genfrag 0.0.0.1

data/spec/data/index_command/out/1-a_lookup.tdf

@@ -0,0 +1,4 @@
+id	Size	Positions
+1	138	95 5
+2	193	457 1
+3	168	1539 4

data/spec/data/index_command/out/3-a_lookup.tdf

@@ -0,0 +1,2 @@
+id	Size	Positions
+1	30	433 2

data/spec/data/index_command/out/5-a_lookup.tdf

@@ -0,0 +1,4 @@
+id	Size	Positions
+1	71	53 5
+2	55	2022 4
+3	98	201 2

data/spec/data/index_command/out/a.fasta.tdf

@@ -0,0 +1,6 @@
+id	Definitions	Sequence
+1	At1g65300: mRNA 837bp	atgaagagaaagatgaagttatcgttaatagaaaacagtgtatcgaggaaaacaacattcaccaaaaggaagaaagggatgacgaagaaactaaccgagctagtcactctatgtggtgttgaagcatgtgcggtcgtctatagtccgttcaactcgatcccggaggcttggccgtcaagggaaggcgttgaagacgtggtgtcgaaatttatggagttgtcggtgttggaccggaccaagaagatggtggatcaagagacttttataagtcaaaggatcgccaaagaaaaagagcagctgcagaagctacgtgatgagaaccataattctcagattcgggagttaatgtttggttgtctcaaaggggagacgaatgtgtataatcttgatggaagggatcttcaagatttgagtttatatattgataagtatcttaatggtcttactcgcaggattgagatcctTAttgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcggatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctctttatgatttttatgatcagattccaaagaaaattcatggttttaatatgaatatgaataaggattcgaatcaaagtatggttttggatttgaatcaaaatcttaatgatggagaggacgagggcattccttgcatggacaacaacaactaccaccccgaaatcgattgtctcgctaccgtcaccactgcccccactgatgtttgtgctcctaacatcaccaatgatctctag
+2	At1g65300: mRNA 837bp (shortened at end)	atgaagagaaagatgaagttatcgttaatagaaaacagtgtatcgaggaaaacaacattcaccaaaaggaagaaagggatgacgaagaaactaaccgagctagtcactctatgtggtgttgaagcatgtgcggtcgtctatagtccgttcaactcgatcccggaggcttggccgtcaagggaaggcgttgaagacgtggtgtcgaaatttatggagttgtcggtgttggaccggaccaagaagatggtggatcaagagacttttataagtcaaaggatcgccaaagaaaaagagcagctgcagaagctacgtgatgagaaccataattctcagattcgggagttaatgtttggttgtctcaaaggggagacgaatgtgtataatcttgatggaagggatcttcaagatttgagtttatatattgataagtatcttaatggtcttactcgcaggattgagatcctTAttgagaacggtgagtcttcttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcggatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctctttatgatttttatgatcag
+3	At1g65300: mRNA 837bp (shortened from start)	ttcatctttacctcttcctattgttgcgaatgcagctgcaccagtcggatttgatggtcctatgtttcaatatcataatcaaaatcagcaaaagccggttcaattccaatatcaggctctttatgatttttatgatcagattccaaagaaaattcatggttttaatatgaatatgaataaggattcgaatcaaagtatggttttggatttgaatcaaaatcttaatgatggagaggacgagggcattccttgcatggacaacaacaactaccaccccgaaatcgattgtctcgctaccgtcaccactgcccccactgatgtttgtgctcctaacatcaccaatgatctctag
+4	At1g02580 mRNA (2291 bp) UTR's and CDS,At1g02580 mRNA (2291 bp) UTR's and CDS (duplicate)	aggcgagtggttaatggagaaggaaaaccatgaggacgatggtgagggtttgccacccgaactaaatcagataaaagagcaaatcgaaaaggagagatttctgcatatcaagagaaaattcgagctgagatacattccaagtgtggctactcatgcttcacaccatcaatcgtttgacttaaaccagcccgctgcagaggatgataatggaggagacaacaaatcacttttgtcgagaatgcaaaacccacttcgtcatttcagtgcctcatctgattataattcttacgaagatcaaggttatgttcttgatgaggatcaagattatgctcttgaagaagatgtaccattatttcttgatgaagatgtaccattattaccaagtgtcaagcttccaattgttgagaagctaccacgatccattacatgggtcttcaccaaaagtagccagctgatggctgaaagtgattctgtgattggtaagagacaaatctattatttgaatggtgaggcactagaattgagcagtgaagaagatgaggaagatgaagaagaagatgaggaagaaatcaagaaagaaaaatgcgaattttctgaagatgtagaccgatttatatggacggttgggcaggactatggtttggatgatctggtcgtgcggcgtgctctcgccaagtacctcgaagtggatgtttcggacatattggaaagatacaatgaactcaagcttaagaatgatggaactgctggtgaggcttctgatttgacatccaagacaataactactgctttccaggattttgctgatagacgtcattgccgtcgttgcatgatattcgattgtcatatgcatgagaagtatgagcccgagtctagatccagcgaagacaaatctagtttgtttgaggatgaagatagacaaccatgcagtgagcattgttacctcaaggtgaggagtgtgacagaagctgatcatgtgatggataatgataactctatatcaaacaagattgtggtctcagatccaaacaacactatgtggacgcctgtagagaaggatctttacttgaaaggaattgagatatttgggagaaacagttgtgatgttgcattaaacatacttcgggggcttaagacgtgcctagagatttacaattacatgcgcgaacaagatcaatgtactatgtcattagaccttaacaaaactacacaaagacacaatcaggttaccaaaaaagtatctcgaaaaagtagtaggtcggtccgcaaaaaatcgagactccgaaaatatgctcgttatccgcctgctttaaagaaaacaactagtggagaagctaagttttataagcactacacaccatgcacttgcaagtcaaaatgtggacagcaatgcccttgtttaactcacgaaaattgctgcgagaaatattgcgggtgctcaaaggattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctgctaatcgtgaatgcgatccagatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacaccagtgcaaatccaatgcaagaacatgcaattcctccttcaaaccaataaaaagattctcattggaaagtctgatgttcatggatggggtgcatttacatgggactctcttaaaaagaatgagtatctcggagaatatactggagaactgatcactcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatcagctcgaaatcgatgctcgccgtaaaggaaacgagttcaaatttctcaatcactcagcaagacctaactgctacgccaagttgatgattgtgagaggagatcagaggattggtctatttgcggagagagcaatcgaagaaggtgaggagcttttcttcgactactgctatggaccagaacatgcggattggtcgcgtggtcgagaacctagaaagactggtgcttctaaaaggtctaaggaagcccgtccagctcgttagtttttgatctgaggagaagcagcaattcaagcagtcctttttttatgttatggtatatcaattaataatgtaatgctattttgtgttactaaaccaaaacttaagtttctgttttatttgttttagggtgttttgtttgtatcatatgtgtcttaactttcaaagttttctttttgtatttcaatttaaaaacaatgtttatgttgtt
+5	At1g02580 - shortened for test - inserted cutpoint	gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctgctaatcgtgaatgcgatccagatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacaccagtgcaaatccaatgcaagaacatgcaataataaaaagattctcattggaaagtctgatgttcatggattcatggttttaattggggtgcatttacatgggactctcttaaaaagaatgagtatctcggagaatatactggagaactgatcactcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca

data/spec/genfrag/app/command_spec.rb

@@ -0,0 +1,55 @@
+
+require File.expand_path(
+    File.join(File.dirname(__FILE__), %w[.. .. spec_helper]))
+
+# --------------------------------------------------------------------------
+describe Genfrag::App::Command do
+
+  before :all do
+    @out = StringIO.new
+    @err = StringIO.new
+    #@input_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command')
+    #@output_dir = File.join(GENFRAG_SPEC_TMP_DIR, %w[index_command])
+    #FileUtils.mkdir(@output_dir) unless File.directory? @output_dir
+  end
+  
+  before :each do
+    @app = Genfrag::App::Command.new(@out, @err)
+    @app.ops = OpenStruct.new({:quiet => true})
+  end
+  
+  after :each do
+    @out.clear
+    @err.clear
+  end
+  
+  describe 'output' do
+    it 'should print in command-line mode and respect quiet' do
+      cli = true
+      @app.ops.quiet = false
+      @app.cli_p(cli, 'hello')
+      @out.readline.should match(%r/hello/)
+      @out.clear
+    
+      @app.ops.quiet = true
+      @app.cli_p(cli, 'hello')
+      @out.readline.should be_nil
+    end
+  
+    it "shouldn't print in library mode" do
+      cli = false
+      @app.ops.quiet = false
+      @app.cli_p(cli, 'hello')
+      @out.readline.should be_nil
+      @out.clear
+    
+      @app.ops.quiet = true
+      @app.cli_p(cli, 'hello')
+      @out.readline.should be_nil
+    end
+  end
+  
+  
+end
+
+# EOF

data/spec/genfrag/app/index_command_spec.rb

@@ -0,0 +1,258 @@
+
+require File.expand_path(
+    File.join(File.dirname(__FILE__), %w[.. .. spec_helper]))
+    
+# --------------------------------------------------------------------------
+describe Genfrag::App::IndexCommand do
+  
+  before :all do
+    @out = StringIO.new
+    @err = StringIO.new
+    @input_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command', 'in')
+    @frozen_output_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command', 'out')
+    @working_output_dir = File.join(GENFRAG_SPEC_TMP_DIR, %w[index_command])
+    FileUtils.mkdir_p(@working_output_dir) unless File.directory? @working_output_dir
+  end
+  
+  before :each do
+    @app = Genfrag::App::IndexCommand.new(@out, @err)
+  end
+  
+  after :each do
+    @out.clear
+    @err.clear
+  end
+  
+  describe 'when used from the command-line' do
+    it 'should provide a help command and exit' do
+      lambda {@app.cli_run %w[--help]}.should raise_error(SystemExit)
+      @out.readline.should match(%r/Usage: genfrag index \[options\]/)
+      @out.clear
+
+      lambda {@app.cli_run %w[--help]}.should raise_error(SystemExit)
+      @out.readline.should match(%r/Usage: genfrag index \[options\]/)
+    end
+    
+    it 'should default to the help message and exit if no command is given' do
+      lambda {@app.cli_run %w[]}.should raise_error(SystemExit)
+      @out.readline.should match(%r/Usage: genfrag index \[options\]/)
+    end
+    
+    it 'should stop on unrecognized options' do
+      lambda {@app.cli_run %w[--bad]}.should raise_error(OptionParser::InvalidOption)
+    end
+
+    it 'should recognize a fasta file passed as an argument' do
+      pending 'feature'
+    end
+        
+    it 'should recognize multiple fasta files passed as arguments' do
+      pending 'feature'
+    end
+    
+    it 'should stop on missing --fasta' do
+      lambda {@app.cli_run %w[-v --re5 BstYI --re3 BstYI]}.should raise_error(SystemExit)
+    end
+    
+    it 'should stop on missing --re5' do
+      lambda {@app.cli_run %w[-v --fasta a --re3 BstYI]}.should raise_error(SystemExit)
+    end
+    
+    it 'should stop on missing --re3' do
+      lambda {@app.cli_run %w[-v --fasta a --re5 BstYI]}.should raise_error(SystemExit)
+    end
+    
+    it "should stop when --re3 is passed something it can't recognize" do
+      lambda {@app.cli_run %w[-v --fasta a --re5 BstYI --re3 notanenzyme]}.should raise_error
+    end
+    
+    it "should stop when --re5 is passed something it can't recognize" do
+      lambda {@app.cli_run %w[-v --fasta a --re3 BstYI --re5 notanenzyme]}.should raise_error
+    end
+  end
+  
+  describe 'command-line option parser' do
+    it 'should stop on unrecognized options' do
+      lambda {@app.parse %w[--bad]}.should raise_error(OptionParser::InvalidOption)
+    end
+    
+    it 'should recognize verbose' do
+      @app.parse(%w[--verbose])
+      @app.parse(%w[-v])
+    end
+
+    it 'should recognize tracktime' do
+      @app.parse(%w[--tracktime])
+      @app.parse(%w[-m])
+    end
+    
+    it 'should recognize quiet' do
+      @app.parse(%w[--quiet])
+      @app.parse(%w[-q])
+    end
+    
+    it 'should recognize re5 with string' do
+      @app.parse(%w[--re5 a])
+      @app.parse(%w[-5 a])
+    end
+    
+    it 'should recognize re3 with string' do
+      @app.parse(%w[--re3 a])
+      @app.parse(%w[-3 a])
+    end
+    
+    it 'should recognize sqlite' do
+      @app.parse(%w[--sqlite])
+      @app.parse(%w[-t])
+    end
+    
+    it 'should recognize lookup with string' do
+      @app.parse(%w[--lookup a])
+      @app.parse(%w[-l a])
+    end
+    
+    it 'should recognize fasta with string' do
+      @app.parse(%w[--fasta a])
+      @app.parse(%w[-f a])
+    end
+    
+    it 'should recognize a combination of arguments' do
+      @app.parse(%w[-v --re5 a --re3 a])
+      @app.parse(%w[--verbose -5 a -3 a])
+    end
+  end
+  
+  describe 'with working example,' do
+    
+    after :all do
+      #FileUtils.rm Dir.glob(File.join(@working_output_dir,'*'))
+    end
+    
+    describe 'a.fasta' do
+      
+      before :each do
+        @fasta = 'a.fasta'        
+        @app = Genfrag::App::IndexCommand.new(@out, @err)
+        @app.ops.indir = @input_dir
+        @app.ops.outdir = @working_output_dir
+        @app.ops.filefasta = @fasta
+      end
+      
+    ############################################################
+      describe 'using re5 = BstYI and re3 = MseI' do
+        
+        before :each do
+          @app.ops.re5 = 'BstYI'
+          @app.ops.re3 = 'MseI'
+        end
+
+        describe 'without sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '1-a_lookup'
+            @app.ops.sqlite = false
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('1-a_lookup', '.tdf')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+
+        describe 'with sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '2-a_lookup'
+            @app.ops.sqlite = true
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('2-a_lookup', '.db')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+      end
+
+    ############################################################
+      describe 'using re5 = MseI and re3 = BstYI' do
+        
+        before :each do
+          @app.ops.re5 = 'MseI'
+          @app.ops.re3 = 'BstYI'
+        end
+
+        describe 'without sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '3-a_lookup'
+            @app.ops.sqlite = false
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('3-a_lookup', '.tdf')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+
+        describe 'with sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '4-a_lookup'
+            @app.ops.sqlite = true
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('4-a_lookup', '.db')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+      end
+
+    ############################################################
+      describe 'using re5 = TaqI and re3 = AluI' do
+
+        before :each do
+          @app.ops.re5 = 'TaqI'
+          @app.ops.re3 = 'AluI'
+        end
+
+        describe 'without sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '5-a_lookup'
+            @app.ops.sqlite = false
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('5-a_lookup', '.tdf')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+
+        describe 'with sqlite' do
+          it 'should execute' do
+            @app.ops.filelookup = '6-a_lookup'
+            @app.ops.sqlite = true
+            @app.run
+          end
+          it 'lookup should be the same' do
+            compare('6-a_lookup', '.db')
+          end
+          it 'fasta should be the same' do
+            compare(@fasta, '.tdf')
+          end
+        end
+      end
+      
+    end # a.fasta
+    
+  end # with working example
+  
+end
+
+# EOF

data/spec/genfrag/app/search_command/match_spec.rb

@@ -0,0 +1,77 @@
+
+require File.expand_path(
+    File.join(File.dirname(__FILE__), %w[.. .. .. spec_helper]))
+    
+# --------------------------------------------------------------------------
+describe Genfrag::App::SearchCommand do
+
+  before :all do
+    @out = StringIO.new
+    @err = StringIO.new
+    @input_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command', 'out')
+    @frozen_output_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'search_command', 'out')
+    @working_output_dir = File.join(GENFRAG_SPEC_TMP_DIR, %w[search_command])
+    FileUtils.mkdir_p(@working_output_dir) unless File.directory? @working_output_dir
+  end
+  
+  before :each do
+    @app = Genfrag::App::SearchCommand.new(@out, @err)
+  end
+  
+  after :each do
+    @out.clear
+    @err.clear
+  end
+  
+  describe 'test matches_adapter' do
+    it 'test' do
+      pending 'tbd'
+    end
+  end
+  
+  describe 'test find_matching_fragments' do
+    it 'test' do
+      pending 'tbd'
+    end
+  end
+  
+  describe 'test right_tail_of' do
+    it 'finds this right-most fragment preceding cut' do
+    # PpiI
+      p = 'n n n n n n^n n n n n n n g a a c n n n n n c t c n n n n n n n n n n n n n^n'
+      @app.right_tail_of(p).should == 'n'
+    end
+    
+    it 'finds this right-most fragment preceding cut' do
+    # BstYI
+      p = 'r^g a t c y'
+      @app.right_tail_of(p).should == 'gatcy'
+    end
+    
+    it "raises an error when there isn't a cut symbol" do
+      p = 'r g a t c y'
+      lambda {@app.right_tail_of(p)}.should raise_error
+    end
+  end
+  
+  describe 'test left_tail_of' do
+    it 'finds this left-most fragment preceding cut' do
+    # PpiI
+      p = 'n n n n n n^n n n n n n n g a a c n n n n n c t c n n n n n n n n n n n n n^n'
+      @app.left_tail_of(p).should == 'nnnnnn'
+    end
+    
+    it 'finds this left-most fragment preceding cut' do
+    # BstYI
+      p = 'r^g a t c y'
+      @app.left_tail_of(p).should == 'r'
+    end
+    
+    it "raises an error when there isn't a cut symbol" do
+      p = 'r g a t c y'
+      lambda {@app.left_tail_of(p)}.should raise_error
+    end
+  end
+end
+
+# EOF

data/spec/genfrag/app/search_command/process_file_spec.rb

@@ -0,0 +1,185 @@
+
+require File.expand_path(
+    File.join(File.dirname(__FILE__), %w[.. .. .. spec_helper]))
+    
+# --------------------------------------------------------------------------
+describe Genfrag::App::SearchCommand::ProcessFile do
+
+  before :all do
+    @out = StringIO.new
+    @err = StringIO.new
+    @input_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'index_command', 'out')
+    @frozen_output_dir = File.join(GENFRAG_SPEC_DATA_DIR, 'search_command', 'out')
+    @working_output_dir = File.join(GENFRAG_SPEC_TMP_DIR, %w[search_command])
+    FileUtils.mkdir_p(@working_output_dir) unless File.directory? @working_output_dir
+  end
+  
+  before :each do
+    @app = Genfrag::App::IndexCommand.new(@out, @err)
+  end
+  
+  after :each do
+    @out.clear
+    @err.clear
+  end
+  
+  describe 'test process_tdf_fasta_file' do
+    
+    describe 'with a.fasta.tdf' do
+      before :all do
+        d = IO.readlines File.join(@input_dir, 'a.fasta.tdf')
+        @res = Genfrag::App::SearchCommand::ProcessFile.process_tdf_fasta_file d
+      end
+    
+      it 'should have five elements' do
+        @res.size.should == 5
+      end
+    
+      it 'element 5 definitions' do
+        @res[5][:definitions].should == ["At1g02580 - shortened for test - inserted cutpoint"]
+      end
+    
+      it 'element 4 definitions' do
+        @res[4][:definitions].sort.should == ["At1g02580 mRNA (2291 bp) UTR's and CDS", "At1g02580 mRNA (2291 bp) UTR's and CDS (duplicate)"].sort
+      end
+    
+      it 'element 5 sequence' do
+        @res[5][:sequence].should == 'gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctgctaatcgtgaatgcgatccagatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacaccagtgcaaatccaatgcaagaacatgcaataataaaaagattctcattggaaagtctgatgttcatggattcatggttttaattggggtgcatttacatgggactctcttaaaaagaatgagtatctcggagaatatactggagaactgatcactcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca'
+      end
+    end
+    
+    describe 'with an array of data' do
+      before :all do
+        ary = [ %w(id Definitions Sequence),
+                [1,'DescA,DescB','seq-abc'],
+                [2,'DescC','seq-def'],
+                [3,'DescD,DescE,DescF','seq-ghi'] ]
+        d = ary.map {|x| x.join("\t")}
+        @res = Genfrag::App::SearchCommand::ProcessFile.process_tdf_fasta_file d
+      end
+    
+      it 'should have three elements' do
+        @res.size.should == 3
+      end
+    
+      it 'element 1 definitions' do
+        @res[1][:definitions].sort.should == ['DescA', 'DescB'].sort
+      end
+    
+      it 'element 2 definitions' do
+        @res[2][:definitions].sort.should == ['DescC'].sort
+      end
+    
+      it 'element 3 sequence' do
+        @res[3][:sequence].should == 'seq-ghi'
+      end
+    end
+  end
+  
+  
+  describe 'test process_db_fasta_file' do
+  
+    describe 'with a.fasta.db' do
+      before :all do
+        d = SQLite3::Database.new( File.join(@input_dir, 'a.fasta.db') )
+        @res = Genfrag::App::SearchCommand::ProcessFile.process_db_fasta_file d
+      end
+    
+      it 'should have five elements' do
+        @res.size.should == 5
+      end
+    
+      it 'element 5 definitions' do
+        @res[5][:definitions].should == ["At1g02580 - shortened for test - inserted cutpoint"]
+      end
+    
+      it 'element 4 definitions' do
+        @res[4][:definitions].sort.should == ["At1g02580 mRNA (2291 bp) UTR's and CDS", "At1g02580 mRNA (2291 bp) UTR's and CDS (duplicate)"].sort
+      end
+    
+      it 'element 5 sequence' do
+        @res[5][:sequence].should == 'gattgcaacaatcgctttggaggatgtaattgtgcaattggccaatgcacaaatcgacaatgtccttgttttgctgctaatcgtgaatgcgatccagatctttgtcggagttgtcctcttagctgtggagatggcactcttggtgagacaccagtgcaaatccaatgcaagaacatgcaataataaaaagattctcattggaaagtctgatgttcatggattcatggttttaattggggtgcatttacatgggactctcttaaaaagaatgagtatctcggagaatatactggagaactgatcactcatgatgaagctaatgagcgtgggagaatagaagatcggattggttcttcctacctctttaccttgaatgatca'
+      end
+    end
+    
+  end
+  
+  
+  describe 'test process_tdf_freq_lookup' do
+    describe 'with 1-a_lookup.tdf' do
+      before :all do
+        d = IO.readlines File.join(@input_dir, '1-a_lookup.tdf')
+        @res = Genfrag::App::SearchCommand::ProcessFile.process_tdf_freq_lookup d
+      end
+    
+    # { 193=>[{:offset=>457, :raw_size=>193, :fasta_id=>1}], 
+    #   138=>[{:offset=>95, :raw_size=>138, :fasta_id=>5}], 
+    #   168=>[{:offset=>1539, :raw_size=>168, :fasta_id=>4}]}
+    
+      it 'should have three elements' do
+        @res.size.should == 3        
+      end
+      
+      it 'elements should have an array of hashes with three keys' do
+        @res.each do |k,ary|
+          ary.each do |hsh|
+            hsh.keys.size.should == 3
+          end
+        end
+      end
+      
+      it 'elements key should match :raw_size' do
+        @res.each do |k,ary|
+          ary.each do |hsh|
+            k.should == hsh[:raw_size]
+          end
+        end
+      end
+
+    end
+  end
+  
+  describe 'test process_db_freq_lookup' do
+    describe 'with 2-a_lookup.db' do
+      before :all do
+        d = SQLite3::Database.new( File.join(@input_dir, '2-a_lookup.db') )
+        @res = Genfrag::App::SearchCommand::ProcessFile.process_db_freq_lookup d
+      end
+    
+    # { 193=>[{:offset=>457, :raw_size=>193, :fasta_id=>1}], 
+    #   138=>[{:offset=>95, :raw_size=>138, :fasta_id=>5}], 
+    #   168=>[{:offset=>1539, :raw_size=>168, :fasta_id=>4}]}
+    
+      it 'should have three elements' do
+        @res.size.should == 3        
+      end
+      
+      it 'elements should have an array of hashes with three keys' do
+        @res.each do |k,ary|
+          ary.each do |hsh|
+            hsh.keys.size.should == 3
+          end
+        end
+      end
+      
+      it 'elements key should match :raw_size' do
+        @res.each do |k,ary|
+          ary.each do |hsh|
+            k.should == hsh[:raw_size]
+          end
+        end
+      end
+
+    end
+  end
+  
+  describe 'test process_tdf_adapters' do
+    it 'test' do
+      pending 'tbd'
+    end
+  end
+  
+  
+end
+
+# EOF