chrislo-sourceclassifier 0.2.0 → 0.2.1

data/sources/gcc/fasta.gcc-2.gcc

@@ -1,132 +0,0 @@
-/* The Computer Language Shootout
- * http://shootout.alioth.debian.org/
- * contributed by Joern Inge Vestgaarden
- * Compile with gcc -O3 -fomit-frame-pointer -march=pentium4 -mfpmath=sse -msse2 -o fasta fasta.c
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-
-#define MIN(a,b) ((a) <= (b) ? (a) : (b))
-#define LINE_LEN 60
-
-#define IM 139968
-#define IA   3877
-#define IC  29573
-int global_last = 42;
-#define gen_random(max) (max*((global_last = (global_last * IA + IC) % IM) / ((float)(IM))))
-
-struct aminoacids {
-  float p;
-  char c;
-};
-
-void make_cumulative (struct aminoacids * genelist, int count) {
-    float cp = 0.0;
-    int i;
-    for (i=0; i < count; i++) {
-        cp += genelist[i].p;
-        genelist[i].p = cp;
-    }
-}
-
-void repeat_fasta (const char *s, int n) {
-  int len = strlen(s);
-  int pos = 0;
-  while (n > 0) {
-    const int line = MIN(LINE_LEN, n);
-    const int left = len-pos; 
-    n -= line;
-    if (left >= line) {     /* Line not broken */
-      fwrite(s+pos,1,line,stdout);
-      putc('\n', stdout);
-      pos += line;
-    } else {                /* Line broken */
-      fwrite(s+pos,1,left,stdout);
-      pos = 0;
-      fwrite(s,1,line-left,stdout);
-      pos += line - left;
-      putc('\n', stdout);
-    }
-  }    
-}
-
-void random_fasta (struct aminoacids * genelist, int n) {
-  char buf[LINE_LEN+1];
-  char *s = NULL;
-  struct aminoacids *a = genelist;
-  float r;
-  while (n > 0) {
-    const int line = MIN(LINE_LEN, n);
-    const char *end = (char *)buf + line;
-    n -= line;
-    s = buf;
-    while (s < end) {
-      r = gen_random(1.0);
-      a = genelist;
-      while (*((float *)a) < r) ++a; /* Linear search */
-      *s++ = a->c;
-    }
-    *s = '\n';
-    fwrite(buf, 1, line+1, stdout);
-  }
-}
-
-
-/* Main -- define alphabets, make 3 fragments */
-
-static struct aminoacids iub[] = {
-    { 0.27, 'a' },
-    { 0.12, 'c' },
-    { 0.12, 'g' },
-    { 0.27, 't' },
-    { 0.02, 'B' },
-    { 0.02, 'D' },
-    { 0.02, 'H' },
-    { 0.02, 'K' },
-    { 0.02, 'M' },
-    { 0.02, 'N' },
-    { 0.02, 'R' },
-    { 0.02, 'S' },
-    { 0.02, 'V' },
-    { 0.02, 'W' },
-    { 0.02, 'Y' }
-};
-
-#define IUB_LEN (sizeof (iub) / sizeof (struct aminoacids))
-
-static struct aminoacids homosapiens[] = {
-    { 0.3029549426680, 'a' },
-    { 0.1979883004921, 'c' },
-    { 0.1975473066391, 'g' },
-    { 0.3015094502008, 't' },
-};
-
-#define HOMOSAPIENS_LEN (sizeof (homosapiens) / sizeof (struct aminoacids))
-
-static char * alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" \
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" \
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" \
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" \
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" \
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" \
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
-
-int main (int argc, char * argv[]) {
-    int n = 1000;
-    if (argc > 1) sscanf (argv[1], "%d", &n);
-    make_cumulative (iub, IUB_LEN);
-    make_cumulative (homosapiens, HOMOSAPIENS_LEN);
-
-    printf (">ONE Homo sapiens alu\n");
-    repeat_fasta ( alu, n*2);
-    printf (">TWO IUB ambiguity codes\n");    
-    random_fasta ( iub,   n*3);
-    printf (">THREE Homo sapiens frequency\n");
-    random_fasta ( homosapiens,  n*5);
-
-    return 0;
-}
-

data/sources/gcc/fasta.gcc-3.gcc

@@ -1,145 +0,0 @@
-/* The Computer Language Benchmarks Game
- * http://shootout.alioth.debian.org/
- * Contributed by Joern Inge Vestgaarden
- * Modified by Jorge Peixoto de Morais Neto
- * Modified by Ryan Flynn
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <err.h>
-
-#define WIDTH 60
-#define MIN(a,b) ((a) <= (b) ? (a) : (b))
-#define NELEMENTS(x) (sizeof (x) / sizeof ((x)[0]))
-
-typedef struct {
-    float p;
-    char c;
-} aminoacid_t;
-
-static inline float myrandom (float max) {
-    unsigned long const IM = 139968;
-    unsigned long const IA = 3877;
-    unsigned long const IC = 29573;
-    static unsigned long last = 42;
-    last = (last * IA + IC) % IM;
-    /*Integer to float conversions are faster if the integer is signed*/
-    return max * (long) last / IM;
-}
-
-static inline void accumulate_probabilities (aminoacid_t *genelist, size_t len) {
-    float cp = 0.0;
-    size_t i;
-    for (i = 0; i < len; i++) {
-        cp += genelist[i].p;
-        genelist[i].p = cp;
-    }
-}
-
-/* This function prints the characters of the string s. When it */
-/* reaches the end of the string, it goes back to the beginning */
-/* It stops when the total number of characters printed is count. */
-/* Between each WIDTH consecutive characters it prints a newline */
-/* This function assumes that WIDTH <= strlen (s) + 1 */
-static void repeat_fasta (char const *s, size_t count) {
-    size_t pos = 0;
-    size_t len = strlen (s);
-    char *s2 = malloc (len + WIDTH);
-    memcpy (s2, s, len);
-    memcpy (s2 + len, s, WIDTH);
-    do {
-     	size_t line = MIN(WIDTH, count);
-     	fwrite_unlocked (s2 + pos,1,line,stdout);
-     	putchar_unlocked ('\n');
-     	pos += line;
-     	if (pos >= len) pos -= len;
-     	count -= line;
-    } while (count);
-    free (s2);
-}
-
-/* This function takes a pointer to the first element of an array */
-/* Each element of the array is a struct with a character and */
-/* a float number p between 0 and 1. */
-/* The function generates a random float number r and */
-/* finds the first array element such that p >= r. */
-/* This is a weighted random selection. */
-/* The function then prints the character of the array element. */
-/* This is done count times. */
-/* Between each WIDTH consecutive characters, the function prints a newline */
-static void random_fasta (aminoacid_t const *genelist, size_t count) {
-    do {
-	size_t line = MIN(WIDTH, count);
-	size_t pos = 0;
-	char buf[WIDTH + 1];
-	do {
-	    float r = myrandom (1.0);
-	    size_t i = 0;
-	    while (genelist[i].p < r)
-		++i; /* Linear search */
-	    buf[pos++] = genelist[i].c;
-	} while (pos < line);
-	buf[line] = '\n';
-	fwrite_unlocked (buf, 1, line + 1, stdout);
-	count -= line;
-    } while (count);
-}
-
-int main (int argc, char **argv) {
-    static char OutBuf[128 * 1024];
-    size_t n;
-    if (argc > 1) {
-	char const *arg = argv[1];
- 	char *tail;
- 	n = strtoul (arg, &tail, 0);
- 	if (tail == arg)
-	    errx (1, "Could not convert \"%s\" to an unsigned long integer", arg);
-    } else n = 1000;
-
-    static aminoacid_t iub[] = {
-	{ 0.27, 'a' },
-	{ 0.12, 'c' },
-	{ 0.12, 'g' },
-	{ 0.27, 't' },
-	{ 0.02, 'B' },
-	{ 0.02, 'D' },
-	{ 0.02, 'H' },
-	{ 0.02, 'K' },
-	{ 0.02, 'M' },
-	{ 0.02, 'N' },
-	{ 0.02, 'R' },
-	{ 0.02, 'S' },
-	{ 0.02, 'V' },
-	{ 0.02, 'W' },
-	{ 0.02, 'Y' }};
-
-    static aminoacid_t homosapiens[] = {
-	{ 0.3029549426680, 'a' },
-	{ 0.1979883004921, 'c' },
-	{ 0.1975473066391, 'g' },
-	{ 0.3015094502008, 't' }};
-
-    accumulate_probabilities (iub, NELEMENTS(iub));
-    accumulate_probabilities (homosapiens, NELEMENTS(homosapiens));
-
-    static char const *const alu ="\
-GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
-GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
-CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
-ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
-GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
-AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
-AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
-
-    setvbuf(stdout, OutBuf, _IOFBF, sizeof OutBuf); /* buffer output */
-    fputs_unlocked (">ONE Homo sapiens alu\n", stdout);
-    repeat_fasta (alu, 2 * n);
-    fputs_unlocked (">TWO IUB ambiguity codes\n", stdout);
-    random_fasta (iub, 3 * n);
-    fputs_unlocked (">THREE Homo sapiens frequency\n", stdout);
-    random_fasta (homosapiens, 5 * n);
-    return 0;
-}
-

data/sources/gcc/fasta.gcc-4.gcc

@@ -1,141 +0,0 @@
-/* The Computer Language Benchmarks Game
- * http://shootout.alioth.debian.org/
- * Contributed by Joern Inge Vestgaarden
- * Modified by Jorge Peixoto de Morais Neto
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <err.h>
-
-#define WIDTH 60
-#define MIN(a,b) ((a) <= (b) ? (a) : (b))
-#define NELEMENTS(x) (sizeof (x) / sizeof ((x)[0]))
-
-typedef struct {
-    float p;
-    char c;
-} aminoacid_t;
-
-static inline float myrandom (float max) { 
-    unsigned long const IM = 139968;
-    unsigned long const IA = 3877;
-    unsigned long const IC = 29573;
-    static unsigned long last = 42; 
-    last = (last * IA + IC) % IM; 
-    /*Integer to float conversions are faster if the integer is signed*/
-    return max * (long) last / IM; 
-} 
-
-static inline void accumulate_probabilities (aminoacid_t *genelist, size_t len) {
-    float cp = 0.0;
-    size_t i;
-    for (i = 0; i < len; i++) {
-        cp += genelist[i].p;
-        genelist[i].p = cp;
-    }
-}
-
-/* This function prints the characters of the string s. When it */
-/* reaches the end of the string, it goes back to the beginning */
-/* It stops when the total number of characters printed is count. */
-/* Between each WIDTH consecutive characters it prints a newline */
-/* This function assumes that WIDTH <= strlen (s) + 1 */
-static void repeat_fasta (char const *s, size_t count) {
-    size_t pos = 0;  
-    size_t len = strlen (s); 
-    char *s2 = malloc (len + WIDTH);
-    memcpy (s2, s, len); 
-    memcpy (s2 + len, s, WIDTH); 
-    do {   
-     	size_t line = MIN(WIDTH, count); 
-     	fwrite_unlocked (s2 + pos,1,line,stdout); 
-     	putchar_unlocked ('\n'); 
-     	pos += line; 
-     	if (pos >= len) pos -= len; 
-     	count -= line;  
-    } while (count); 
-    free (s2); 
-}
-
-/* This function takes a pointer to the first element of an array */
-/* Each element of the array is a struct with a character and */
-/* a float number p between 0 and 1. */
-/* The function generates a random float number r and */
-/* finds the first array element such that p >= r. */
-/* This is a weighted random selection. */
-/* The function then prints the character of the array element. */
-/* This is done count times. */
-/* Between each WIDTH consecutive characters, the function prints a newline */
-static void random_fasta (aminoacid_t const *genelist, size_t count) {
-    do {    
-	size_t line = MIN(WIDTH, count);    
-	size_t pos = 0;    
-	char buf[WIDTH + 1];    
-	do {    
-	    float r = myrandom (1.0);
-	    size_t i = 0;   
-	    while (genelist[i].p < r)    
-		++i; /* Linear search */    
-	    buf[pos++] = genelist[i].c;    
-	} while (pos < line);   
-	buf[line] = '\n';
-	fwrite_unlocked (buf, 1, line + 1, stdout);    
-	count -= line;    
-    } while (count);   
-}
-
-int main (int argc, char **argv) {
-    size_t n;
-    if (argc > 1) { 
-	char const *arg = argv[1];
- 	char *tail; 
- 	n = strtoul (arg, &tail, 0); 
- 	if (tail == arg)  
-	    errx (1, "Could not convert \"%s\" to an unsigned long integer", arg); 
-    } else n = 1000;
-
-    static aminoacid_t iub[] = {
-	{ 0.27, 'a' },
-	{ 0.12, 'c' },
-	{ 0.12, 'g' },
-	{ 0.27, 't' },
-	{ 0.02, 'B' },
-	{ 0.02, 'D' },
-	{ 0.02, 'H' },
-	{ 0.02, 'K' },
-	{ 0.02, 'M' },
-	{ 0.02, 'N' },
-	{ 0.02, 'R' },
-	{ 0.02, 'S' },
-	{ 0.02, 'V' },
-	{ 0.02, 'W' },
-	{ 0.02, 'Y' }};
-
-    static aminoacid_t homosapiens[] = {
-	{ 0.3029549426680, 'a' },
-	{ 0.1979883004921, 'c' },
-	{ 0.1975473066391, 'g' },
-	{ 0.3015094502008, 't' }};
-
-    accumulate_probabilities (iub, NELEMENTS(iub)); 
-    accumulate_probabilities (homosapiens, NELEMENTS(homosapiens));
-
-    static char const *const alu ="\
-GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
-GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
-CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
-ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
-GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
-AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
-AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
-
-    fputs_unlocked (">ONE Homo sapiens alu\n", stdout);
-    repeat_fasta (alu, 2 * n);
-    fputs_unlocked (">TWO IUB ambiguity codes\n", stdout);
-    random_fasta (iub, 3 * n);
-    fputs_unlocked (">THREE Homo sapiens frequency\n", stdout);
-    random_fasta (homosapiens, 5 * n);
-    return 0;
-}

data/sources/gcc/fibo.gcc

@@ -1,20 +0,0 @@
-/* -*- mode: c -*-
- * $Id: fibo.gcc,v 1.6 2005-04-25 19:01:38 igouy-guest Exp $
- * http://shootout.alioth.debian.org/
- * Revised with register allocation by David Bronaugh
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-
-static unsigned long
-fib(unsigned long n) {
-    return( (n < 2) ? 1 : (fib(n-2) + fib(n-1)) );
-}
-
-int
-main(int argc, char *argv[]) {
-    int N = ((argc == 2) ? atoi(argv[1]) : 1);
-    printf("%ld\n", fib(N));
-    return(0);
-}

data/sources/gcc/harmonic.gcc

@@ -1,22 +0,0 @@
-/* The Great Computer Language Shootout
-   http://shootout.alioth.debian.org/
-
-   contributed by Greg Buchholz 
-   Optimized by Paul Hsieh
-   compile:  gcc -O2 -o harmonic harmonic.c
-*/
-#include<stdio.h>
-#include<stdlib.h>
-
-int main (int argc, char **argv)
-{
-    double i=1, sum=0;
-    int n;
-
-    for(n = atoi(argv[1]); n > 0; n--, i++)
-        sum += 1/i;
-
-    printf("%.9f\n", sum);
-    return 0;
-}
-