
+#   ## end ##
+#
+class Lasergene
+  # Entire header before the sequence
+  attr_reader :comments
+  
+  # Sequence
+  # 
+  # Bio::Sequence::NA or Bio::Sequence::AA object
+  attr_reader :sequence
+  
+  # Name of sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :name
+  
+  # Contig length, length of present sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :contig_length
+  
+  # Average length per sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :average_length
+  
+  # Length of parent sequence
+  # * Parsed from standard Lasergene header
+  attr_reader :total_length
+  
+  # Number of top strand sequences
+  # * Parsed from standard Lasergene header
+  attr_reader :top_strand_sequences
+  
+  # Number of bottom strand sequences
+  # * Parsed from standard Lasergene header
+  attr_reader :bottom_strand_sequences
+  
+  # Number of sequences
+  # * Parsed from standard Lasergene header
+  attr_reader :total_sequences
+
+  DELIMITER_1 = '^\^\^:' # Match '^^:' at the beginning of a line
+  DELIMITER_2 = '^\^\^'  # Match '^^' at the beginning of a line
+
+  def initialize(lines)
+    process(lines)
+  end  
+  
+  # Is the comment header recognized as standard Lasergene format?
+  #
+  # ---
+  # *Arguments*
+  # * _none_
+  # *Returns*:: +true+ _or_ +false+
+  def standard_comment?
+    @standard_comment
+  end
+  
+  # Sequence
+  # 
+  # Bio::Sequence::NA or Bio::Sequence::AA object
+  def seq
+    @sequence
+  end
+  
+  # Name of sequence
+  # * Parsed from standard Lasergene header
+  def entry_id
+    @name
+  end
+  
+  #########
+  protected
+  #########
+  
+  def process(lines)
+    delimiter_1_indices = []
+    delimiter_2_indices = []
+    
+    # If the data from the file is passed as one big String instead of
+    # broken into an Array, convert lines to an Array
+    if lines.kind_of? String
+      lines = lines.tr("\r", '').split("\n")
+    end
+
+    lines.each_with_index do |line, index|
+      if line.match DELIMITER_1
+        delimiter_1_indices << index
+      elsif line.match DELIMITER_2
+        delimiter_2_indices << index
+      end
+    end
+
+    raise InputError, "More than one delimiter of type '#{DELIMITER_1}'" if delimiter_1_indices.size > 1
+    raise InputError, "More than one delimiter of type '#{DELIMITER_2}'" if delimiter_2_indices.size > 1
+    raise InputError, "No comment to data separator of type '#{DELIMITER_2}'" if delimiter_2_indices.size < 1
+
+    if !delimiter_1_indices.empty?
+      # toss out DELIMETER_1 and anything preceding it
+      @comments = lines[ (delimiter_1_indices[0] + 1) .. (delimiter_2_indices[0] - 1) ]
+    else
+      @comments = lines[ 0 .. (delimiter_2_indices[0] - 1) ]
+    end
+
+    @standard_comment = false
+    if @comments[0] =~ %r{(.+)\s+\(\d+,\d+\)} # if we have a standard Lasergene comment
+      @standard_comment = true
+      @name = $1
+      comments.each do |comment|
+        if comment.match('Contig Length:\s+(\d+)')
+          @contig_length = $1.to_i
+        elsif comment.match('Average Length/Sequence:\s+(\d+)')
+          @average_length = $1.to_i
+        elsif comment.match('Total Sequence Length:\s+(\d+)')
+          @total_length = $1.to_i
+        elsif comment.match('Top Strand:\s+(\d+)')
+          @top_strand_sequences = $1.to_i
+        elsif comment.match('Bottom Strand:\s+(\d+)')
+          @bottom_strand_sequences = $1.to_i
+        elsif comment.match('Total:\s+(\d+)')
+          @total_sequences = $1.to_i
+        end
+      end
+    end
+
+    @comments = @comments.join('')
+    @sequence = Bio::Sequence.auto( lines[ (delimiter_2_indices[0] + 1) .. -1 ].join('') )
+  end
+end # Lasergene
+end # Bio

data/lib/bio/db/litdb.rb

@@ -1,34 +1,10 @@
 #
 # = bio/db/litdb.rb - LITDB database class
 #
-# Copyright::  Copyright (C) 2001 KATAYAMA Toshiaki <k@bioruby.org>
-# License::    LGPL
+# Copyright::  Copyright (C) 2001 Toshiaki Katayama <k@bioruby.org>
+# License::    The Ruby License
 #
-#  $Id: litdb.rb,v 0.7 2005/12/18 15:58:41 k Exp $
-#
-# == Description
-#
-#
-# == Example
-# == References
-#
-#--
-#
-#  This library is free software; you can redistribute it and/or
-#  modify it under the terms of the GNU Lesser General Public
-#  License as published by the Free Software Foundation; either
-#  version 2 of the License, or (at your option) any later version.
-#
-#  This library is distributed in the hope that it will be useful,
-#  but WITHOUT ANY WARRANTY; without even the implied warranty of
-#  MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-#  Lesser General Public License for more details.
-#
-#  You should have received a copy of the GNU Lesser General Public
-#  License along with this library; if not, write to the Free Software
-#  Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307  USA
-#
-#++
+# $Id: litdb.rb,v 0.10 2007/04/05 23:35:40 trevor Exp $
 #
 
 require 'bio/db'

data/lib/bio/db/medline.rb

@@ -2,9 +2,16 @@
 # = bio/db/medline.rb - NCBI PubMed/MEDLINE database class
 #
 # Copyright::  Copyright (C) 2001, 2005
-#              KATAYAMA Toshiaki <k@bioruby.org>
-# License::    LGPL
+#              Toshiaki Katayama <k@bioruby.org>
+# License::    The Ruby License
 #
+# $Id: medline.rb,v 1.16 2007/04/05 23:35:40 trevor Exp $
+#
+
+require 'bio/db'
+
+module Bio
+
 # == Description
 #
 # NCBI PubMed/MEDLINE database class.
@@ -16,323 +23,295 @@
 #   medline.pmid == medline.entry_id
 #   medilne.mesh
 #
-# == References
-#
-# $Id: medline.rb,v 1.13 2006/02/18 15:03:47 nakao Exp $
-#
-#++
-#
-#  This library is free software; you can redistribute it and/or
-#  modify it under the terms of the GNU Lesser General Public
-#  License as published by the Free Software Foundation; either
-#  version 2 of the License, or (at your option) any later version.
-#
-#  This library is distributed in the hope that it will be useful,
-#  but WITHOUT ANY WARRANTY; without even the implied warranty of
-#  MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
-#  Lesser General Public License for more details.
-#
-#  You should have received a copy of the GNU Lesser General Public
-#  License along with this library; if not, write to the Free Software
-#  Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307  USA
-#
-#--
-#
-
-require 'bio/db'
-
-module Bio
-
-  # NCBI PubMed/MEDLINE database class.
-  class MEDLINE < NCBIDB
+class MEDLINE < NCBIDB
 
-    # 
-    def initialize(entry)
-      @pubmed = Hash.new('')
+  # 
+  def initialize(entry)
+    @pubmed = Hash.new('')
 
-      tag = ''
-      entry.each_line do |line|
-        if line =~ /^\w/
-          tag = line[0,4].strip
-        end
-        @pubmed[tag] += line[6..-1] if line.length > 6
+    tag = ''
+    entry.each_line do |line|
+      if line =~ /^\w/
+        tag = line[0,4].strip
       end
+      @pubmed[tag] += line[6..-1] if line.length > 6
     end
+  end
 
 
-    # returns a Reference object.
-    def reference
-      hash = Hash.new('')
+  # returns a Reference object.
+  def reference
+    hash = Hash.new('')
 
-      hash['authors']	= authors
-      hash['title']	= title
-      hash['journal']	= journal
-      hash['volume']	= volume
-      hash['issue']	= issue
-      hash['pages']	= pages
-      hash['year']	= year
-      hash['pubmed']	= pmid
-      hash['medline']  	= ui
-      hash['abstract']	= abstract
-      hash['mesh']	= mesh
-      hash['affiliations'] = affiliations
+    hash['authors']	= authors
+    hash['title']	= title
+    hash['journal']	= journal
+    hash['volume']	= volume
+    hash['issue']	= issue
+    hash['pages']	= pages
+    hash['year']	= year
+    hash['pubmed']	= pmid
+    hash['medline']  	= ui
+    hash['abstract']	= abstract
+    hash['mesh']	= mesh
+    hash['affiliations'] = affiliations
 
-      hash.delete_if { |k, v| v.nil? or v.empty? }
+    hash.delete_if { |k, v| v.nil? or v.empty? }
 
-      return Reference.new(hash)
-    end
+    return Reference.new(hash)
+  end
 
 
-    ### Common MEDLINE tags
+  ### Common MEDLINE tags
 
-    # PMID - PubMed Unique Identifier
-    #   Unique number assigned to each PubMed citation.
-    def pmid
-      @pubmed['PMID'].strip
-    end
-    alias entry_id pmid
+  # PMID - PubMed Unique Identifier
+  #   Unique number assigned to each PubMed citation.
+  def pmid
+    @pubmed['PMID'].strip
+  end
+  alias entry_id pmid
 
-    # UI   - MEDLINE Unique Identifier
-    #   Unique number assigned to each MEDLINE citation.
-    def ui
-      @pubmed['UI'].strip
-    end
+  # UI   - MEDLINE Unique Identifier
+  #   Unique number assigned to each MEDLINE citation.
+  def ui
+    @pubmed['UI'].strip
+  end
 
-    # TA   - Journal Title Abbreviation
-    #   Standard journal title abbreviation.
-    def ta
-      @pubmed['TA'].gsub(/\s+/, ' ').strip
-    end
-    alias journal ta
+  # TA   - Journal Title Abbreviation
+  #   Standard journal title abbreviation.
+  def ta
+    @pubmed['TA'].gsub(/\s+/, ' ').strip
+  end
+  alias journal ta
 
-    # VI   - Volume
-    #   Journal volume.
-    def vi
-      @pubmed['VI'].strip
-    end
-    alias volume vi
+  # VI   - Volume
+  #   Journal volume.
+  def vi
+    @pubmed['VI'].strip
+  end
+  alias volume vi
 
-    # IP   - Issue
-    #   The number of the issue, part, or supplement of the journal in which
-    #   the article was published.
-    def ip
-      @pubmed['IP'].strip
-    end
-    alias issue ip
+  # IP   - Issue
+  #   The number of the issue, part, or supplement of the journal in which
+  #   the article was published.
+  def ip
+    @pubmed['IP'].strip
+  end
+  alias issue ip
 
-    # PG   - Page Number
-    #   The full pagination of the article.
-    def pg
-      @pubmed['PG'].strip
-    end
+  # PG   - Page Number
+  #   The full pagination of the article.
+  def pg
+    @pubmed['PG'].strip
+  end
 
-    def pages
-      pages = pg
-      if pages =~ /-/
-        from, to = pages.split('-')
-        if (len = from.length - to.length) > 0
-          to = from[0,len] + to
-        end
-        pages = "#{from}-#{to}"
+  def pages
+    pages = pg
+    if pages =~ /-/
+      from, to = pages.split('-')
+      if (len = from.length - to.length) > 0
+        to = from[0,len] + to
       end
-      return pages
+      pages = "#{from}-#{to}"
     end
+    return pages
+  end
 
-    # DP   - Publication Date
-    #   The date the article was published.
-    def dp
-      @pubmed['DP'].strip
-    end
-    alias date dp
+  # DP   - Publication Date
+  #   The date the article was published.
+  def dp
+    @pubmed['DP'].strip
+  end
+  alias date dp
 
-    def year
-      dp[0,4]
-    end
+  def year
+    dp[0,4]
+  end
 
-    # TI   - Title Words
-    #   The title of the article.
-    def ti
-      @pubmed['TI'].gsub(/\s+/, ' ').strip
-    end
-    alias title ti
+  # TI   - Title Words
+  #   The title of the article.
+  def ti
+    @pubmed['TI'].gsub(/\s+/, ' ').strip
+  end
+  alias title ti
 
-    # AB   - Abstract
-    #   Abstract.
-    def ab
-      @pubmed['AB'].gsub(/\s+/, ' ').strip
-    end
-    alias abstract ab
+  # AB   - Abstract
+  #   Abstract.
+  def ab
+    @pubmed['AB'].gsub(/\s+/, ' ').strip
+  end
+  alias abstract ab
 
-    # AU   - Author Name
-    #   Authors' names.
-    def au
-      @pubmed['AU'].strip
-    end
+  # AU   - Author Name
+  #   Authors' names.
+  def au
+    @pubmed['AU'].strip
+  end
 
-    def authors
-      authors = []
-      au.split(/\n/).each do |author|
-        if author =~ / /
-          name = author.split(/\s+/)
-          suffix = name[-2] =~ /^[A-Z]+$/ ? name.pop : nil	# Jr etc.
-          initial = name.pop.split(//).join('. ')
-          author = "#{name.join(' ')}, #{initial}."
-        end
-        if suffix
-          author << " " + suffix
-        end
-        authors.push(author)
+  def authors
+    authors = []
+    au.split(/\n/).each do |author|
+      if author =~ / /
+        name = author.split(/\s+/)
+        suffix = name[-2] =~ /^[A-Z]+$/ ? name.pop : nil	# Jr etc.
+        initial = name.pop.split(//).join('. ')
+        author = "#{name.join(' ')}, #{initial}."
       end
-      return authors
+      if suffix
+        author << " " + suffix
+      end
+      authors.push(author)
     end
+    return authors
+  end
 
-    # SO   - Source
-    #   Composite field containing bibliographic information.
-    def so
-      @pubmed['SO'].strip
-    end
-    alias source so
+  # SO   - Source
+  #   Composite field containing bibliographic information.
+  def so
+    @pubmed['SO'].strip
+  end
+  alias source so
 
-    # MH   - MeSH Terms
-    #   NLM's controlled vocabulary.
-    def mh
-      @pubmed['MH'].strip.split(/\n/)
-    end
-    alias mesh mh
+  # MH   - MeSH Terms
+  #   NLM's controlled vocabulary.
+  def mh
+    @pubmed['MH'].strip.split(/\n/)
+  end
+  alias mesh mh
 
-    # AD   - Affiliation
-    #   Institutional affiliation and address of the first author, and grant
-    #   numbers.
-    def ad
-      @pubmed['AD'].strip.split(/\n/)
-    end
-    alias affiliations ad
+  # AD   - Affiliation
+  #   Institutional affiliation and address of the first author, and grant
+  #   numbers.
+  def ad
+    @pubmed['AD'].strip.split(/\n/)
+  end
+  alias affiliations ad
 
 
-    ### Other MEDLINE tags
+  ### Other MEDLINE tags
 
-    # AID  - Article Identifier
-    #   Article ID values may include the pii (controlled publisher identifier)
-    #   or doi (Digital Object Identifier).
+  # AID  - Article Identifier
+  #   Article ID values may include the pii (controlled publisher identifier)
+  #   or doi (Digital Object Identifier).
 
-    # CI   - Copyright Information
-    #   Copyright statement.
+  # CI   - Copyright Information
+  #   Copyright statement.
 
-    # CIN  - Comment In
-    #   Reference containing a comment about the article.
+  # CIN  - Comment In
+  #   Reference containing a comment about the article.
 
-    # CN   - Collective Name
-    #   Corporate author or group names with authorship responsibility.
+  # CN   - Collective Name
+  #   Corporate author or group names with authorship responsibility.
 
-    # CON  - Comment On
-    #   Reference upon which the article comments.
+  # CON  - Comment On
+  #   Reference upon which the article comments.
 
-    # CY   - Country
-    #   The place of publication of the journal.
+  # CY   - Country
+  #   The place of publication of the journal.
 
-    # DA   - Date Created
-    #   Used for internal processing at NLM.
+  # DA   - Date Created
+  #   Used for internal processing at NLM.
 
-    # DCOM - Date Completed
-    #   Used for internal processing at NLM.
+  # DCOM - Date Completed
+  #   Used for internal processing at NLM.
 
-    # DEP  - Date of Electronic Publication
-    #   Electronic publication date.
+  # DEP  - Date of Electronic Publication
+  #   Electronic publication date.
 
-    # EDAT - Entrez Date
-    #   The date the citation was added to PubMed.
+  # EDAT - Entrez Date
+  #   The date the citation was added to PubMed.
 
-    # EIN  - Erratum In
-    #   Reference containing a published erratum to the article.
+  # EIN  - Erratum In
+  #   Reference containing a published erratum to the article.
 
-    # GS   - Gene Symbol
-    #   Abbreviated gene names (used 1991 through 1996).
+  # GS   - Gene Symbol
+  #   Abbreviated gene names (used 1991 through 1996).
 
-    # ID   - Identification Number 
-    #   Research grant numbers, contract numbers, or both that designate
-    #   financial support by any agency of the US PHS (Public Health Service).
+  # ID   - Identification Number 
+  #   Research grant numbers, contract numbers, or both that designate
+  #   financial support by any agency of the US PHS (Public Health Service).
 
-    # IS   - ISSN
-    #   International Standard Serial Number of the journal.
+  # IS   - ISSN
+  #   International Standard Serial Number of the journal.
 
-    # JC   - Journal Title Code
-    #   MEDLINE unique three-character code for the journal.
+  # JC   - Journal Title Code
+  #   MEDLINE unique three-character code for the journal.
 
-    # JID  - NLM Unique ID
-    #   Unique journal ID in NLM's catalog of books, journals, and audiovisuals.
+  # JID  - NLM Unique ID
+  #   Unique journal ID in NLM's catalog of books, journals, and audiovisuals.
 
-    # LA   - Language
-    #   The language in which the article was published.
+  # LA   - Language
+  #   The language in which the article was published.
 
-    # LR   - Last Revision Date
-    #   The date a change was made to the record during a maintenance procedure.
+  # LR   - Last Revision Date
+  #   The date a change was made to the record during a maintenance procedure.
 
-    # MHDA - MeSH Date
-    #   The date MeSH terms were added to the citation. The MeSH date is the
-    #   same as the Entrez date until MeSH are added.
+  # MHDA - MeSH Date
+  #   The date MeSH terms were added to the citation. The MeSH date is the
+  #   same as the Entrez date until MeSH are added.
 
-    # PHST - Publication History Status Date
-    #   History status date.
+  # PHST - Publication History Status Date
+  #   History status date.
 
-    # PS   - Personal Name as Subject
-    #   Individual is the subject of the article.
+  # PS   - Personal Name as Subject
+  #   Individual is the subject of the article.
 
-    # PST  - Publication Status
-    #   Publication status.
+  # PST  - Publication Status
+  #   Publication status.
 
-    # PT   - Publication Type
-    #   The type of material the article represents.
-    def pt
-      @pubmed['PT'].strip.split(/\n/)   
-    end
-    alias publication_type pt
+  # PT   - Publication Type
+  #   The type of material the article represents.
+  def pt
+    @pubmed['PT'].strip.split(/\n/)   
+  end
+  alias publication_type pt
 
-    # RF   - Number of References
-    #   Number of bibliographic references for Review articles.
+  # RF   - Number of References
+  #   Number of bibliographic references for Review articles.
 
-    # RIN  - Retraction In
-    #   Retraction of the article
+  # RIN  - Retraction In
+  #   Retraction of the article
 
-    # RN   - EC/RN Number
-    #   Number assigned by the Enzyme Commission to designate a particular
-    #   enzyme or by the Chemical Abstracts Service for Registry Numbers.
+  # RN   - EC/RN Number
+  #   Number assigned by the Enzyme Commission to designate a particular
+  #   enzyme or by the Chemical Abstracts Service for Registry Numbers.
 
-    # ROF  - Retraction Of
-    #   Article being retracted.
+  # ROF  - Retraction Of
+  #   Article being retracted.
 
-    # RPF  - Republished From
-    #   Original article.
+  # RPF  - Republished From
+  #   Original article.
 
-    # SB   - Journal Subset
-    #   Code for a specific set of journals.
+  # SB   - Journal Subset
+  #   Code for a specific set of journals.
 
-    # SI   - Secondary Source Identifier
-    #   Identifies a secondary source that supplies information, e.g., other
-    #   data sources, databanks and accession numbers of molecular sequences
-    #   discussed in articles.
+  # SI   - Secondary Source Identifier
+  #   Identifies a secondary source that supplies information, e.g., other
+  #   data sources, databanks and accession numbers of molecular sequences
+  #   discussed in articles.
 
-    # TT   - Transliterated / Vernacular Title 
-    #   Non-Roman alphabet language titles are transliterated.
+  # TT   - Transliterated / Vernacular Title 
+  #   Non-Roman alphabet language titles are transliterated.
 
-    # UIN  - Update In
-    #   Update to the article.
+  # UIN  - Update In
+  #   Update to the article.
 
-    # UOF  - Update Of
-    #   The article being updated.
+  # UOF  - Update Of
+  #   The article being updated.
 
-    # URLF - URL Full-Text
-    #   Link to the full-text of article at provider's website. Links are
-    #   incomplete. Use PmLink for the complete set of available links.
-    #   [PmLink] http://www.ncbi.nlm.nih.gov/entrez/utils/pmlink_help.html
+  # URLF - URL Full-Text
+  #   Link to the full-text of article at provider's website. Links are
+  #   incomplete. Use PmLink for the complete set of available links.
+  #   [PmLink] http://www.ncbi.nlm.nih.gov/entrez/utils/pmlink_help.html
 
-    # URLS - URL Summary
-    #   Link to the article summary at provider's website. Links are
-    #   incomplete. Use PmLink for the complete set of available links.
-    #   [PmLink] http://www.ncbi.nlm.nih.gov/entrez/utils/pmlink_help.html
+  # URLS - URL Summary
+  #   Link to the article summary at provider's website. Links are
+  #   incomplete. Use PmLink for the complete set of available links.
+  #   [PmLink] http://www.ncbi.nlm.nih.gov/entrez/utils/pmlink_help.html
 
-  end
+end # MEDLINE
 
-end
+end # Bio