genfrag 0.0.0.1

data/lib/genfrag/app/search_command/match.rb

@@ -0,0 +1,165 @@
+
+module Genfrag
+class App
+
+class SearchCommand < Command
+
+# Does the sequence match the adapter
+#
+  def matches_adapter(five_or_three, primary_frag, complement_frag, raw_frag, trim)
+    adapter_specificity = nil
+    adapter_sequence    = nil
+    adapter_size        = nil
+    trim_primary        = nil
+    trim_complement     = nil
+
+    if five_or_three == 5
+      tail = right_tail_of(Bio::RestrictionEnzyme::DoubleStranded.new(@ops.re5).aligned_strands_with_cuts.primary)
+
+      adapter_specificity = @adapters[:adapter5_specificity].upcase
+      adapter_sequence    = @adapters[:adapter5_sequence].upcase if @adapters[:adapter5_sequence]
+      adapter_size        = @adapters[:adapter5_size]
+      trim_primary        = trim[:from_left_primary]
+      trim_complement     = trim[:from_left_complement]
+
+      # TEMP Check for match
+      primary_frag =~ /(\.*)/
+      dots_on_primary = $1.size
+      lead_in = tail.size + dots_on_primary
+      return false if primary_frag[ lead_in .. -1 ].tr('.', '') !~ /^#{adapter_specificity}/i
+
+    elsif five_or_three == 3
+      tail = left_tail_of(Bio::RestrictionEnzyme::DoubleStranded.new(@ops.re3).aligned_strands_with_cuts.primary)
+
+      if @adapters[:adapter3_specificity][0].chr == '_'
+        adapter_specificity = @adapters[:adapter3_specificity][1..-1].reverse.upcase
+      else
+        adapter_specificity = Bio::Sequence::NA.new(@adapters[:adapter3_specificity]).forward_complement.to_s.upcase
+      end
+      adapter_sequence    = Bio::Sequence::NA.new(@adapters[:adapter3_sequence]).forward_complement.to_s.upcase if @adapters[:adapter3_sequence]
+      adapter_size        = @adapters[:adapter3_size]
+      trim_primary        = trim[:from_right_primary]
+      trim_complement     = trim[:from_right_complement]
+      primary_frag.reverse!
+      complement_frag.reverse!
+      raw_frag.reverse!
+
+      # TEMP Check for match
+      primary_frag =~ /(\.*)/
+      dots_on_primary = $1.size
+      lead_in = tail.size + dots_on_primary
+      return false if primary_frag[ lead_in .. -1 ].tr('.', '') !~ /^#{adapter_specificity}/i
+
+    else
+      raise "First argument to matches_adapter must be a '5' or a '3'. Received: #{five_or_three.inspect}"
+    end
+
+    #return false if raw_frag[ [trim_primary, trim_complement].max .. -1 ] !~ /^#{adapter_specificity}/i
+
+    #overhang = [trim_primary, trim_complement].max - [trim_primary, trim_complement].min
+
+    #lead_in = overhang
+
+    if adapter_sequence
+      raise 'FIXME - not functional yet'
+
+  #      if lead_in >= adapter_sequence.size
+  #        # need to preserve dots on primary string
+  #        new_primary_frag = ('.' * (lead_in - adapter_sequence.size)) + adapter_sequence + primary_frag[ lead_in .. -1 ]
+  #        new_complement_frag = complement_frag
+  #      else
+  #        # need to add dots to beginning of complement string
+  #        new_primary_frag = adapter_sequence + primary_frag[ lead_in .. -1 ]
+  #        new_complement_frag = ('.' * (adapter_sequence.size - lead_in) ) + complement_frag
+  #      end
+
+    elsif adapter_size
+      raise 'FIXME - not functional yet'
+
+  #      # only the size and the specificity of the adapter has been provided
+  #      size_of_specificity = adapter_specificity.size
+  #      size_of_sequence    = adapter_size - size_of_specificity
+  #      if lead_in >= size_of_sequence
+  #        # need to preserve dots on primary string
+  #        new_primary_frag = primary_frag[ 0 .. (lead_in - 1) ].upcase + primary_frag[ lead_in .. -1 ]
+  #        new_complement_frag = complement_frag
+  #      else
+  #        # need to add dots to beginning of complement string
+  #        new_primary_frag = ('+' * (size_of_sequence - lead_in) ) + primary_frag[ 0 .. (lead_in - 1) ].upcase + primary_frag[ lead_in .. -1 ]
+  #        new_complement_frag = ('.' * (size_of_sequence - lead_in) ) + complement_frag
+  #      end
+
+    else
+    # only the specificity has been provided
+      new_primary_frag = ('.' * dots_on_primary) + ('+' * tail.size) + primary_frag[ lead_in .. -1 ]
+      new_complement_frag = complement_frag
+
+    end
+
+    if five_or_three == 3
+      new_primary_frag.reverse!
+      new_complement_frag.reverse!
+    end
+
+    return [new_primary_frag, new_complement_frag]
+  end
+
+
+# Find the fragments that match the search parameters
+#
+  def find_matching_fragments(sizes, left, right)
+    hits=[]
+    s = (@adapters[:adapter5_size] or 0) + (@adapters[:adapter3_size] or 0)
+
+    if [@ops.size].flatten == [0] or [@ops.size].flatten == [nil] or [@ops.size].flatten == ["0"]
+      sizes.each do |raw_size, info|
+        hits << info
+      end
+
+    else
+      [@ops.size].flatten.each do |seek_size|
+        seek_size = seek_size.to_i
+        sizes.each do |raw_size, info|
+          frag_size = raw_size - left[:trim_from_both] - right[:trim_from_both]
+          if (frag_size >= seek_size - s) and (frag_size <= seek_size + s)
+            hits << info
+          end
+        end
+      end
+    end
+
+    return hits
+  end
+
+  def right_tail_of(s)
+  # 'PpiI' => "n n n n n n^n n n n n n n g a a c n n n n n c t c n n n n n n n n n n n n n^n"
+  # => 'n'
+  # 'BstYI' => "r^g a t c y"
+  # => 'gatcy'
+
+    if s =~ /.*\^(.*)/
+      return $1.tr(' ', '')
+    else
+      raise "Sequence #{s} has no cuts (defined by symbol '^')"
+    end
+  end
+
+  def left_tail_of(s)
+  # 'PpiI' => "n n n n n n^n n n n n n n g a a c n n n n n c t c n n n n n n n n n n n n n^n"
+  # => 'nnnnnn'
+  # 'BstYI' => "r^g a t c y"
+  # => 'r'
+
+    if s =~ /([^\^]*)\^/
+      return $1.tr(' ', '')
+    else
+      raise "Sequence #{s} has no cuts (defined by symbol '^')"
+    end
+
+  end
+
+end  # class SearchCommand
+end  # class App
+end  # module Genfrag
+
+# EOF

data/lib/genfrag/app/search_command/process_file.rb

@@ -0,0 +1,125 @@
+
+module Genfrag
+class App
+
+class SearchCommand < Command
+
+  class ProcessFile
+    class << self
+    # Process the standardized Fasta file (tdf format)
+    #
+      def process_tdf_fasta_file(f_normalized_fasta)
+        sequences = {}
+        f_normalized_fasta[1..-1].each do |line|
+          line = line.chomp.split("\t")
+          id = line[0].to_i
+          sequences[id] = {:definitions => CSV.parse_line(line[1]), :sequence => line[2]}
+        end
+        return sequences
+      end
+
+    # Process the standardized Fasta file (sqlite3 format)
+      def process_db_fasta_file(db_normalized_fasta)
+        sequences = {}
+        db_normalized_fasta.execute( "select * from db_normalized_fasta" ) do |row|
+          id = row[0].to_i
+          sequences[id] = {:definitions => CSV.parse_line(row[1]), :sequence => row[2]}
+        end
+        return sequences
+      end
+
+    # Process the fragment frequency file (tdf format)
+    #
+      def process_tdf_freq_lookup(f_freq_lookup)
+        sizes = {}
+        f_freq_lookup[1..-1].each do |line|
+          line = line.chomp.split("\t")
+          id = line[0]
+          size = line[1].to_i
+          multiple = []
+          line[2].split(', ').each do |a|
+            pos = {}
+            pos[:offset], pos[:fasta_id] = a.split(' ')
+            pos[:offset] = pos[:offset].to_i
+            pos[:raw_size] = size.to_i
+            pos[:fasta_id] = pos[:fasta_id].to_i
+            multiple << pos
+          end
+          sizes[size] = multiple
+        end
+        return sizes
+      end
+
+    # Process the fragment frequency file (sqlite3 format)
+    #
+      def process_db_freq_lookup(db_freq_lookup)
+        sizes = {}
+        db_freq_lookup.execute( "select * from db_freq_lookup" ) do |row|
+          id = row[0]
+          size = row[1].to_i
+          multiple = []
+          row[2].split(', ').each do |a|
+            pos = {}
+            pos[:offset], pos[:fasta_id] = a.split(' ')
+            pos[:offset] = pos[:offset].to_i
+            pos[:raw_size] = size.to_i
+            pos[:fasta_id] = pos[:fasta_id].to_i
+            multiple << pos
+          end
+          sizes[size] = multiple
+        end
+        return sizes
+      end
+
+    # Process the adapter file (tdf format)
+    #
+      def process_tdf_adapters(f_adapters, adapter5_name=nil, adapter3_name=nil)
+        adapter5_sequence = nil
+        adapter3_sequence = nil
+        adapter5_specificity = nil
+        adapter3_specificity = nil
+        adapter5_needs_to_be_found = !adapter5_name.nil?
+        adapter3_needs_to_be_found = !adapter3_name.nil?
+        f_adapters[1..-1].each do |line|
+          break if !(adapter5_needs_to_be_found or adapter3_needs_to_be_found)
+          line = line.chomp.split("\t")
+          next if line.empty?
+          name = line[0]
+          worksense = line[1][0].chr.to_i
+          sequence = line[2].gsub(/\|N*$/i,'')
+          specificity = line[3] # what it's supposed to match
+          if (worksense != 3 and worksense != 5)
+            raise "Unknown worksense value \"#{line[1]}\". First character of column must be a '5' or a '3'."
+          end
+          
+          if adapter5_name and (worksense == 5) and ( name =~ /#{adapter5_name}/i )
+            adapter5_sequence = sequence
+            adapter5_specificity = specificity
+            adapter5_needs_to_be_found = false
+          elsif adapter3_name and (worksense == 3) and ( name =~ /#{adapter3_name}/i )
+            adapter3_sequence = sequence
+            adapter3_specificity = specificity
+            adapter3_needs_to_be_found = false
+          end
+        end
+        if ( adapter5_name and adapter5_needs_to_be_found )
+          raise "named-adapter5 ('#{adapter5_name}') with the worksense '5' not found."
+        elsif ( adapter3_name and adapter3_needs_to_be_found )
+          raise "named-adapter3 ('#{adapter3_name}') with the worksense '3' not found."
+        end
+        return {
+          :adapter5_sequence    => adapter5_sequence,
+          :adapter5_specificity => adapter5_specificity,
+          :adapter3_sequence    => adapter3_sequence,
+          :adapter3_specificity => adapter3_specificity
+        }
+      end
+
+    end
+  end # class ProcessFile
+
+end  # class SearchCommand
+end  # class App
+end  # module Genfrag
+
+# EOF

data/lib/genfrag/app/search_command/trim.rb

@@ -0,0 +1,121 @@
+
+module Genfrag
+class App
+
+class SearchCommand < Command
+
+# Keep track of extraneous nucleotides that should be removed from the final fragment
+#
+# Example BstYI used as RE5
+# BstYI -
+#   5' - r^g a t c y - 3'
+#   3' - y c t a g^r - 5'
+#
+#   re5_ds.cut_locations.primary              # => [0]
+#   re5_ds.cut_locations.complement           # => [4]
+#   re5_ds.aligned_strands.primary.size       # => 6
+#
+#   # number of nucleotides to trim from the left side on the primary strand
+#   re5_ds.cut_locations.primary.max + 1      # => 1
+#
+#   # number of nucleotides to trim from the left side on the complement strand
+#   re5_ds.cut_locations.complement.max + 1   # => 5
+#
+#
+# Example BstYI used as RE3
+# BstYI -
+#   5' - r^g a t c y - 3'
+#   3' - y c t a g^r - 5'
+#
+#   re3_ds.cut_locations.primary              # => [0]
+#   re3_ds.cut_locations.complement           # => [4]
+#   re3_ds.aligned_strands.primary.size       # => 6
+#
+#   # number of nucleotides to trim from the right side on the primary strand
+#   re3_ds.aligned_strands.primary.size - (re3_ds.cut_locations.primary.min + 1)      # => 5
+#
+#   # number of nucleotides to trim from the right side on the complement strand
+#   re3_ds.aligned_strands.primary.size - (re3_ds.cut_locations.complement.min + 1)   # => 1
+#
+#
+# Example PpiI used as RE5
+# PpiI -
+#   5' - n n n n n n^n n n n n n n g a a c n n n n n c t c n n n n n n n n n n n n n^n - 3'
+#   3' - n^n n n n n n n n n n n n c t t g n n n n n g a g n n n n n n n n^n n n n n n - 5'
+#
+#   re5_ds.cut_locations.primary              # => [5, 37]
+#   re5_ds.cut_locations.complement           # => [0, 32]
+#   re5_ds.aligned_strands.primary.size       # => 39
+#
+#   # number of nucleotides to trim from the left side on the primary strand
+#   re5_ds.cut_locations.primary.max + 1      # => 38
+#
+#   # number of nucleotides to trim from the left side on the complement strand
+#   re5_ds.cut_locations.complement.max + 1   # => 33
+#
+#
+# Example PpiI used as RE3
+# PpiI -
+#   5' - n n n n n n^n n n n n n n g a a c n n n n n c t c n n n n n n n n n n n n n^n - 3'
+#   3' - n^n n n n n n n n n n n n c t t g n n n n n g a g n n n n n n n n^n n n n n n - 5'
+#
+#   re3_ds.cut_locations.primary              # => [5, 37]
+#   re3_ds.cut_locations.complement           # => [0, 32]
+#   re3_ds.aligned_strands.primary.size       # => 39
+#
+#   # number of nucleotides to trim from the right side on the primary strand
+#   re3_ds.aligned_strands.primary.size - (re3_ds.cut_locations.primary.min + 1)      # => 33
+#
+#   # number of nucleotides to trim from the right side on the complement strand
+#   re3_ds.aligned_strands.primary.size - (re3_ds.cut_locations.complement.min + 1)   # => 38
+#
+  def calculate_trim_for_nucleotides(re5_ds, re3_ds)
+    trim = {}
+    trim[:from_left_primary]     = re5_ds.cut_locations.primary.max + 1
+    trim[:from_left_complement]  = re5_ds.cut_locations.complement.max + 1
+    trim[:from_right_primary]    = re3_ds.aligned_strands.primary.size - (re3_ds.cut_locations.primary.min + 1)
+    trim[:from_right_complement] = re3_ds.aligned_strands.primary.size - (re3_ds.cut_locations.complement.min + 1)
+    return trim
+  end
+
+# Calculate left and right trims
+#
+  def calculate_left_and_right_trims(trim)
+    left = {}
+    # Should we "dot out" (nucleotide padding) from the primary strand? If no, then we assume the complement needs padding.
+    left[:dot_out_from_primary] = (trim[:from_left_primary] > trim[:from_left_complement])
+    # How much gets cut off on both primary and complement strands
+    left[:trim_from_both] = [trim[:from_left_primary], trim[:from_left_complement]].min
+
+    right = {}
+    right[:dot_out_from_primary] = (trim[:from_right_primary] > trim[:from_right_complement])
+    right[:trim_from_both] = [trim[:from_right_primary], trim[:from_right_complement]].min
+    return [left,right]
+  end
+
+# Do the trimming
+#
+  def trim_sequences(primary_frag, complement_frag, left, right, trim)
+    if left[:dot_out_from_primary]
+      primary_frag = "." * trim[:from_left_primary] + primary_frag[trim[:from_left_primary]..-1]
+    else
+      complement_frag = "." * trim[:from_left_complement] + complement_frag[trim[:from_left_complement]..-1]
+    end
+
+    if right[:dot_out_from_primary]
+      primary_frag = primary_frag[0..(-1 - trim[:from_right_primary])] + "." * trim[:from_right_primary]
+    else
+      complement_frag = complement_frag[0..(-1 - trim[:from_right_primary])] + "." * trim[:from_right_primary]
+    end
+
+    primary_frag = primary_frag[left[:trim_from_both]..(-1-right[:trim_from_both])]
+    complement_frag = complement_frag[left[:trim_from_both]..(-1-right[:trim_from_both])]
+  
+    return [primary_frag, complement_frag]
+  end
+
+end  # class SearchCommand
+end  # class App
+end  # module Genfrag
+
+# EOF

data/spec/data/index_command/in/a.fasta

@@ -0,0 +1,109 @@
+
+>At1g02580 mRNA (2291 bp) UTR's and CDS
+aggcgagtggttaatggagaaggaaaaccatgaggacgatggtgagggtttgccacccgaactaaatcagataaaa
+gagcaaatcgaaaaggagagatttctgcatatcaagagaaaattcgagctgagatacattccaagtgtggctactc
+atgcttcacaccatcaatcgtttgacttaaaccagcccgctgcagaggatgataatggaggagacaacaaatcact
+tttgtcgagaatgcaaaacccacttcgtcatttcagtgcctcatctgattataattcttacgaagatcaaggttat
+gttcttgatgaggatcaagattatgctcttgaagaagatgtaccattatttcttgatgaagatgtaccattattac
+caagtgtcaagcttccaattgttgagaagctaccacgatccattacatgggtcttcaccaaaagtagccagctgat
+ggctgaaagtgattctgtgattggtaagagacaaatctattatttgaatggtgaggcactagaattgagcagtgaa
+gaagatgaggaagatgaagaagaagatgaggaagaaatcaagaaagaaaaatgcgaattttctgaagatgtagacc
+gatttatatggacggttgggcaggactatggtttggatgatctggtcgtgcggcgtgctctcgccaagtacctcga
+agtggatgtttcggacatattggaaagatacaatgaactcaagcttaagaatgatggaactgctggtgaggcttct
+gatttgacatccaagacaataactactgctttccaggattttgctgatagacgtcattgccgtcgttgcatgatat
+tcgattgtcatatgcatgagaagtatgagcccgagtctagatccagcgaagacaaatctagtttgtttgaggatga
+agatagacaaccatgcagtgagcattgttacctcaaggtgaggagtgtgacagaagctgatcatgtgatggataat
+gataactctatatcaaacaagattgtggtctcagatccaaacaacactatgtggacgcctgtagagaaggatcttt
+acttgaaaggaattgagatatttgggagaaacagttgtgatgttgcattaaacatacttcgggggcttaagacgtg
+cctagagatttacaattacatgcgcgaacaagatcaatgtactatgtcattagaccttaacaaaactacacaaaga
+cacaatcaggttaccaaaaaagtatctcgaaaaagtagtaggtcggtccgcaaaaaatcgagactccgaaaatatg
+ctcgttatccgcctgctttaaagaaaacaactagtggagaagctaagttttataagcactacacaccatgcacttg
+caagtcaaaatgtggacagcaatgcccttgtttaactcacgaaaattgctgcgagaaatattgcgggtgctcaaag
+gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctg
+ctaatcgtgaatgcgatcca  gatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacacc
+agtgcaaatccaatgcaagaacatgcaattcctccttcaaaccaataaaaagattctcattggaaagtctgatgtt
+catggatggggtgcatttacatgggactctct  taaaaagaatgagtatctcggagaatatactggagaactgatca
+ctcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca
+gctcgaaatcgatgctcgccgtaaaggaaacgagttcaaatttctcaatcactcagcaagacctaactgctacgcc
+aagttgatgattgtgagaggagatcagaggattggtctatttgcggagagagcaatcgaagaaggtgaggagcttt
+tcttcgactactgctatggaccagaacatgcggattggtcgcgtggtcgagaacctagaaagactggtgcttctaa
+aaggtctaaggaagcccgtccagctcgttagtttttgatctgaggagaagcagcaattcaagcagtccttttttta
+tgttatggtatatcaattaataatgtaatgctattttgtgttactaaaccaaaacttaagtttctgttttatttgt
+tttagggtgttttgtttgtatcatatgtgtcttaactttcaaagttttctttttgtatttcaatttaaaaacaatg
+tttatgttgtt
+
+>At1g02580 mRNA (2291 bp) UTR's and CDS (duplicate)
+aggcgagtggttaatggagaaggaaaaccatgaggacgatggtgagggtttgccacccgaactaaatcagataaaa
+gagcaaatcgaaaaggagagatttctgcatatcaagagaaaattcgagctgagatacattccaagtgtggctactc
+atgcttcacaccatcaatcgtttgacttaaaccagcccgctgcagaggatgataatggaggagacaacaaatcact
+tttgtcgagaatgcaaaacccacttcgtcatttcagtgcctcatctgattataattcttacgaagatcaaggttat
+gttcttgatgaggatcaagattatgctcttgaagaagatgtaccattatttcttgatgaagatgtaccattattac
+caagtgtcaagcttccaattgttgagaagctaccacgatccattacatgggtcttcaccaaaagtagccagctgat
+ggctgaaagtgattctgtgattggtaagagacaaatctattatttgaatggtgaggcactagaattgagcagtgaa
+gaagatgaggaagatgaagaagaagatgaggaagaaatcaagaaagaaaaatgcgaattttctgaagatgtagacc
+gatttatatggacggttgggcaggactatggtttggatgatctggtcgtgcggcgtgctctcgccaagtacctcga
+agtggatgtttcggacatattggaaagatacaatgaactcaagcttaagaatgatggaactgctggtgaggcttct
+gatttgacatccaagacaataactactgctttccaggattttgctgatagacgtcattgccgtcgttgcatgatat
+tcgattgtcatatgcatgagaagtatgagcccgagtctagatccagcgaagacaaatctagtttgtttgaggatga
+agatagacaaccatgcagtgagcattgttacctcaaggtgaggagtgtgacagaagctgatcatgtgatggataat
+gataactctatatcaaacaagattgtggtctcagatccaaacaacactatgtggacgcctgtagagaaggatcttt
+acttgaaaggaattgagatatttgggagaaacagttgtgatgttgcattaaacatacttcgggggcttaagacgtg
+cctagagatttacaattacatgcgcgaacaagatcaatgtactatgtcattagaccttaacaaaactacacaaaga
+cacaatcaggttaccaaaaaagtatctcgaaaaagtagtaggtcggtccgcaaaaaatcgagactccgaaaatatg
+ctcgttatccgcctgctttaaagaaaacaactagtggagaagctaagttttataagcactacacaccatgcacttg
+caagtcaaaatgtggacagcaatgcccttgtttaactcacgaaaattgctgcgagaaatattgcgggtgctcaaag
+gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctg
+ctaatcgtgaatgcgatcca  gatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacacc
+agtgcaaatccaatgcaagaacatgcaattcctccttcaaaccaataaaaagattctcattggaaagtctgatgtt
+catggatggggtgcatttacatgggactctct  taaaaagaatgagtatctcggagaatatactggagaactgatca
+ctcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca
+gctcgaaatcgatgctcgccgtaaaggaaacgagttcaaatttctcaatcactcagcaagacctaactgctacgcc
+aagttgatgattgtgagaggagatcagaggattggtctatttgcggagagagcaatcgaagaaggtgaggagcttt
+tcttcgactactgctatggaccagaacatgcggattggtcgcgtggtcgagaacctagaaagactggtgcttctaa
+aaggtctaaggaagcccgtccagctcgttagtttttgatctgaggagaagcagcaattcaagcagtccttttttta
+tgttatggtatatcaattaataatgtaatgctattttgtgttactaaaccaaaacttaagtttctgttttatttgt
+tttagggtgttttgtttgtatcatatgtgtcttaactttcaaagttttctttttgtatttcaatttaaaaacaatg
+tttatgttgtt
+
+>At1g65300: mRNA 837bp
+atgaagagaaagatgaagttatcgttaatagaaaacagtgtatcgaggaaaacaacattcaccaaaaggaagaaag
+ggatgacgaagaaactaaccgagctagtcactctatgtggtgttgaagcatgtgcggtcgtctatagtccgttcaa
+ctcgatcccggaggcttggccgtcaagggaaggcgttgaagacgtggtgtcgaaatttatggagttgtcggtgttg
+gaccggaccaagaagatggtggatcaagagacttttataagtcaaaggatcgccaaagaaaaagagcagctgcaga
+agctacgtgatgagaaccataattctcagattcgggagttaatgtttggttgtctcaaaggggagacgaatgtgta
+taatcttgatggaagggatcttcaagatttgagtttatatattgataagtatcttaatggtcttactcgcaggatt
+ga  gatcctTAttgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcg
+gatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctcttta
+tgatttttatgatcagattccaaagaaaattcatggttt  taatatgaatatgaataaggattcgaatcaaagtatg
+gttttggatttgaatcaaaatcttaatgatggagaggacgagggcattccttgcatggacaacaacaactaccacc
+ccgaaatcgattgtctcgctaccgtcaccactgcccccactgatgtttgtgctcctaacatcaccaatgatctcta
+g
+
+>At1g65300: mRNA 837bp (shortened at end)
+atgaagagaaagatgaagttatcgttaatagaaaacagtgtatcgaggaaaacaacattcaccaaaaggaagaaag
+ggatgacgaagaaactaaccgagctagtcactctatgtggtgttgaagcatgtgcggtcgtctatagtccgttcaa
+ctcgatcccggaggcttggccgtcaagggaaggcgttgaagacgtggtgtcgaaatttatggagttgtcggtgttg
+gaccggaccaagaagatggtggatcaagagacttttataagtcaaaggatcgccaaagaaaaagagcagctgcaga
+agctacgtgatgagaaccataattctcagattcgggagttaatgtttggttgtctcaaaggggagacgaatgtgta
+taatcttgatggaagggatcttcaagatttgagtttatatattgataagtatcttaatggtcttactcgcaggatt
+gagatcctTAttgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcg
+gatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctcttta
+tgatttttatgatcag
+
+
+>At1g65300: mRNA 837bp (shortened from start)
+ttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcg
+gatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctcttta
+tgatttttatgatcagattccaaagaaaattcatggttttaatatgaatatgaataaggattcgaatcaaagtatg
+gttttggatttgaatcaaaatcttaatgatggagaggacgagggcattccttgcatggacaacaacaactaccacc
+ccgaaatcgattgtctcgctaccgtcaccactgcccccactgatgtttgtgctcctaacatcaccaatgatctcta
+g
+
+
+>At1g02580 - shortened for test - inserted cutpoint
+gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctg
+ctaatcgtgaatgcgatcca  gatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacacc
+agtgcaaatccaatgcaagaacatgcaataataaaaagattctcattggaaagtctgatgttcatggattcatggt
+tttaattggggtgcatttacatgggactctct  taaaaagaatgagtatctcggagaatatactggagaactgatca
+ctcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca
+