@teselagen/ove 0.7.28 → 0.7.30-beta.1

package/AnnotationContainerHolder.js

@@ -1,20 +0,0 @@
-import React from "react";
-
-const AnnotationContainerHolder = function (props) {
-  return (
-    <div
-      className={props.className || "annotationContainer"}
-      width="100%"
-      style={{
-        height: props.containerHeight,
-        position: "relative",
-        display: "block",
-        marginTop: props.marginTop + props.extraMargin,
-        marginBottom: props.marginBottom
-      }}
-    >
-      {props.children}
-    </div>
-  );
-};
-export default AnnotationContainerHolder;

package/AnnotationPositioner.js

@@ -1,27 +0,0 @@
-import React from "react";
-
-class AnnotationPositioner extends React.PureComponent {
-  render() {
-    return (
-      <svg
-        data-y-offset={this.props.yOffset}
-        transform={this.props.transform || null}
-        height={`${Math.max(0, this.props.height)}px`}
-        className={
-          (this.props.className || "") + " veRowViewAnnotationPosition"
-        }
-        width={Math.max(0, this.props.width + 5)}
-        style={{
-          position: "absolute",
-          top: this.props.top,
-          left: this.props.left
-        }}
-      >
-        {this.props.children}
-      </svg>
-    );
-  }
-}
-export default AnnotationPositioner;
-
-// key={'feature' + annotation.id + 'start:' + annotationRange.start}

package/AutoAnnotate.js

@@ -1,501 +0,0 @@
-/* eslint-disable jsx-a11y/anchor-is-valid */
-/* eslint-disable jsx-a11y/anchor-has-content */
-/* eslint-disable no-throw-literal */
-import { unparse } from "papaparse";
-import pluralize from "pluralize";
-import { SubmissionError, reduxForm } from "redux-form";
-import shortid from "shortid";
-import CreateAnnotationsPage from "./CreateAnnotationsPage";
-import { formName } from "./constants";
-import { AutoAnnotateBpMatchingDialog } from "./AutoAnnotateBpMatchingDialog";
-import {
-  parseCsvFile,
-  validateCSVRequiredHeaders,
-  validateCSVRow
-} from "@teselagen/file-utils";
-import downloadjs from "downloadjs";
-import {
-  autoAnnotate,
-  convertApELikeRegexToRegex,
-  convertProteinSeqToDNAIupac,
-  getFeatureToColorMap,
-  getFeatureTypes
-} from "@teselagen/sequence-utils";
-import { hideDialog, showDialog } from "./GlobalDialogUtils";
-import { compose } from "redux";
-import {
-  DataTable,
-  DialogFooter,
-  FileUploadField,
-  InfoHelper,
-  showConfirmationDialog,
-  wrapDialog
-} from "@teselagen/ui";
-import { startCase } from "lodash-es";
-import withEditorProps from "./withEditorProps";
-import { useEffect, useState } from "react";
-import { Colors, Tab, Tabs } from "@blueprintjs/core";
-import { typeField } from "./helperComponents/PropertiesDialog/typeField";
-
-export function autoAnnotateFeatures() {
-  showDialog({
-    ModalComponent: AutoAnnotateModal, //we want to use a ModalComponent here so our addon does not
-    props: {
-      annotationType: "feature"
-    }
-  });
-}
-export function autoAnnotateParts() {
-  showDialog({
-    ModalComponent: AutoAnnotateModal, //we want to use a ModalComponent here so our addon does not
-    props: {
-      annotationType: "part"
-    }
-  });
-}
-export function autoAnnotatePrimers() {
-  showDialog({
-    ModalComponent: AutoAnnotateModal, //we want to use a ModalComponent here so our addon does not
-    props: {
-      annotationType: "primer"
-    }
-  });
-}
-
-export const AutoAnnotateModal = compose(
-  wrapDialog(p => ({
-    canEscapeKeyClose: false,
-    title: `Auto Annotate ${startCase(pluralize(p.annotationType))}`
-  })),
-  withEditorProps,
-  reduxForm({ form: formName })
-)(props => {
-  const {
-    sequenceData,
-    handleSubmit,
-    annotationType = "feature",
-    error,
-    getCustomAutoAnnotateList
-  } = props;
-  const [fileType, setSelectedImportType] = useState("csvFile");
-  const [newAnnotations, setNewAnns] = useState(false);
-  const [customAnnResponse, setCustomAnnResponse] = useState();
-  const [loadingCustomAnnList, setLoadingCustomAnnList] = useState();
-  useEffect(() => {
-    (async () => {
-      if (getCustomAutoAnnotateList) {
-        setLoadingCustomAnnList(true);
-        try {
-          const anns = await getCustomAutoAnnotateList(props);
-          setCustomAnnResponse(anns);
-        } catch (e) {
-          window.toastr.warning("Error loading custom annotation list");
-          console.error(`e:`, e);
-        } finally {
-          setLoadingCustomAnnList(false);
-        }
-      }
-    })();
-    // eslint-disable-next-line react-hooks/exhaustive-deps
-  }, []);
-  if (newAnnotations) {
-    return (
-      <CreateAnnotationsPage
-        {...props}
-        newAnnotations={newAnnotations}
-      ></CreateAnnotationsPage>
-    );
-  }
-  return (
-    <div className="bp3-dialog-body">
-      <Tabs
-        renderActiveTabPanelOnly
-        onChange={setSelectedImportType}
-        selectedTabId={fileType}
-      >
-        <Tab
-          panel={
-            <div>
-              <div>
-                Select a CSV file (
-                <a
-                  onClick={() => {
-                    const rows = [
-                      {
-                        name: `Example ${startCase(annotationType)} 1`,
-                        description: "I'm a description",
-                        sequence: `gatNNtacaggttt`,
-                        ...(annotationType === "feature" && {
-                          type: `cds`
-                        }),
-                        isRegex: false,
-                        matchType: "dna"
-                      },
-                      {
-                        name: `Example Protein ${startCase(annotationType)}`,
-                        description: "I'm a description",
-                        sequence: `APGSGTGGGSGSAPG`,
-                        ...(annotationType === "feature" && {
-                          type: `cds`
-                        }),
-                        isRegex: false,
-                        matchType: "protein"
-                      },
-                      {
-                        name: `Example ${startCase(annotationType)} 2`,
-                        description: "I'm another description",
-                        sequence: `gat.*tacccc.*aggttt`,
-                        ...(annotationType === "feature" && {
-                          type: `cds`
-                        }),
-                        isRegex: true,
-                        matchType: "dna"
-                      }
-                    ];
-                    const csv = unparse(rows);
-                    // const blob = new Blob([convert(sequenceData)], { type: "text/plain" });
-                    // const filename = `${sequenceData.name || "Untitled_Sequence"}.${fileExt}`;
-                    // FileSaver.saveAs(blob, filename);
-                    downloadjs(
-                      csv,
-                      `Example CSV Annotation Upload File.csv`,
-                      "text/plain"
-                    );
-                  }}
-                >
-                  download example
-                </a>
-                ) with the following columns:<br></br>
-                <br></br>
-                <div style={{ display: "flex" }}>
-                  name,description,sequence,type,
-                  <span style={{ display: "flex" }}>
-                    isRegex &nbsp;
-                    <InfoHelper
-                      onClick={e => {
-                        e.stopPropagation();
-                        e.preventDefault();
-                        showDialog({
-                          ModalComponent: AutoAnnotateBpMatchingDialog
-                        });
-                      }}
-                      content={
-                        <span>
-                          Any valid regexes allowed. Click for more info about
-                          regex matching
-                        </span>
-                      }
-                    ></InfoHelper>
-                  </span>
-                  ,matchType
-                </div>
-                <br></br>
-                {annotationType !== "feature" && (
-                  <>
-                    <i>Note: the "type" column is optional</i>
-                    <br></br>
-                  </>
-                )}
-              </div>
-              <FileUploadField
-                validateAgainstSchema={validateAgainstSchema}
-                name="csvFile"
-                fileLimit={1}
-                isRequired
-                accept=".csv"
-              ></FileUploadField>
-            </div>
-          }
-          id="csvFile"
-          title="CSV"
-        ></Tab>
-        <Tab
-          panel={
-            <div>
-              <div>
-                Select an ApE style features .txt file (
-                <a
-                  onClick={() => {
-                    downloadjs(
-                      `T3	ATTAACCCTCACTAAAGGGA	primer_bind	cyan	green	0	0
-M13-fwd	TGTAAAACGACGGCCAGT	primer_bind	cyan	green	0	0
-FRT	GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC	misc_recomb	orchid	pink	0	0`,
-                      `Example APE Feature List Upload File.txt`,
-                      "text/plain"
-                    );
-                  }}
-                >
-                  download example
-                </a>
-                ):
-              </div>
-              <FileUploadField
-                fileLimit={1}
-                name="apeFile"
-                isRequired
-                accept=".txt"
-              ></FileUploadField>
-              {error && (
-                <div style={{ padding: 5, color: Colors.RED1 }}>{error}</div>
-              )}
-            </div>
-          }
-          id="apeFile"
-          title="ApE File"
-        ></Tab>
-        {getCustomAutoAnnotateList &&
-          (loadingCustomAnnList ? (
-            <Tab disabled title="Loading..."></Tab>
-          ) : (
-            customAnnResponse &&
-            customAnnResponse.list && (
-              <Tab
-                id="implementerDefined"
-                title={customAnnResponse.title || "Custom List"}
-                panel={
-                  customAnnResponse.list.length ? (
-                    <div>
-                      <DataTable
-                        isInfinite
-                        formName={"customAnnsTable"}
-                        schema={
-                          annotationType === "feature"
-                            ? customAnnsSchema
-                            : customAnnsSchemaNoType
-                        }
-                        entities={customAnnResponse.list}
-                      ></DataTable>
-                    </div>
-                  ) : (
-                    <div>No Annotations Found</div>
-                  )
-                }
-              ></Tab>
-            )
-          ))}
-      </Tabs>
-      <DialogFooter
-        hideModal={hideDialog}
-        disabled={
-          fileType === "implementerDefined" &&
-          !(
-            customAnnResponse &&
-            customAnnResponse.list &&
-            customAnnResponse.list.length
-          )
-        }
-        onClick={handleSubmit(async ({ apeFile, csvFile }) => {
-          let convertNonStandardTypes = false;
-          const annsToCheck = [];
-          try {
-            const validateRow = async (row, rowName) => {
-              const { type = "", sequence } = row;
-              let regexConvertedSeq;
-
-              if (annotationType === "feature") {
-                const cleanedType = getFeatureTypes().find(
-                  t => t.toLowerCase() === type.toLowerCase()
-                );
-                if (!cleanedType) {
-                  if (!convertNonStandardTypes) {
-                    convertNonStandardTypes = await showConfirmationDialog({
-                      cancelButtonText: "Stop Auto-Annotate",
-                      text: `Detected that ${rowName} has a non-standard type of ${type}. We will assign it and all subsequent non-standard types to use the misc_feature type instead`
-                    });
-                    if (!convertNonStandardTypes) {
-                      throw {
-                        validationError: `${rowName} specifies the feature type ${type} which is not valid`
-                      };
-                    }
-                  }
-                  row.type = "misc_feature";
-                } else {
-                  row.type = cleanedType;
-                }
-              }
-              if (!sequence) {
-                throw {
-                  validationError: `${rowName} did not have a sequence`
-                };
-              }
-              if (row.isRegex && row.isRegex.toUpperCase() === "TRUE") {
-                try {
-                  new RegExp(regexConvertedSeq); //just trying out whether the regexConvertedSeq will work as a valid regex
-                } catch (error) {
-                  throw {
-                    validationError: `${rowName} has an invalid sequence/regex. Please fix it manually.`
-                  };
-                }
-                row.isRegex = true;
-              } else {
-                row.isRegex = undefined;
-              }
-              annsToCheck.push(row);
-            };
-            if (fileType === "implementerDefined") {
-              for (const [
-                // eslint-disable-next-line no-unused-vars
-                i,
-                // eslint-disable-next-line no-unused-vars
-                { name, sequence, matchType, type, isRegex }
-              ] of customAnnResponse.list.entries()) {
-                await validateRow(
-                  {
-                    name,
-                    sequence,
-                    matchType,
-                    type,
-                    isRegex: isRegex ? "TRUE" : "FALSE"
-                  },
-                  `Row ${i + 1} (${name})`
-                );
-              }
-            } else if (fileType === "csvFile") {
-              const csvHeaders = ["name", "description", "sequence"];
-              if (annotationType === "feature") {
-                csvHeaders.push("type");
-              }
-              csvHeaders.push("isRegex");
-              const {
-                data,
-                meta: { fields }
-              } = await parseCsvFile(csvFile[0]);
-              const error = validateCSVRequiredHeaders(fields, csvHeaders);
-              if (error) {
-                throw {
-                  validationError: error
-                };
-              }
-
-              // eslint-disable-next-line no-unused-vars
-              for (const [index, row] of data.entries()) {
-                const error = validateCSVRow(row, csvHeaders, index);
-                if (error) {
-                  throw {
-                    validationError: error
-                  };
-                }
-                await validateRow(row, `Row ${index + 1} (${row.name})`);
-              }
-            } else if (fileType === "apeFile") {
-              const { data } = await parseCsvFile(apeFile[0], {
-                header: false
-              });
-              // eslint-disable-next-line no-unused-vars
-              for (const [i, [name, sequence, type]] of data.entries()) {
-                await validateRow(
-                  { name, sequence, type },
-                  `Row ${i + 1} (${name})`
-                );
-              }
-            } else {
-              console.info(`we shouldn't be here!`);
-              console.info(`fileType:`, fileType);
-            }
-
-            if (!annsToCheck.length) {
-              return window.toastr.warning(
-                "No Annotations Detected on File. Please check that your file is in the correct format."
-              );
-            }
-            const annotationsToCheckById = {};
-            annsToCheck.forEach(ann => {
-              if (ann.matchType === "protein") {
-                ann.sequence = convertProteinSeqToDNAIupac(ann.sequence);
-              }
-              const id = shortid();
-              annotationsToCheckById[id] = {
-                ...ann,
-                sequence: ann.isRegex
-                  ? ann.sequence
-                  : convertApELikeRegexToRegex(ann.sequence),
-                id
-              };
-            });
-
-            const seqId = "placeholderId";
-            const { [seqId]: newAnns } = autoAnnotate({
-              seqsToAnnotateById: {
-                [seqId]: { ...sequenceData, id: seqId }
-              },
-              annotationsToCheckById
-            });
-
-            if (newAnns && newAnns.length) {
-              setNewAnns(
-                newAnns.map(a => {
-                  const toRet = {
-                    ...annotationsToCheckById[a.id],
-                    ...a,
-                    forward: a.strand !== -1,
-                    id: shortid()
-                  };
-                  toRet.color =
-                    toRet.color || getFeatureToColorMap()[toRet.type];
-                  return toRet;
-                })
-              );
-            } else {
-              window.toastr.warning(
-                `No ${annotationType}s detected on sequence.`
-              );
-            }
-          } catch (error) {
-            console.error(`error:`, error);
-            if (error.validationError) {
-              throw new SubmissionError({ [fileType]: error.validationError });
-            } else {
-              window.toastr.error(
-                `Error annotating ${annotationType}(s). Double check your file to make sure it is valid!`
-              );
-            }
-          }
-        })}
-        text="Annotate"
-      ></DialogFooter>
-    </div>
-  );
-});
-
-if (!window._ove_addons) window._ove_addons = {};
-window._ove_addons.autoAnnotateFeatures = autoAnnotateFeatures;
-window._ove_addons.autoAnnotateParts = autoAnnotateParts;
-window._ove_addons.autoAnnotatePrimers = autoAnnotatePrimers;
-
-const customAnnsSchema = ["name", "sequence", typeField, "isRegex"];
-const customAnnsSchemaNoType = ["name", "sequence", typeField, "isRegex"];
-
-const validateAgainstSchema = {
-  fields: [
-    {
-      path: "name",
-      type: "string",
-      isRequired: true
-    },
-    {
-      path: "description",
-      type: "string"
-    },
-    {
-      path: "sequence",
-      type: "string",
-      isRequired: true
-    },
-    {
-      path: "type",
-      type: "dropdown",
-      values: getFeatureTypes(),
-      defaultValue: "misc_feature"
-    },
-    {
-      path: "isRegex",
-      type: "boolean"
-    },
-    {
-      path: "matchType",
-      type: "dropdown",
-      defaultValue: "dna",
-      values: ["dna", "protein"]
-    }
-  ]
-};