genfrag 0.0.0.1

data/spec/genfrag/app/search_command/trim_spec.rb

@@ -0,0 +1,75 @@
+
+require File.expand_path(
+    File.join(File.dirname(__FILE__), %w[.. .. .. spec_helper]))
+    
+# --------------------------------------------------------------------------
+describe Genfrag::App::SearchCommand do
+
+  before :all do
+    @out = StringIO.new
+    @err = StringIO.new
+    @input_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command', 'out')
+    @frozen_output_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'search_command', 'out')
+    @working_output_dir = File.join(GENFRAG_SPEC_TMP_DIR, %w[search_command])
+    FileUtils.mkdir_p(@working_output_dir) unless File.directory? @working_output_dir
+  end
+  
+  before :each do
+    @app = Genfrag::App::SearchCommand.new(@out, @err)
+  end
+  
+  after :each do
+    @out.clear
+    @err.clear
+  end
+  
+  describe 'test calculate_trim_for_nucleotides' do
+    it 'should work for BstYI' do
+      re5_ds = Bio::RestrictionEnzyme::DoubleStranded.new('BstYI')
+      re3_ds = Bio::RestrictionEnzyme::DoubleStranded.new('BstYI')
+      
+      @app.calculate_trim_for_nucleotides(re5_ds, re3_ds).should == {:from_left_primary=>1, :from_right_primary=>5, :from_right_complement=>1, :from_left_complement=>5}
+    end
+    
+    it 'should work for PpiI' do
+      re5_ds = Bio::RestrictionEnzyme::DoubleStranded.new('PpiI')
+      re3_ds = Bio::RestrictionEnzyme::DoubleStranded.new('PpiI')
+      
+      @app.calculate_trim_for_nucleotides(re5_ds, re3_ds).should == {:from_right_primary=>33, :from_left_primary=>38, :from_right_complement=>38, :from_left_complement=>33}
+    end
+  end
+  
+  describe 'test calculate_left_and_right_trims' do
+    it 'should work for BstYI / PpiI' do
+      re5_ds = Bio::RestrictionEnzyme::DoubleStranded.new('BstYI')
+      re3_ds = Bio::RestrictionEnzyme::DoubleStranded.new('PpiI')
+      
+      trim = @app.calculate_trim_for_nucleotides(re5_ds, re3_ds)
+      @app.calculate_left_and_right_trims(trim).should == [{:trim_from_both=>1, :dot_out_from_primary=>false}, {:trim_from_both=>33, :dot_out_from_primary=>false}]
+    end
+    
+    it 'should work for PpiI / BstYI' do
+      re5_ds = Bio::RestrictionEnzyme::DoubleStranded.new('PpiI')
+      re3_ds = Bio::RestrictionEnzyme::DoubleStranded.new('BstYI')
+      
+      trim = @app.calculate_trim_for_nucleotides(re5_ds, re3_ds)
+      @app.calculate_left_and_right_trims(trim).should == [{:trim_from_both=>33, :dot_out_from_primary=>true}, {:trim_from_both=>1, :dot_out_from_primary=>true}]
+    end
+  end
+  
+  describe 'test trim_sequences' do
+    it 'test' do
+      p = "agatccttattgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcggatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctctttatgatttttatgatcagattccaaagaaaattcatggttttaa"
+      c = "tctaggaataactcttgccactcagaagaagtagaaatggagaaggataacaacgcttacgtcgacgtggtcagcctaaactaccaggatacaaagttatagtattagttttagtcgttttcggccaagttaaggttatagtccgagaaatactaaaaatactagtctaaggtttcttttaagtaccaaaatt"
+      l = {:trim_from_both=>1, :dot_out_from_primary=>false}
+      r = {:trim_from_both=>1, :dot_out_from_primary=>true}
+      t = {:from_right_primary=>3, :from_left_primary=>1, :from_right_complement=>1, :from_left_complement=>5}
+      @app.trim_sequences(p,c,l,r,t).should == 
+        ["gatccttattgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcggatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctctttatgatttttatgatcagattccaaagaaaattcatggttt..", 
+          "....gaataactcttgccactcagaagaagtagaaatggagaaggataacaacgcttacgtcgacgtggtcagcctaaactaccaggatacaaagttatagtattagttttagtcgttttcggccaagttaaggttatagtccgagaaatactaaaaatactagtctaaggtttcttttaagtaccaaaat"]
+    end
+  end
+  
+end
+
+# EOF

data/spec/genfrag/app/search_command_spec.rb

@@ -0,0 +1,260 @@
+
+require File.expand_path(
+    File.join(File.dirname(__FILE__), %w[.. .. spec_helper]))
+    
+# --------------------------------------------------------------------------
+describe Genfrag::App::SearchCommand do
+
+=begin 
+  before :all do
+    @out = StringIO.new
+    @err = StringIO.new
+    @input_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command', 'in')
+    @frozen_output_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command', 'out')
+    @working_output_dir = File.join(GENFRAG_SPEC_TMP_DIR, %w[index_command])
+    FileUtils.mkdir_p(@working_output_dir) unless File.directory? @working_output_dir
+  end
+  
+  before :each do
+    @app = Genfrag::App::IndexCommand.new(@out, @err)
+  end
+  
+  after :each do
+    @out.clear
+    @err.clear
+  end
+  
+  describe 'when used from the command-line' do
+    it 'should provide a help command and exit' do
+      lambda {@app.cli_run %w[--help]}.should raise_error(SystemExit)
+      @out.readline.should match(%r/Usage: genfrag index \[options\]/)
+      @out.clear
+
+      lambda {@app.cli_run %w[--help]}.should raise_error(SystemExit)
+      @out.readline.should match(%r/Usage: genfrag index \[options\]/)
+    end
+    
+    it 'should default to the help message and exit if no command is given' do
+      lambda {@app.cli_run %w[]}.should raise_error(SystemExit)
+      @out.readline.should match(%r/Usage: genfrag index \[options\]/)
+    end
+    
+    it 'should stop on unrecognized options' do
+      lambda {@app.cli_run %w[--bad]}.should raise_error(OptionParser::InvalidOption)
+    end
+
+    it 'should recognize a fasta file passed as an argument' do
+      pending 'feature'
+    end
+        
+    it 'should recognize multiple fasta files passed as arguments' do
+      pending 'feature'
+    end
+    
+    it 'should stop on missing --fasta' do
+      lambda {@app.cli_run %w[-v --re5 BstYI --re3 BstYI]}.should raise_error(SystemExit)
+    end
+    
+    it 'should stop on missing --re5' do
+      lambda {@app.cli_run %w[-v --fasta a --re3 BstYI]}.should raise_error(SystemExit)
+    end
+    
+    it 'should stop on missing --re3' do
+      lambda {@app.cli_run %w[-v --fasta a --re5 BstYI]}.should raise_error(SystemExit)
+    end
+    
+    it "should stop when --re3 is passed something it can't recognize" do
+      lambda {@app.cli_run %w[-v --fasta a --re5 BstYI --re3 notanenzyme]}.should raise_error
+    end
+    
+    it "should stop when --re5 is passed something it can't recognize" do
+      lambda {@app.cli_run %w[-v --fasta a --re3 BstYI --re5 notanenzyme]}.should raise_error
+    end
+  end
+  
+  describe 'command-line option parser' do
+    it 'should stop on unrecognized options' do
+      lambda {@app.parse %w[--bad]}.should raise_error(OptionParser::InvalidOption)
+    end
+    
+    it 'should recognize verbose' do
+      @app.parse(%w[--verbose])
+      @app.parse(%w[-v])
+    end
+
+    it 'should recognize tracktime' do
+      @app.parse(%w[--tracktime])
+      @app.parse(%w[-m])
+    end
+    
+    it 'should recognize quiet' do
+      @app.parse(%w[--quiet])
+      @app.parse(%w[-q])
+    end
+    
+    it 'should recognize re5 with string' do
+      @app.parse(%w[--re5 a])
+      @app.parse(%w[-5 a])
+    end
+    
+    it 'should recognize re3 with string' do
+      @app.parse(%w[--re3 a])
+      @app.parse(%w[-3 a])
+    end
+    
+    it 'should recognize sqlite' do
+      @app.parse(%w[--sqlite])
+      @app.parse(%w[-t])
+    end
+    
+    it 'should recognize lookup with string' do
+      @app.parse(%w[--lookup a])
+      @app.parse(%w[-l a])
+    end
+    
+    it 'should recognize fasta with string' do
+      @app.parse(%w[--fasta a])
+      @app.parse(%w[-f a])
+    end
+    
+    it 'should recognize a combination of arguments' do
+      @app.parse(%w[-v --re5 a --re3 a])
+      @app.parse(%w[--verbose -5 a -3 a])
+    end
+  end
+  
+  describe 'with working example,' do
+    
+    after :all do
+      #FileUtils.rm Dir.glob(File.join(@working_output_dir,'*'))
+    end
+    
+    describe 'a.fasta' do
+      
+      before :each do
+        @fasta = 'a.fasta'        
+        @app = Genfrag::App::IndexCommand.new(@out, @err)
+        @app.ops.indir = @input_dir
+        @app.ops.outdir = @working_output_dir
+        @app.ops.filefasta = @fasta
+      end
+      
+    ############################################################
+      describe 'using re5 = BstYI and re3 = MseI' do
+        
+        before :each do
+          @app.ops.re5 = 'BstYI'
+          @app.ops.re3 = 'MseI'
+        end
+
+        describe 'without sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '1-a_lookup'
+            @app.ops.sqlite = false
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('1-a_lookup', '.tdf')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+
+        describe 'with sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '2-a_lookup'
+            @app.ops.sqlite = true
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('2-a_lookup', '.db')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+      end
+
+    ############################################################
+      describe 'using re5 = MseI and re3 = BstYI' do
+        
+        before :each do
+          @app.ops.re5 = 'MseI'
+          @app.ops.re3 = 'BstYI'
+        end
+
+        describe 'without sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '3-a_lookup'
+            @app.ops.sqlite = false
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('3-a_lookup', '.tdf')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+
+        describe 'with sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '4-a_lookup'
+            @app.ops.sqlite = true
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('4-a_lookup', '.db')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+      end
+
+    ############################################################
+      describe 'using re5 = TaqI and re3 = AluI' do
+
+        before :each do
+          @app.ops.re5 = 'TaqI'
+          @app.ops.re3 = 'AluI'
+        end
+
+        describe 'without sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '5-a_lookup'
+            @app.ops.sqlite = false
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('5-a_lookup', '.tdf')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+
+        describe 'with sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '6-a_lookup'
+            @app.ops.sqlite = true
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('6-a_lookup', '.db')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+      end
+      
+    end # a.fasta
+    
+  end # with working example
+=end
+  
+end
+
+# EOF

data/spec/genfrag/app_spec.rb

@@ -0,0 +1,77 @@
+
+require File.expand_path(
+    File.join(File.dirname(__FILE__), %w[.. spec_helper]))
+
+#class Runner
+#  attr_accessor :name
+#  def run(*a, &b) nil; end
+#end
+
+describe Genfrag::App do
+
+  before :all do
+    @out = StringIO.new
+    @err = StringIO.new
+  end
+
+  before :each do
+#    @runner = ::Runner.new
+    @app = Genfrag::App.new(@out, @err)
+
+    Genfrag::App::IndexCommand.stub!(:new)
+    Genfrag::App::SearchCommand.stub!(:new)
+  end
+
+  after :each do
+    @out.clear
+    @err.clear
+  end
+
+  it 'should provide an index command' do
+    @app.cli_run %w[index]
+  end
+
+  it 'should provide a search command' do
+    @app.cli_run %w[search]
+  end
+
+  it 'should provide an info command' do
+    pending "feature"
+    @app.cli_run %w[info]
+  end
+
+  it 'should provide a help command' do
+    @app.cli_run %w[--help]
+    @out.readline
+    @out.readline.should match(%r/GenFrag allows/)
+    @out.clear
+
+    @app.cli_run %w[-h]
+    @out.readline
+    @out.readline.should match(%r/GenFrag allows/)
+  end
+
+  it 'should default to the help message if no command is given' do
+    @app.cli_run []
+    @out.readline
+    @out.readline.should match(%r/GenFrag allows/)
+  end
+
+  it 'should report an error for unrecognized commands' do
+    lambda {@app.cli_run %w[bad_func]}.should raise_error(SystemExit)
+    @err.readline.should == 'ERROR:  While executing genfrag ... (RuntimeError)'
+    @err.readline.should == '    Unknown command "bad_func"'
+  end
+
+  it 'should report a version number' do
+    @app.cli_run %w[--version]
+    @out.readline.should == "Genfrag #{Genfrag::VERSION}"
+    @out.clear
+
+    @app.cli_run %w[-V]
+    @out.readline.should == "Genfrag #{Genfrag::VERSION}"
+  end
+
+end  # describe Genfrag::App
+
+# EOF

data/spec/genfrag_spec.rb

@@ -0,0 +1,87 @@
+
+require File.join(File.dirname(__FILE__), %w[spec_helper])
+
+describe Genfrag do
+  
+  before :all do
+    @root_dir = File.expand_path(File.join(File.dirname(__FILE__), '..'))
+    @app = Genfrag
+  end
+
+  it "finds things releative to 'root'" do
+    Genfrag.path(%w[lib genfrag debug]).
+        should == File.join(@root_dir, %w[lib genfrag debug])
+  end
+  
+  describe 'filename function' do
+    describe 'name_adapters' do
+      it 'should format correctly' do
+        @app.name_adapters('abc.db').should == 'abc'
+        @app.name_adapters('abc.tdf').should == 'abc'
+        @app.name_adapters('abc.x').should == 'abc.x'
+        @app.name_adapters.should be_nil
+      end
+    end
+
+    describe 'name_normalized_fasta' do
+      it 'should format correctly using filefasta option' do
+        @app.name_normalized_fasta(nil,'abc.db').should == 'abc'
+        @app.name_normalized_fasta(nil,'abc.tdf').should == 'abc'
+        @app.name_normalized_fasta(nil,'abc.x').should == 'abc.x'
+      end
+
+      it 'should format correctly using multiple input files' do
+        files = ['zxy', 'abc', 'def']
+        @app.name_normalized_fasta(files).should == 'abc_def_zxy_normalized'
+
+        files = ['zxy', 'foo/abc', 'foo/def']
+        @app.name_normalized_fasta(files).should == 'fooxabc_fooxdef_zxy_normalized'
+      end
+
+      it 'should raise an error without any filename source' do
+        lambda {@app.name_normalized_fasta}.should raise_error
+      end
+    end
+
+    describe 'name_freq_lookup' do
+#      def name_freq_lookup(input_filenames=[],filefasta=nil,filelookup=nil,re5=nil,re3=nil)
+
+      it 'should format correctly using filelookup option' do
+        @app.name_freq_lookup(nil,nil,'abc.db').should == 'abc'
+        @app.name_freq_lookup(nil,nil,'abc.tdf').should == 'abc'
+        @app.name_freq_lookup(nil,nil,'abc.x').should == 'abc.x'
+      end
+
+      it 'should format correctly without filelookup option and with filefasta and enzymes' do
+        re5 = 'MyRe5'
+        re3 = 'MyRe3'
+        @app.name_freq_lookup(nil,'abc.db',nil,re5,re3).should == 'abc_myre5_myre3_index'
+        @app.name_freq_lookup(nil,'abc.tdf',nil,re5,re3).should == 'abc_myre5_myre3_index'
+        @app.name_freq_lookup(nil,'abc.x',nil,re5,re3).should == 'abc.x_myre5_myre3_index'
+      end
+
+      it 'should format correctly using multiple input files and enzymes' do
+        re5 = 'MyRe5'
+        re3 = 'MyRe3'
+
+        files = ['zxy', 'abc', 'def']
+        @app.name_freq_lookup(files,nil,nil,re5,re3).should == 'abc_def_zxy_myre5_myre3_index'
+
+        files = ['zxy', 'foo/abc', 'foo/def']
+        @app.name_freq_lookup(files,nil,nil,re5,re3).should == 'fooxabc_fooxdef_zxy_myre5_myre3_index'
+      end
+
+      it 'should raise an error using multiple input files without enzymes' do
+        files = ['zxy', 'abc', 'def']
+        lambda {@app.name_freq_lookup(files)}.should raise_error
+      end
+
+      it 'should raise an error without any filename source' do
+        lambda {@app.name_freq_lookup}.should raise_error
+      end
+    end
+  end
+  
+end
+
+# EOF