@jbrowse/plugin-alignments 2.1.7 → 2.2.1

package/src/CramAdapter/CramSlightlyLazyFeature.ts

@@ -3,25 +3,14 @@ import {
   Feature,
   SimpleFeatureSerialized,
 } from '@jbrowse/core/util/simpleFeature'
-
+import { CramRecord } from '@gmod/cram'
 import CramAdapter from './CramAdapter'
-
-export interface Mismatch {
-  qual?: number
-  start: number
-  length: number
-  type: string
-  base: string
-  altbase?: string
-  seq?: string
-  cliplen?: number
-}
+import { Mismatch, readFeaturesToCIGAR, readFeaturesToMismatches } from './util'
 
 export default class CramSlightlyLazyFeature implements Feature {
   // uses parameter properties to automatically create fields on the class
   // https://www.typescriptlang.org/docs/handbook/classes.html#parameter-properties
-  // eslint-disable-next-line @typescript-eslint/no-explicit-any
-  constructor(private record: any, private _store: CramAdapter) {}
+  constructor(private record: CramRecord, private _store: CramAdapter) {}
 
   _get_name() {
     return this.record.readName
@@ -32,7 +21,7 @@ export default class CramSlightlyLazyFeature implements Feature {
   }
 
   _get_end() {
-    return this.record.alignmentStart + this.record.lengthOnRef - 1
+    return this.record.alignmentStart + (this.record.lengthOnRef ?? 1) - 1
   }
 
   _get_cram_read_features() {
@@ -119,114 +108,16 @@ export default class CramSlightlyLazyFeature implements Feature {
 
   // generate a CIGAR, based on code from jkbonfield
   _get_CIGAR() {
-    let seq = ''
-    let cigar = ''
-    let op = 'M'
-    let oplen = 0
-
-    // not sure I should access these, but...
-    const ref = this.record._refRegion.seq
-    const refStart = this.record._refRegion.start
-    let last_pos = this.record.alignmentStart
-    let sublen = 0
-    if (typeof this.record.readFeatures !== 'undefined') {
-      // @ts-ignore
-      for (let i = 0; i < this.record.readFeatures.length; i++) {
-        const { code, refPos, sub, data } = this.record.readFeatures[i]
-        sublen = refPos - last_pos
-        seq += ref.substring(last_pos - refStart, refPos - refStart)
-        last_pos = refPos
-
-        if (oplen && op !== 'M') {
-          cigar += oplen + op
-          oplen = 0
-        }
-        if (sublen) {
-          op = 'M'
-          oplen += sublen
-        }
-
-        if (code === 'b') {
-          // An array of bases stored verbatim
-          const ret = data.split(',')
-          const added = String.fromCharCode(...ret)
-          seq += added
-          last_pos += added.length
-          oplen += added.length
-        } else if (code === 'B') {
-          // Single base (+ qual score)
-          seq += sub
-          last_pos++
-          oplen++
-        } else if (code === 'X') {
-          // Substitution
-          seq += sub
-          last_pos++
-          oplen++
-        } else if (code === 'D' || code === 'N') {
-          // Deletion or Ref Skip
-          last_pos += data
-          if (oplen) {
-            cigar += oplen + op
-          }
-          cigar += data + code
-          oplen = 0
-        } else if (code === 'I' || code === 'S') {
-          // Insertion or soft-clip
-          seq += data
-          if (oplen) {
-            cigar += oplen + op
-          }
-          cigar += data.length + code
-          oplen = 0
-        } else if (code === 'i') {
-          // Single base insertion
-          seq += data
-          if (oplen) {
-            cigar += oplen + op
-          }
-          cigar += `${1}I`
-          oplen = 0
-        } else if (code === 'P') {
-          // Padding
-          if (oplen) {
-            cigar += oplen + op
-          }
-          cigar += `${data}P`
-        } else if (code === 'H') {
-          // Hard clip
-          if (oplen) {
-            cigar += oplen + op
-          }
-          cigar += `${data}H`
-          oplen = 0
-        } // else q or Q
-      }
-    } else {
-      sublen = this.record.readLength - seq.length
-    }
-    if (seq.length !== this.record.readLength) {
-      sublen = this.record.readLength - seq.length
-      seq += ref.substring(last_pos - refStart, last_pos - refStart + sublen)
-
-      if (oplen && op !== 'M') {
-        cigar += oplen + op
-        oplen = 0
-      }
-      op = 'M'
-      oplen += sublen
-    }
-    if (oplen) {
-      cigar += oplen + op
-    }
-    return cigar
+    return readFeaturesToCIGAR(
+      this.record.readFeatures,
+      this.record.alignmentStart,
+      this.record.readLength,
+      this.record._refRegion,
+    )
   }
 
   tags() {
-    const properties = Object.getOwnPropertyNames(
-      CramSlightlyLazyFeature.prototype,
-    )
-    return properties
+    return Object.getOwnPropertyNames(CramSlightlyLazyFeature.prototype)
       .filter(
         prop =>
           prop.startsWith('_get_') &&
@@ -280,111 +171,20 @@ export default class CramSlightlyLazyFeature implements Feature {
   }
 
   toJSON(): SimpleFeatureSerialized {
-    // eslint-disable-next-line @typescript-eslint/no-explicit-any
-    const tags: Record<string, any> = {}
-    this.tags().forEach((t: string) => {
-      const val = this.get(t)
-      if (val !== undefined) {
-        tags[t] = val
-      }
-    })
-
     return {
-      ...tags,
-      name: this.get('name'),
-      type: this.get('type'),
+      ...Object.fromEntries(
+        this.tags()
+          .map(t => [t, this.get(t)])
+          .filter(elt => elt[1] !== undefined),
+      ),
       uniqueId: this.id(),
     }
   }
 
   _get_mismatches(): Mismatch[] {
-    const readFeatures = this.get('cram_read_features')
+    const readFeatures = this.record.readFeatures
     const qual = this.qualRaw()
-    if (!readFeatures) {
-      return []
-    }
     const start = this.get('start')
-    const mismatches: Mismatch[] = new Array(readFeatures.length)
-    let j = 0
-    for (let i = 0; i < readFeatures.length; i++) {
-      const f = readFeatures[i]
-      const { code, pos, data, sub, ref } = f
-      const refPos = f.refPos - 1 - start
-      if (code === 'X') {
-        // substitution
-        mismatches[j++] = {
-          start: refPos,
-          length: 1,
-          base: sub,
-          qual: qual?.[pos],
-          altbase: ref,
-          type: 'mismatch',
-        }
-      } else if (code === 'I') {
-        // insertion
-        mismatches[j++] = {
-          start: refPos,
-          type: 'insertion',
-          base: `${data.length}`,
-          length: 0,
-        }
-      } else if (code === 'N') {
-        // reference skip
-        mismatches[j++] = {
-          type: 'skip',
-          length: data,
-          start: refPos,
-          base: 'N',
-        }
-      } else if (code === 'S') {
-        // soft clip
-        const len = data.length
-        mismatches[j++] = {
-          start: refPos,
-          type: 'softclip',
-          base: `S${len}`,
-          cliplen: len,
-          length: 1,
-        }
-      } else if (code === 'P') {
-        // padding
-      } else if (code === 'H') {
-        // hard clip
-        const len = data
-        mismatches[j++] = {
-          start: refPos,
-          type: 'hardclip',
-          base: `H${len}`,
-          cliplen: len,
-          length: 1,
-        }
-      } else if (code === 'D') {
-        // deletion
-        mismatches[j++] = {
-          type: 'deletion',
-          length: data,
-          start: refPos,
-          base: '*',
-        }
-      } else if (code === 'b') {
-        // stretch of bases
-      } else if (code === 'q') {
-        // stretch of qual scores
-      } else if (code === 'B') {
-        // a pair of [base, qual]
-      } else if (code === 'i') {
-        // single-base insertion
-        // insertion
-        mismatches[j++] = {
-          start: refPos,
-          type: 'insertion',
-          base: data,
-          length: 1,
-        }
-      } else if (code === 'Q') {
-        // single quality value
-      }
-    }
-    return mismatches.slice(0, j)
+    return readFeaturesToMismatches(readFeatures, start, qual)
   }
 }

package/src/CramAdapter/CramTestAdapters.ts

@@ -37,7 +37,7 @@ export class FetchableSmallFasta {
     if (!entry) {
       throw new Error(`no sequence with id ${id} exists`)
     }
-    return entry.sequence.substr(start - 1, length)
+    return entry.sequence.slice(start, start + length)
   }
 
   async getSequenceList() {

package/src/CramAdapter/__snapshots__/CramAdapter.test.ts.snap

@@ -1,8 +1,8 @@
 // Jest Snapshot v1, https://goo.gl/fbAQLP
 
 exports[`adapter can fetch features from volvox-sorted.cram 1`] = `
-Array [
-  Object {
+[
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5540,
@@ -12,11 +12,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "ATACACTGGTTCGGAGACGGTTGATGACGAGCGCGCTATATGTCGGCATCTGCGCGCCATGAGCGGCCGCTATCCGGCGGCACGCATAATATAGTGCAAG",
+    "seq": "TACACTGGTTCGGAGACGGTTCGTGACGAGCGCGCTATATGTCGGCATCTGCGCCGCATGAGCGGCCGCTGACCGGCGGCACGACTAATATAGTGCAAGA",
     "seq_id": "ctgA",
     "start": 5440,
     "strand": -1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -28,7 +28,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1618",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5541,
@@ -38,11 +38,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "TACACTGGTTCGGAGACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCGGCGGCTGTCCGGCGGCACGAATAATATAGTGCAAGA",
+    "seq": "ACACTGGTTCGGAGACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCGGCCCCTGTCCGGCGGCACGAATAATATAGTGCAAGAA",
     "seq_id": "ctgA",
     "start": 5441,
     "strand": -1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -54,7 +54,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1619",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5544,
@@ -64,11 +64,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "ACTGGTTCGGAGACGGTTCATGACGGGCGCGCTATATGTCGGCATCTGCTCGCCATGAGCGGCCGCTGTCCGGCGGTACGAATAATATAGTGCAAGAAAA",
+    "seq": "CTGGTTCGGAGACGGTTCATGACGACCGCGCTATATGTCGGCATCTGCGTCGCATGAGCGGCCGCTGTCCGGCGGCTCGAATAATATAGTGCAAGAAAAA",
     "seq_id": "ctgA",
     "start": 5444,
     "strand": 1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -80,7 +80,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1620",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5553,
@@ -90,11 +90,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "GAGACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCGCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGAC",
+    "seq": "AGACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCGCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACT",
     "seq_id": "ctgA",
     "start": 5453,
     "strand": 1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -106,7 +106,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1621",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5554,
@@ -116,11 +116,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "AGACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCCCATGAGGGGCCGCTGTCCAGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACT",
+    "seq": "GACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCCGCCGCTGTCCGACGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTA",
     "seq_id": "ctgA",
     "start": 5454,
     "strand": 1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -132,7 +132,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1622",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5559,
@@ -142,11 +142,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "GTTCATGACGAGCGCGCTATATATCGGCATCTGCGCGCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGT",
+    "seq": "TTCATGACGAGCGCGCTATATGACGGCATCTGCGCCGCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTT",
     "seq_id": "ctgA",
     "start": 5459,
     "strand": -1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -158,7 +158,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1623",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5560,
@@ -168,11 +168,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "TTCATGACGAGCGCGCTATATGTCGGCATCTGCGCGCCACGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTT",
+    "seq": "TCATGACGAGCGCGCTATATGTCGGCATCTGCGCCGCATCAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTA",
     "seq_id": "ctgA",
     "start": 5460,
     "strand": 1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -184,7 +184,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1624",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5568,
@@ -194,11 +194,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "GAGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTATATATGA",
+    "seq": "AGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTATATATGAT",
     "seq_id": "ctgA",
     "start": 5468,
     "strand": 1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -210,7 +210,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1625",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5594,
@@ -220,11 +220,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "CCCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACTGAAGACTACGGTTATATATGATGGAACGGCCCTCACAGCATTCAAAC",
+    "seq": "CCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCTAAGACTACGGTTATATATGATGGAACGGCCCTCACAGCATTCTCACA",
     "seq_id": "ctgA",
     "start": 5494,
     "strand": -1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,
@@ -236,7 +236,7 @@ Array [
     "type": "match",
     "uniqueId": "test-1626",
   },
-  Object {
+  {
     "CIGAR": "100M",
     "clipPos": 0,
     "end": 5596,
@@ -246,11 +246,11 @@ Array [
     "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
     "refName": "ctgA",
     "score": 37,
-    "seq": "CCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTATATATGATGGAACGGCCCTCACAGCATCCTAACAG",
+    "seq": "CATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTATATATGATGGAACGGCCCTCACAGCATTGTAACAGG",
     "seq_id": "ctgA",
     "start": 5496,
     "strand": 1,
-    "tags": Object {
+    "tags": {
       "X0": 1,
       "X1": 0,
       "XG": 0,

package/src/CramAdapter/__snapshots__/util.test.ts.snap

@@ -0,0 +1,14 @@
+// Jest Snapshot v1, https://goo.gl/fbAQLP
+
+exports[`cram read features mismatches 1`] = `
+[
+  {
+    "base": "1",
+    "length": 0,
+    "start": 24,
+    "type": "insertion",
+  },
+]
+`;
+
+exports[`cram read features to CIGAR 1`] = `"24M1I75M"`;

package/src/CramAdapter/configSchema.ts

@@ -1,33 +1,57 @@
-import PluginManager from '@jbrowse/core/PluginManager'
 import { ConfigurationSchema } from '@jbrowse/core/configuration'
-import { types } from 'mobx-state-tree'
 
-export default (pluginManager: PluginManager) => {
-  return types.late(() =>
-    ConfigurationSchema(
-      'CramAdapter',
-      {
-        fetchSizeLimit: {
-          type: 'number',
-          defaultValue: 3_000_000,
-        },
-        cramLocation: {
-          type: 'fileLocation',
-          defaultValue: {
-            uri: '/path/to/my.cram',
-            locationType: 'UriLocation',
-          },
-        },
-        craiLocation: {
-          type: 'fileLocation',
-          defaultValue: {
-            uri: '/path/to/my.cram.crai',
-            locationType: 'UriLocation',
-          },
-        },
-        sequenceAdapter: pluginManager.pluggableConfigSchemaType('adapter'),
+/**
+ * #config CramAdapter
+ * used to configure CRAM adapter
+ */
+function x() {} // eslint-disable-line @typescript-eslint/no-unused-vars
+
+const configSchema = ConfigurationSchema(
+  'CramAdapter',
+  {
+    /**
+     * #slot fetchSizeLimit
+     */
+    fetchSizeLimit: {
+      type: 'number',
+      description:
+        'size in bytes over which to display a warning to the user that too much data will be fetched',
+      defaultValue: 3_000_000,
+    },
+
+    /**
+     * #slot cramLocation
+     */
+    cramLocation: {
+      type: 'fileLocation',
+      defaultValue: {
+        uri: '/path/to/my.cram',
+        locationType: 'UriLocation',
       },
-      { explicitlyTyped: true },
-    ),
-  )
-}
+    },
+
+    /**
+     * #slot craiLocation
+     */
+    craiLocation: {
+      type: 'fileLocation',
+      defaultValue: {
+        uri: '/path/to/my.cram.crai',
+        locationType: 'UriLocation',
+      },
+    },
+
+    /**
+     * #slot sequenceAdapter
+     * generally refers to the reference genome assembly's sequence adapter
+     * currently needs to be manually added
+     */
+    sequenceAdapter: {
+      type: 'frozen',
+      description: 'sequence data adapter',
+      defaultValue: null,
+    },
+  },
+  { explicitlyTyped: true },
+)
+export default configSchema

package/src/CramAdapter/index.ts

@@ -2,15 +2,14 @@ import PluginManager from '@jbrowse/core/PluginManager'
 import AdapterType from '@jbrowse/core/pluggableElementTypes/AdapterType'
 
 // locals
-import configSchemaF from './configSchema'
+import configSchema from './configSchema'
 
 export default (pluginManager: PluginManager) => {
-  pluginManager.addAdapterType(
-    () =>
-      new AdapterType({
-        name: 'CramAdapter',
-        configSchema: pluginManager.load(configSchemaF),
-        getAdapterClass: () => import('./CramAdapter').then(r => r.default),
-      }),
-  )
+  pluginManager.addAdapterType(() => {
+    return new AdapterType({
+      name: 'CramAdapter',
+      configSchema,
+      getAdapterClass: () => import('./CramAdapter').then(r => r.default),
+    })
+  })
 }

package/src/CramAdapter/util.test.ts

@@ -0,0 +1,26 @@
+import { readFeaturesToCIGAR, readFeaturesToMismatches } from './util'
+
+test('cram read features mismatches', () => {
+  expect(
+    // from ctgA_15140_15565_0:0:1_1:0:0_2e8 in volvox-sorted.cram
+    readFeaturesToMismatches(
+      [{ code: 'i', data: 'C', pos: 25, refPos: 15164 }],
+      15139,
+    ),
+  ).toMatchSnapshot()
+})
+
+test('cram read features to CIGAR', () => {
+  expect(
+    // from ctgA_15140_15565_0:0:1_1:0:0_2e8 in volvox-sorted.cram
+    readFeaturesToCIGAR(
+      [{ code: 'i', data: 'C', pos: 25, refPos: 15164 }],
+      15140,
+      100,
+      {
+        start: 14998,
+        seq: 'agaccacattcagctctcggtaacatgggaggcttgtggttgcaccgtaaaagggggatagcccatccatcctgtaaacctacaatcgcgcgtagcttaatacgctcacattagacattcgatcgagagacctggtttcaagagccttcccttttgctttagtgggccaaatcgcaaccctgctcccctcccttacgccttatacacttcagtgcaaattcatgcgttcagcgaacaactggacttctgttgtacgtagtccacgggggcttattcattatagaaagccccctactgtcaccgttatatggttcacacatgagctgatcacctagagagtcgtcatgcacattcgcctaacaaggacatatgagtaaccg',
+      },
+    ),
+  ).toMatchSnapshot()
+})