quorum 0.1.0

data/spec/dummy/config/routes.rb

@@ -0,0 +1,9 @@
+Rails.application.routes.draw do
+
+  mount Quorum::Engine => "/quorum"
+
+  mount Resque::Server.new, :at => "/quorum/resque"
+
+  match "/" => redirect("/quorum")
+
+end

data/spec/dummy/config.ru

@@ -0,0 +1,4 @@
+# This file is used by Rack-based servers to start the application.
+
+require ::File.expand_path('../config/environment',  __FILE__)
+run Dummy::Application

data/spec/dummy/db/schema.rb

@@ -0,0 +1,214 @@
+# encoding: UTF-8
+# This file is auto-generated from the current state of the database. Instead
+# of editing this file, please use the migrations feature of Active Record to
+# incrementally modify your database, and then regenerate this schema definition.
+#
+# Note that this schema.rb definition is the authoritative source for your
+# database schema. If you need to create the application database on another
+# system, you should be using db:schema:load, not running all the migrations
+# from scratch. The latter is a flawed and unsustainable approach (the more migrations
+# you'll amass, the slower it'll run and the greater likelihood for issues).
+#
+# It's strongly recommended to check this file into your version control system.
+
+ActiveRecord::Schema.define(:version => 20111227224920) do
+
+  create_table "quorum_blastn_job_reports", :force => true do |t|
+    t.string   "query"
+    t.integer  "query_len"
+    t.string   "hit_id"
+    t.string   "hit_def"
+    t.string   "hit_accession"
+    t.integer  "hit_len"
+    t.integer  "hsp_num"
+    t.string   "hsp_group"
+    t.integer  "bit_score"
+    t.integer  "score"
+    t.string   "evalue"
+    t.integer  "query_from"
+    t.integer  "query_to"
+    t.integer  "hit_from"
+    t.integer  "hit_to"
+    t.string   "query_frame"
+    t.string   "hit_frame"
+    t.integer  "identity"
+    t.integer  "positive"
+    t.integer  "align_len"
+    t.text     "qseq"
+    t.text     "hseq"
+    t.text     "midline"
+    t.boolean  "results"
+    t.integer  "blastn_job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_blastn_jobs", :force => true do |t|
+    t.string   "expectation"
+    t.integer  "max_score"
+    t.integer  "min_bit_score"
+    t.boolean  "filter"
+    t.boolean  "gapped_alignments"
+    t.integer  "gap_opening_penalty"
+    t.integer  "gap_extension_penalty"
+    t.text     "blast_dbs"
+    t.boolean  "queue"
+    t.integer  "job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_blastp_job_reports", :force => true do |t|
+    t.string   "query"
+    t.integer  "query_len"
+    t.string   "hit_id"
+    t.string   "hit_def"
+    t.string   "hit_accession"
+    t.integer  "hit_len"
+    t.integer  "hsp_num"
+    t.string   "hsp_group"
+    t.integer  "bit_score"
+    t.integer  "score"
+    t.string   "evalue"
+    t.integer  "query_from"
+    t.integer  "query_to"
+    t.integer  "hit_from"
+    t.integer  "hit_to"
+    t.string   "query_frame"
+    t.string   "hit_frame"
+    t.integer  "identity"
+    t.integer  "positive"
+    t.integer  "align_len"
+    t.text     "qseq"
+    t.text     "hseq"
+    t.text     "midline"
+    t.boolean  "results"
+    t.integer  "blastp_job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_blastp_jobs", :force => true do |t|
+    t.string   "expectation"
+    t.integer  "max_score"
+    t.integer  "min_bit_score"
+    t.boolean  "filter"
+    t.boolean  "gapped_alignments"
+    t.integer  "gap_opening_penalty"
+    t.integer  "gap_extension_penalty"
+    t.text     "blast_dbs"
+    t.boolean  "queue"
+    t.integer  "job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_blastx_job_reports", :force => true do |t|
+    t.string   "query"
+    t.integer  "query_len"
+    t.string   "hit_id"
+    t.string   "hit_def"
+    t.string   "hit_accession"
+    t.integer  "hit_len"
+    t.integer  "hsp_num"
+    t.string   "hsp_group"
+    t.integer  "bit_score"
+    t.integer  "score"
+    t.string   "evalue"
+    t.integer  "query_from"
+    t.integer  "query_to"
+    t.integer  "hit_from"
+    t.integer  "hit_to"
+    t.string   "query_frame"
+    t.string   "hit_frame"
+    t.integer  "identity"
+    t.integer  "positive"
+    t.integer  "align_len"
+    t.text     "qseq"
+    t.text     "hseq"
+    t.text     "midline"
+    t.boolean  "results"
+    t.integer  "blastx_job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_blastx_jobs", :force => true do |t|
+    t.string   "expectation"
+    t.integer  "max_score"
+    t.integer  "min_bit_score"
+    t.boolean  "filter"
+    t.boolean  "gapped_alignments"
+    t.integer  "gap_opening_penalty"
+    t.integer  "gap_extension_penalty"
+    t.text     "blast_dbs"
+    t.boolean  "queue"
+    t.integer  "job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_hmmer_jobs", :force => true do |t|
+    t.string   "expectation"
+    t.integer  "min_score"
+    t.boolean  "queue"
+    t.integer  "job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_jobs", :force => true do |t|
+    t.text     "sequence",      :null => false
+    t.text     "na_sequence"
+    t.text     "aa_sequence"
+    t.string   "sequence_hash"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_tblastn_job_reports", :force => true do |t|
+    t.string   "query"
+    t.integer  "query_len"
+    t.string   "hit_id"
+    t.string   "hit_def"
+    t.string   "hit_accession"
+    t.integer  "hit_len"
+    t.integer  "hsp_num"
+    t.string   "hsp_group"
+    t.integer  "bit_score"
+    t.integer  "score"
+    t.string   "evalue"
+    t.integer  "query_from"
+    t.integer  "query_to"
+    t.integer  "hit_from"
+    t.integer  "hit_to"
+    t.string   "query_frame"
+    t.string   "hit_frame"
+    t.integer  "identity"
+    t.integer  "positive"
+    t.integer  "align_len"
+    t.text     "qseq"
+    t.text     "hseq"
+    t.text     "midline"
+    t.boolean  "results"
+    t.integer  "tblastn_job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+  create_table "quorum_tblastn_jobs", :force => true do |t|
+    t.string   "expectation"
+    t.integer  "max_score"
+    t.integer  "min_bit_score"
+    t.boolean  "filter"
+    t.boolean  "gapped_alignments"
+    t.integer  "gap_opening_penalty"
+    t.integer  "gap_extension_penalty"
+    t.text     "blast_dbs"
+    t.boolean  "queue"
+    t.integer  "job_id"
+    t.datetime "created_at"
+    t.datetime "updated_at"
+  end
+
+end

data/spec/dummy/public/404.html

@@ -0,0 +1,26 @@
+<!DOCTYPE html>
+<html>
+<head>
+  <title>The page you were looking for doesn't exist (404)</title>
+  <style type="text/css">
+    body { background-color: #fff; color: #666; text-align: center; font-family: arial, sans-serif; }
+    div.dialog {
+      width: 25em;
+      padding: 0 4em;
+      margin: 4em auto 0 auto;
+      border: 1px solid #ccc;
+      border-right-color: #999;
+      border-bottom-color: #999;
+    }
+    h1 { font-size: 100%; color: #f00; line-height: 1.5em; }
+  </style>
+</head>
+
+<body>
+  <!-- This file lives in public/404.html -->
+  <div class="dialog">
+    <h1>The page you were looking for doesn't exist.</h1>
+    <p>You may have mistyped the address or the page may have moved.</p>
+  </div>
+</body>
+</html>

data/spec/dummy/public/422.html

@@ -0,0 +1,26 @@
+<!DOCTYPE html>
+<html>
+<head>
+  <title>The change you wanted was rejected (422)</title>
+  <style type="text/css">
+    body { background-color: #fff; color: #666; text-align: center; font-family: arial, sans-serif; }
+    div.dialog {
+      width: 25em;
+      padding: 0 4em;
+      margin: 4em auto 0 auto;
+      border: 1px solid #ccc;
+      border-right-color: #999;
+      border-bottom-color: #999;
+    }
+    h1 { font-size: 100%; color: #f00; line-height: 1.5em; }
+  </style>
+</head>
+
+<body>
+  <!-- This file lives in public/422.html -->
+  <div class="dialog">
+    <h1>The change you wanted was rejected.</h1>
+    <p>Maybe you tried to change something you didn't have access to.</p>
+  </div>
+</body>
+</html>

data/spec/dummy/public/500.html

@@ -0,0 +1,26 @@
+<!DOCTYPE html>
+<html>
+<head>
+  <title>We're sorry, but something went wrong (500)</title>
+  <style type="text/css">
+    body { background-color: #fff; color: #666; text-align: center; font-family: arial, sans-serif; }
+    div.dialog {
+      width: 25em;
+      padding: 0 4em;
+      margin: 4em auto 0 auto;
+      border: 1px solid #ccc;
+      border-right-color: #999;
+      border-bottom-color: #999;
+    }
+    h1 { font-size: 100%; color: #f00; line-height: 1.5em; }
+  </style>
+</head>
+
+<body>
+  <!-- This file lives in public/500.html -->
+  <div class="dialog">
+    <h1>We're sorry, but something went wrong.</h1>
+    <p>We've been notified about this issue and we'll take a look at it shortly.</p>
+  </div>
+</body>
+</html>

data/spec/dummy/quorum/bin/search

@@ -0,0 +1,141 @@
+#!/usr/bin/env ruby
+
+$LOAD_PATH.unshift(File.expand_path("../../lib", __FILE__))
+
+require 'trollop'
+require 'active_record'
+require 'search_tools/blast'
+
+# Quorum search tools and dependencies.
+SEARCH_TOOLS = {
+  "blastn"  => ["blastn"],
+  "blastx"  => ["blastx"],
+  "tblastn" => ["tblastn"],
+  "blastp"  => ["blastp"]
+}
+
+module Quorum
+  #
+  # Parse Options for Quorum Search Tools
+  #
+  class Search
+
+    def initialize
+      opts = Trollop::options do
+        text <<-HEAD
+
+Quorum
+
+A flexible bioinformatics search tool.
+
+Options:
+
+        HEAD
+
+        # Search tool
+        opt :search_tool, "Search tool to execute. Available tools: " << 
+        "#{SEARCH_TOOLS.keys.join(', ')}", :type => :string, 
+          :required => true, :short => "-s"
+
+        # General settings
+        opt :log_directory, "Path to log directory", :type => :string,
+          :required => true, :short => "-l"
+        opt :tmp_directory, "Path to tmp directory", :type => :string,
+          :required => true, :short => "-m"
+
+        # ActiveRecord database settings
+        opt :id, "Database record ID", :type => :int, :required => true,
+          :short => "-i"
+        opt :database, "Database name", :type => :string, :required => true,
+          :short => "-d"
+        opt :database_adapter, "ActiveRecord database adapter", 
+          :type => :string, :required => true, :short => "-a"
+        opt :database_host, "Database host", :type => :string, 
+          :required => true, :short => "-k"
+        opt :database_user, "Database username", :type => :string, 
+          :required => true, :short => "-u"
+        opt :database_password, "Database password", :type => :string,
+          :required => true, :short => "-p"
+       
+        # Global settings
+        opt :search_database, "Path to search tool database", :type => :string,
+          :short => "-b"
+        opt :threads, "Number of threads to spawn for search tool", 
+          :type => :int, :short => "-t"
+      end
+
+      @args = {} # Contains valid opts.
+
+      ## Additional opt validation. ##
+
+      unless SEARCH_TOOLS.keys.include?(opts[:search_tool].downcase)
+        Trollop::die :search_tool, "search_tool not found\n" <<
+        "Available search tools: " + SEARCH_TOOLS.keys.join(", ")
+      end
+
+      @args[:search_tool] = opts[:search_tool].downcase
+
+      unless opts[:search_database] && Dir.exists?(opts[:search_database])
+        Trollop::die :search_database, "search tool database not found\n" <<
+        "Supplied directory: " + opts[:search_database]
+      end
+
+      @args[:search_database] = opts[:search_database]
+
+      @args[:id]      = opts[:id]
+      @args[:threads] = opts[:threads]
+
+      unless Dir.exists?(opts[:log_directory])
+        Trollop::die :log_directory, "log directory not found\n" <<
+        "Supplied directory: " + opts[:log_directory]
+      end
+
+      @args[:log_directory] = opts[:log_directory]
+      @args[:tmp_directory] = opts[:tmp_directory]
+
+      ## Check System Dependancies ##
+
+      check_dependencies
+
+      ## Establish ActiveRecord Connection ##
+
+      begin
+        ActiveRecord::Base.establish_connection(
+          :adapter  => opts[:database_adapter],
+          :host     => opts[:database_host],
+          :username => opts[:database_user],
+          :password => opts[:database_password],
+          :database => opts[:database]
+        )
+      rescue Exception => e
+        Trollop::die puts e.message
+      end
+
+      ## Execute search tool ##
+
+      if @args[:search_tool].include? "blast"
+        blast = Quorum::SearchTools::Blast.new(@args)
+        blast.execute_blast
+      end
+    end
+
+    #
+    # Check system dependencies.
+    #
+    def check_dependencies
+      SEARCH_TOOLS[@args[:search_tool]].each do |b|
+        system("which #{b} > /dev/null 2>&1")
+        if $?.exitstatus > 0
+          Trollop::die "Quorum dependency not found for tool " <<
+          "#{@args[:search_tool].to_s}. Please add `#{b}` to your PATH."
+        end
+      end
+    end
+
+  end
+end
+
+if __FILE__ == $0
+  Quorum::Search.new  
+end
+

data/spec/dummy/quorum/blastdb/test/contigs.fa

@@ -0,0 +1,2 @@
+>TOG900080
+TGATAGGATAATTCTAGACAAAACATTAGCCGATCAAGTGTCATCATGGAAAAGCAGCAGGGGCCTTAGTGATACAGTGGTGACTGATCATGCTTGTTCTGGGGAAACATGCTCGTACTACGCAATTGGAGATGTATTTATTTGTGAAAAGACTGGACAAGTTCATGTTTGTGACGAAACATGTAGGGAAGTAGTAATGGATCCCACCAACGAGCTTTTGGTCTGTACAATATCTGGCCACTGTTTTGACAGATTGCTATCACCTGCTGAAATGGAGCCTGATGCTGAGCAGCAGCAAGGTGGTGCGGCAGATGAGGCAGAACCGTTTATGGGATCTGGCCGTTTTGCACGGGCTTATTTGCTGGGATACAATTGTGCTGATGAAAAGGAGCTTGAAGCTACTTTGAGGTTTTGCTGATCCCTATTGGCCCTTCTGGAGTGGATGATCTCATGTCTCAGCATTTACCTATTTAAGATCAAATAAATCGGGTTTCCTTTTCGTGTTTCTCTTGGCATAAGAATGTTTGATTAGATCTAGATTATGAAACTCTAATCGTCTTCTATATTAATAATTGTATGCTTAAATTTATAGTTGAAATTCCATTGATGAATTTTTCTT

data/spec/dummy/quorum/blastdb/test/peptides.fa

@@ -0,0 +1,2 @@
+>ADA84676.1 protein L-isoaspartyl methyltransferase 1 [Cicer arietinum]
+MEQYWSGSAINENKGMVENLQRYGIIKSSKVAETMEKIDRGLFVPNGVQPYIDSPMSIGYNATISAPHMHATCLQLLENYLQPGMHALDVGSGTGYLTACFAMMVGPNGRAVGVEHIPELVSFSINNIEKSAAAPQLKDGSLSVHEGDGRQGWPEFATYDAIHVGAAAPEIPQPLIDQLKTGGRMIIPVGNVFQDLKVVDKNSDGSISIRTETSVRYVPLTSKEAQLKE

data/spec/dummy/quorum/blastdb/test.nhd

@@ -0,0 +1 @@
+8824380950

data/spec/dummy/quorum/blastdb/test.nsd

@@ -0,0 +1 @@
+gnl|bl_ord_id|00

data/spec/dummy/quorum/blastdb/test.phd

@@ -0,0 +1 @@
+28413460680

data/spec/dummy/quorum/blastdb/test.psd

@@ -0,0 +1 @@
+gnl|bl_ord_id|00

data/spec/dummy/quorum/lib/logger.rb

@@ -0,0 +1,43 @@
+module Quorum
+  class Logger
+
+    def initialize(dir)
+      @log_directory = dir
+      @log_file      = "quorum.log"
+    end
+
+    #
+    # Write to log file and exit if exit_status is present.
+    #
+    def log(program, message, exit_status = nil, files = nil)
+      File.open(File.join(@log_directory, @log_file), "a") do |log|
+        log.puts ""
+        log.puts Time.now.to_s + " " + program
+        log.puts message
+        log.puts ""
+      end
+
+      if exit_status
+        remove_files(files) unless files.nil?
+        exit exit_status.to_i
+      end
+    end
+
+    private
+
+    #
+    # Removes instance files.
+    #
+    def remove_files(files)
+      unless Dir.glob(files).empty?
+        `rm #{files}`
+      else
+        log(
+          "remove_files",
+          "Unable to remove #{files}"
+        )
+      end
+    end
+
+  end
+end