biotite 1.5.0__cp314-cp314-macosx_10_13_x86_64.whl

biotite/sequence/align/buckets.py

@@ -0,0 +1,71 @@
+# This source code is part of the Biotite package and is distributed
+# under the 3-Clause BSD License. Please see 'LICENSE.rst' for further
+# information.
+
+__name__ = "biotite.sequence.align"
+__author__ = "Patrick Kunzmann"
+__all__ = ["bucket_number"]
+
+from os.path import dirname, join, realpath
+import numpy as np
+
+_primes = None
+
+
+def bucket_number(n_kmers, load_factor=0.8):
+    """
+    Find an appropriate number of buckets for a :class:`BucketKmerTable`
+    based on the number of elements (i.e. *k-mers*) that should be
+    stored in the table.
+
+    Parameters
+    ----------
+    n_kmers : int
+        The expected number of *k-mers* that will be stored in the
+        :class:`BucketKmerTable`.
+        If this number deviates from the actual number of *k-mers* that
+        will be stored, the load factor of the table will deviate
+        by the same percentage.
+    load_factor : float, optional
+        The ratio of bucket number to *k-mer* number.
+        The actual load factor will be lower, as the closest greater
+        prime is returned (see *Notes*).
+
+    Returns
+    -------
+    n_buckets : int
+        The recommended number of buckets to use for a
+        :class:`BucketKmerTable`, that stores `n_kmers` at the given
+        `load_factor`.
+
+    Notes
+    -----
+    The function returns the closest greater prime number from a
+    precomputed list of primes to use as the number of buckets.
+    The reason is that primer numbers have proven to be good hash table
+    sizes, if the hash function is not randomized.
+
+    Let's take unambiguous nucleotide *k-mers* as example.
+    If powers of two would be used as table size (another common scheme),
+    taking the modulo operation on the *k-mer* code would simply erase
+    the upper bits corresponding to the first nucleotide(s) in a
+    *k-mer*.
+    Hence, all *k-mers* with the same suffix would be stored in the same
+    bin.
+    """
+    global _primes
+    if _primes is None:
+        with open(join(dirname(realpath(__file__)), "primes.txt")) as file:
+            _primes = np.array(
+                [
+                    int(line)
+                    for line in file.read().splitlines()
+                    if len(line) != 0 and line[0] != "#"
+                ]
+            )
+
+    number = int(n_kmers / load_factor)
+    index = np.searchsorted(_primes, number, side="left")
+    if index == len(_primes):
+        raise ValueError("Number of buckets too large")
+    return _primes[index]

biotite/sequence/align/cigar.py

@@ -0,0 +1,425 @@
+# This source code is part of the Biotite package and is distributed
+# under the 3-Clause BSD License. Please see 'LICENSE.rst' for further
+# information.
+
+__name__ = "biotite.sequence.align"
+__author__ = "Patrick Kunzmann"
+__all__ = ["CigarOp", "read_alignment_from_cigar", "write_alignment_to_cigar"]
+
+import enum
+import numpy as np
+from biotite.sequence.align.alignment import Alignment, get_codes
+
+
+class CigarOp(enum.IntEnum):
+    """
+    An enum for the different CIGAR operations.
+    """
+
+    MATCH = 0
+    INSERTION = 1
+    DELETION = 2
+    INTRON = 3
+    SOFT_CLIP = 4
+    HARD_CLIP = 5
+    PADDING = 6
+    EQUAL = 7
+    DIFFERENT = 8
+    BACK = 9
+
+    @staticmethod
+    def from_cigar_symbol(symbol):
+        """
+        Get the enum value from the CIGAR symbol.
+
+        Parameters
+        ----------
+        symbol : str
+            The CIGAR symbol.
+
+        Returns
+        -------
+        op : CigarOp
+            The enum value.
+        """
+        return _str_to_op[symbol]
+
+    def to_cigar_symbol(self):
+        return _op_to_str[self]
+
+
+_str_to_op = {
+    "M": CigarOp.MATCH,
+    "I": CigarOp.INSERTION,
+    "D": CigarOp.DELETION,
+    "N": CigarOp.INTRON,
+    "S": CigarOp.SOFT_CLIP,
+    "H": CigarOp.HARD_CLIP,
+    "P": CigarOp.PADDING,
+    "=": CigarOp.EQUAL,
+    "X": CigarOp.DIFFERENT,
+    "B": CigarOp.BACK,
+}
+_op_to_str = {v: k for k, v in _str_to_op.items()}
+
+
+def read_alignment_from_cigar(cigar, position, reference_sequence, segment_sequence):
+    """
+    Create an :class:`Alignment` from a CIGAR string.
+
+    Parameters
+    ----------
+    cigar : str
+        The CIGAR string.
+    position : int
+        0-based position of the first aligned base in the reference.
+        0-based equivalent to the ``POS`` field in the SAM/BAM file.
+    reference_sequence : Sequence
+        The reference sequence.
+    segment_sequence : Sequence
+        The segment, read or query sequence.
+
+    Returns
+    -------
+    alignment : Alignment
+        The alignment.
+
+    See Also
+    --------
+    write_alignment_to_cigar : The reverse operation.
+
+    Notes
+    -----
+    This function expects that the `segment_sequence` was taken from the
+    SAM/BAM file, hence hard-clipped bases are not part of the sequence.
+    Therefore, hard clipped bases are simply ignored in the CIGAR
+    string.
+
+    Examples
+    --------
+
+    >>> ref = NucleotideSequence("TATAAAAGGTTTCCGACCGTAGGTAGCTGA")
+    >>> seg = NucleotideSequence("CCCCGGTTTGACCGTATGTAG")
+    >>> print(read_alignment_from_cigar("9M2D12M", 3, ref, seg))
+    AAAAGGTTTCCGACCGTAGGTAG
+    CCCCGGTTT--GACCGTATGTAG
+    >>> print(read_alignment_from_cigar("4X5=2D7=1X4=", 3, ref, seg))
+    AAAAGGTTTCCGACCGTAGGTAG
+    CCCCGGTTT--GACCGTATGTAG
+
+    Explicit terminal deletions are also possible.
+    Note that in this case the deleted positions count as aligned bases
+    with respect to the `position` parameter.
+
+    >>> print(read_alignment_from_cigar("3D9M2D12M4D", 0, ref, seg))
+    TATAAAAGGTTTCCGACCGTAGGTAGCTGA
+    ---CCCCGGTTT--GACCGTATGTAG----
+
+    If bases in the segment sequence are soft-clipped, they do not
+    appear in the alignment.
+    Furthermore, the start of the reference sequence must be adapted.
+
+    >>> print(read_alignment_from_cigar("4S5M2D12M", 7, ref, seg))
+    GGTTTCCGACCGTAGGTAG
+    GGTTT--GACCGTATGTAG
+
+    Hard-clipped bases are not part of the segment sequence.
+    Hence `H` operations are completely ignored.
+
+    >>> seg = NucleotideSequence("GGTTTGACCGTATGTAG")
+    >>> print(read_alignment_from_cigar("4H5M2D12M", 7, ref, seg))
+    GGTTTCCGACCGTAGGTAG
+    GGTTT--GACCGTATGTAG
+
+    Reading from BAM codes is also possible.
+
+    >>> seg = NucleotideSequence("CCCCGGTTTGACCGTATGTAG")
+    >>> op_tuples = [
+    ...     (CigarOp.MATCH, 9),
+    ...     (CigarOp.DELETION, 2),
+    ...     (CigarOp.MATCH, 12)
+    ... ]
+    >>> print(read_alignment_from_cigar(op_tuples, 3, ref, seg))
+    AAAAGGTTTCCGACCGTAGGTAG
+    CCCCGGTTT--GACCGTATGTAG
+    """
+    if isinstance(cigar, str):
+        operations = _op_tuples_from_cigar(cigar)
+    else:
+        operations = np.asarray(cigar, dtype=int)
+        if operations.ndim != 2:
+            raise ValueError("Expected array with shape (n,2)")
+        if operations.shape[1] != 2:
+            raise ValueError("Expected (operation, length) pairs")
+
+    if len(operations) == 0:
+        return Alignment(
+            [reference_sequence, segment_sequence], np.zeros((0, 2), dtype=int)
+        )
+
+    trace = np.zeros((np.sum(operations[:, 1]), 2), dtype=int)
+    clip_mask = np.ones(trace.shape[0], dtype=bool)
+
+    i = 0
+    ref_pos = position
+    seg_pos = 0
+    for op, length in operations:
+        op = CigarOp(op)
+        if op in (CigarOp.MATCH, CigarOp.EQUAL, CigarOp.DIFFERENT):
+            trace[i : i + length, 0] = np.arange(ref_pos, ref_pos + length)
+            trace[i : i + length, 1] = np.arange(seg_pos, seg_pos + length)
+            ref_pos += length
+            seg_pos += length
+        elif op == CigarOp.INSERTION:
+            trace[i : i + length, 0] = -1
+            trace[i : i + length, 1] = np.arange(seg_pos, seg_pos + length)
+            seg_pos += length
+        elif op in (CigarOp.DELETION, CigarOp.INTRON):
+            trace[i : i + length, 0] = np.arange(ref_pos, ref_pos + length)
+            trace[i : i + length, 1] = -1
+            ref_pos += length
+        elif op == CigarOp.SOFT_CLIP:
+            clip_mask[i : i + length] = False
+            seg_pos += length
+        elif op == CigarOp.HARD_CLIP:
+            clip_mask[i : i + length] = False
+        else:
+            raise ValueError(f"CIGAR operation {op} is not implemented")
+        i += length
+    # Remove clipped positions
+    trace = trace[clip_mask]
+    return Alignment([reference_sequence, segment_sequence], trace)
+
+
+def write_alignment_to_cigar(
+    alignment,
+    reference_index=0,
+    segment_index=1,
+    introns=(),
+    distinguish_matches=False,
+    hard_clip=False,
+    include_terminal_gaps=False,
+    as_string=True,
+):
+    """
+    Convert an :class:`Alignment` into a CIGAR string.
+
+    Parameters
+    ----------
+    alignment : Alignment
+        The alignment to be converted.
+    reference_index : int, optional
+        The index of the reference sequence in the alignment.
+        By default the first sequence is used.
+    segment_index : int, optional
+        The index of the segment, read or query sequence in the
+        alignment.
+        By default the second sequence is used.
+    introns : iterable object of tuple(int, int), optional
+        The introns in the reference sequence.
+        The introns are given as tuples of start and exclusive stop
+        index.
+        In those regions gaps in the reference sequence are reflected by
+        `'N'` in the CIGAR string.
+        By default no introns are assumed.
+    distinguish_matches : bool, optional
+        If true, matches (`'='`) are distinguished from mismatches
+        (`'X'`).
+        Otherwise, matches and mismatches are reflected equally by an
+        `'M'` in the CIGAR string.
+    hard_clip : bool, optional
+        If true, clipped bases are hard-clipped.
+        Otherwise, clipped bases are soft-clipped.
+    include_terminal_gaps : bool, optional
+        If true, terminal gaps in the segment sequence are included in
+        the CIGAR string.
+        These are represented by ``D`` operations at the start and/or
+        end of the string.
+        By default, those terminal gaps are omitted in the CIGAR, which
+        is the way SAM/BAM expects a CIGAR to be.
+    as_string : bool, optional
+        If true, the CIGAR string is returned.
+        Otherwise, a list of tuples is returned, where the first element
+        of each tuple specifies the :class:`CigarOp` and the second
+        element specifies the number of repetitions.
+
+    Returns
+    -------
+    cigar : str or ndarray, shape=(n,2) dtype=int
+        If `as_string` is true, the CIGAR string is returned.
+        Otherwise, an array is returned, where the first column
+        specifies the :class:`CigarOp` and the second column specifies
+        the number of repetitions of that operation.
+
+    See Also
+    --------
+    read_alignment_from_cigar : The reverse operation.
+
+    Notes
+    -----
+    If `include_terminal_gaps` is set to true, you usually want to set
+    ``position=0`` in :func:`read_alignment_from_cigar` to get the
+    correct alignment.
+
+    Examples
+    --------
+
+    >>> ref = NucleotideSequence("TATAAAAGGTTTCCGACCGTAGGTAGCTGA")
+    >>> seg = NucleotideSequence("CCCCGGTTTGACCGTATGTAG")
+    >>> matrix = SubstitutionMatrix.std_nucleotide_matrix()
+    >>> semiglobal_alignment = align_optimal(
+    ...     ref, seg, matrix, local=False, terminal_penalty=False
+    ... )[0]
+    >>> print(semiglobal_alignment)
+    TATAAAAGGTTTCCGACCGTAGGTAGCTGA
+    ---CCCCGGTTT--GACCGTATGTAG----
+    >>> print(write_alignment_to_cigar(semiglobal_alignment))
+    9M2D12M
+    >>> print(write_alignment_to_cigar(semiglobal_alignment, introns=[(12, 14)]))
+    9M2N12M
+    >>> print(write_alignment_to_cigar(semiglobal_alignment, distinguish_matches=True))
+    4X5=2D7=1X4=
+    >>> print(write_alignment_to_cigar(semiglobal_alignment, include_terminal_gaps=True))
+    3D9M2D12M4D
+    >>> local_alignment = align_optimal(ref, seg, matrix, local=True)[0]
+    >>> print(local_alignment)
+    GGTTTCCGACCGTAGGTAG
+    GGTTT--GACCGTATGTAG
+    >>> print(write_alignment_to_cigar(local_alignment, hard_clip=False))
+    4S5M2D12M
+    >>> print(write_alignment_to_cigar(local_alignment, hard_clip=True))
+    4H5M2D12M
+
+    Writing operations as BAM codes is also possible:
+
+    >>> op_tuples = write_alignment_to_cigar(semiglobal_alignment, as_string=False)
+    >>> for op, length in op_tuples:
+    ...     print(CigarOp(op).name, length)
+    MATCH 9
+    DELETION 2
+    MATCH 12
+    """
+    if not include_terminal_gaps:
+        alignment = _remove_terminal_segment_gaps(alignment, segment_index)
+
+    ref_trace = alignment.trace[:, reference_index]
+    seg_trace = alignment.trace[:, segment_index]
+    operations = np.full(alignment.trace.shape[0], CigarOp.MATCH, dtype=int)
+
+    insertion_mask = ref_trace == -1
+    deletion_mask = seg_trace == -1
+    if np.any(insertion_mask & deletion_mask):
+        raise ValueError(
+            "Alignment contains insertion and deletion at the same position"
+        )
+    operations[insertion_mask] = CigarOp.INSERTION
+    operations[deletion_mask] = CigarOp.DELETION
+
+    if introns is not None:
+        intron_mask = np.zeros(operations.shape[0], dtype=bool)
+        for start, stop in introns:
+            if start >= stop:
+                raise ValueError("Intron start must be smaller than intron stop")
+            if start < 0:
+                raise ValueError("Intron start must not be negative")
+            intron_mask[(ref_trace >= start) & (ref_trace < stop)] = True
+        if np.any(intron_mask & ~deletion_mask):
+            raise ValueError("Introns must be within gaps in the reference sequence")
+        operations[intron_mask] = CigarOp.INTRON
+
+    if distinguish_matches:
+        symbol_codes = get_codes(alignment)
+        ref_codes = symbol_codes[reference_index, :]
+        seg_codes = symbol_codes[segment_index, :]
+        equal_mask = ref_codes == seg_codes
+        match_mask = operations == CigarOp.MATCH
+        operations[equal_mask & match_mask] = CigarOp.EQUAL
+        operations[~equal_mask & match_mask] = CigarOp.DIFFERENT
+
+    op_tuples = _aggregate_consecutive(operations)
+
+    clip_op = CigarOp.HARD_CLIP if hard_clip else CigarOp.SOFT_CLIP
+    start_clip_length, end_clip_length = _find_clipped_bases(alignment, segment_index)
+    if start_clip_length != 0:
+        start_clip = [(clip_op, start_clip_length)]
+    else:
+        start_clip = np.zeros((0, 2), dtype=int)
+    if end_clip_length != 0:
+        end_clip = [(clip_op, end_clip_length)]
+    else:
+        end_clip = np.zeros((0, 2), dtype=int)
+    op_tuples = np.concatenate((start_clip, op_tuples, end_clip))
+
+    if as_string:
+        cigar = _cigar_from_op_tuples(op_tuples)
+        return cigar
+    else:
+        return op_tuples
+
+
+def _remove_terminal_segment_gaps(alignment, segment_index):
+    """
+    Remove terminal gaps in the segment sequence.
+    """
+    no_gap_pos = np.where(alignment.trace[:, segment_index] != -1)[0]
+    return alignment[no_gap_pos[0] : no_gap_pos[-1] + 1]
+
+
+def _find_clipped_bases(alignment, segment_index):
+    """
+    Find the number of clipped bases at the start and end of the segment.
+    """
+    # Finding the clipped part is easier, when the terminal segment gaps
+    # are removed (if not already done)
+    alignment = _remove_terminal_segment_gaps(alignment, segment_index)
+    seg_trace = alignment.trace[:, segment_index]
+    # Missing bases at the beginning and end of the segment are
+    # interpreted as clipped
+    # As first element in the segment trace is the first aligned base,
+    # all previous bases are clipped...
+    start_clip_length = seg_trace[0]
+    # ...and the same applies for the last base
+    end_clip_length = len(alignment.sequences[segment_index]) - seg_trace[-1] - 1
+    return start_clip_length, end_clip_length
+
+
+def _aggregate_consecutive(operations):
+    """
+    Aggregate consecutive operations of the same type.
+    """
+    op_start_indices = np.where(operations[:-1] != operations[1:])[0]
+    # Also include the first operation
+    op_start_indices += 1
+    op_start_indices = np.concatenate(([0], op_start_indices))
+    ops = operations[op_start_indices]
+    length = np.diff(np.append(op_start_indices, len(operations)))
+    return np.stack((ops, length), axis=-1)
+
+
+def _cigar_from_op_tuples(op_tuples):
+    """
+    Create a CIGAR string from a list of BAM integer tuples.
+
+    The first element of each tuple specifies the operation and the
+    second element specifies the number of repetitions.
+    """
+    cigar = ""
+    for op, count in op_tuples:
+        cigar += str(count) + CigarOp(op).to_cigar_symbol()
+    return cigar
+
+
+def _op_tuples_from_cigar(cigar):
+    """
+    Create a list of tuples from a CIGAR string.
+    """
+    op_tuples = []
+    count = ""
+    for char in cigar:
+        if char.isdigit():
+            count += char
+        else:
+            op = CigarOp.from_cigar_symbol(char)
+            op_tuples.append((op, count))
+            count = ""
+    return np.array(op_tuples, dtype=int)