chrislo-sourceclassifier 0.2.0 → 0.2.1

data/sources/perl/fannkuch.perl

@@ -1,44 +0,0 @@
-# The Computer Language Benchmarks Game
-# http://shootout.alioth.debian.org/
-# Initial port from C by Steve Clark
-# Rewrite by Kalev Soikonen
-# Modified by Kuang-che Wu
-
-use integer;
-
-sub fannkuch {
-    my ($n) = shift;
-    my ($iter, $flips, $maxflips, $i);
-    my (@q, @p, @count);
-
-    $iter = $maxflips = 0;
-    @p = @count = (1..$n);
-    $m = $n - 1;
-
-    TRY: while (1) {
-	if ($iter < 30) {
-	    print @p, "\n";
-	    $iter++;
-	}
-
-	if ($p[0] != 1 && $p[$m] != $n) {
-	    @q = @p;
-	    for ($flips=0; $q[0] != 1; $flips++) {
-		unshift @q, reverse splice @q, 0, $q[0];
-	    }
-	    $maxflips = $flips if ($flips > $maxflips);
-	}
-
-	for my$i(1..$m) {
-	    splice @p, $i, 0, shift @p;
-	    next TRY if (--$count[$i]);
-	    $count[$i] = $i + 1;
-	}
-	return $maxflips;
-    }
-}
-
-for (shift || 7) {
-    print "Pfannkuchen($_) = ".fannkuch($_)."\n";
-}
-

data/sources/perl/fannkuch.perl-2.perl

@@ -1,38 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Initial port from C by Steve Clark
-# Rewrite by Kalev Soikonen
-
-sub fannkuch {
-    my ($n) = shift;
-    my ($iter, $flips, $maxflips, $i);
-    my (@q, @p, @count);
-
-    $iter = $maxflips = 0;
-    @p = @count = (1..$n);
-
-    TRY: while (1) {
-	print @p, "\n" if ($iter++ < 30);
-
-#	splice @count, 0, $i, (1..$i);
-
-	$flips = 0;
-	for (@q = @p; $q[0] != 1; ) {
-	    unshift @q, reverse splice @q, 0, $q[0];
-	    $flips++;
-	}
-	$maxflips = $flips if ($flips > $maxflips);
-
-	for ($i = 1; $i < $n; $i++) {
-	    splice @p, $i, 0, shift @p;
-	    next TRY if (--$count[$i]);
-	    $count[$i] = $i + 1;
-	}
-	return $maxflips;
-    }
-}
-
-for (shift || 7) {
-    print "Pfannkuchen($_) = ".fannkuch($_)."\n";
-}
-

data/sources/perl/fasta.perl

@@ -1,112 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by David Pyke
-# tweaked by Danny Sauer
-# Butchered by Jesse Millikan
-
-use constant IM => 139968;
-use constant IA => 3877;
-use constant IC => 29573;
-
-use constant LINELENGTH => 60;
-
-my $LAST = 42;
-
-sub makeCumulative {
-    my($genelist) = @_;
-    my $cp = 0.0;
-
-    foreach (@$genelist){
-        $_->[1] = $cp += $_->[1];
-    }
-}
-
-sub makeRandomFasta {
-    my($id,$desc,$n,$genelist) = @_;
-
-    print ">$id $desc\n";
-    my $pick, $r;
-
-	while($n > 0){
-		$pick='';
-
-		# Get LINELENGTH chars or what's left of $n
-        CHAR: foreach (1 .. ($n > LINELENGTH ? LINELENGTH : $n)){
-    		$rand = ($LAST = ($LAST * IA + IC) % IM) / IM;
-
-			# Select gene and append it
-    		foreach (@$genelist){
-				if($rand < $_->[1]){
-					$pick .= $_->[0];
-					next CHAR;
-				}
-    		}
-        }
-
-        print "$pick\n";
-		$n -= LINELENGTH;
-    }
-}
-
-# Print $n characters of $s (repeated if nessary) with newlines every LINELENGTH
-sub makeRepeatFasta {
-    my($id,$desc,$s,$n) = @_;
-
-    print ">$id $desc\n";
-
-	my $ss;
-	while($n > 0){
-		# Overfill $ss with $s
-		$ss .= $s while length $ss < LINELENGTH;
-		# Print LINELENGTH chars or whatever's left of $n
-        print substr($ss,0,$n > LINELENGTH ? LINELENGTH : $n,""), "\n";
-		$n -= LINELENGTH;
-	}
-}
-
-my $iub = [
-    [a, 0.27],
-    [c, 0.12],
-    [g, 0.12],
-    [t, 0.27],
-    [B, 0.02],
-    [D, 0.02],
-    [H, 0.02],
-    [K, 0.02],
-    [M, 0.02],
-    [N, 0.02],
-    [R, 0.02],
-    [S, 0.02],
-    [V, 0.02],
-    [W, 0.02],
-    [Y, 0.02]
-];
-
-my $homosapiens = [
-    [a, 0.3029549426680],
-    [c, 0.1979883004921],
-    [g, 0.1975473066391],
-    [t, 0.3015094502008]
-];
-
-$alu =
-    'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
-    'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
-    'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
-    'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
-    'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
-    'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
-    'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
-
-#main
-
-my $n = ($ARGV[0] || 1000) ;
-
-makeCumulative $iub;
-makeCumulative $homosapiens;
-
-makeRepeatFasta ('ONE', 'Homo sapiens alu', $alu, $n*2);
-makeRandomFasta ('TWO', 'IUB ambiguity codes', $n*3, $iub);
-makeRandomFasta ('THREE', 'Homo sapiens frequency', $n*5, $homosapiens);
-

data/sources/perl/fasta.perl-2.perl

@@ -1,135 +0,0 @@
-#!/usr/bin/perl
-
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by David Pyke
-# tweaked by Danny Sauer
-
-use constant IM => 139968;
-use constant IA => 3877;
-use constant IC => 29573;
-
-use constant LINELENGTH => 60;
-
-my $LAST = 42;
-sub gen_random ($) {
-    return ( ($_[0] * ($LAST = ($LAST * IA + IC) % IM)) / IM );
-}
-
-sub makeCumulative($){
-    my($genelist) = @_;
-    $cp = 0.0;
-
-    foreach (@$genelist){
-        $_->[1] = $cp += $_->[1];
-    }
-}
-
-sub selectRandom($){
-    my($genelist) = @_;
-    $r = gen_random (1);
-
-    foreach (@$genelist){
-        if ($r < $_->[1]){ return $_->[0]; }
-    }
-}
-
-
-sub makeRandomFasta($$$$){
-#void makeRandomFasta (const char * id, const char * desc, const struct aminoacids * genelist, int count, int n) {
-    my($id,$desc,$n,$genelist) = @_;
-
-    print ">$id $desc\n";
-    $pick='';
-
-    # print whole lines
-    foreach (1 .. int($n / LINELENGTH) ){
-        foreach (1 ..  LINELENGTH ){
-            $pick .= selectRandom($genelist);
-        }
-        print "$pick\n";
-        $pick = '';
-    }
-    #print remaining line (if required)
-    if ($n % LINELENGTH){
-        foreach (1 ..  $n % LINELENGTH ){
-            $pick .= selectRandom($genelist);
-        }
-        print "$pick\n";
-    }
-}
-
-sub makeRepeatFasta($$$$){
-#void makeRepeatFasta (const char * id, const char * desc, const char * s, int n) {
-    # we want to print $n characters of $s (repeated if nessary) with newlines every LINELENGTH
-    my($id,$desc,$s,$n) = @_;
-
-    print ">$id $desc\n";
-
-    # what we need, and the extra (if any) will be discarded.
-    foreach (1 .. int($n / LINELENGTH) ){
-        while (length $ss < LINELENGTH){
-            $ss .= $s;
-        }
-        print substr($ss,0,LINELENGTH), "\n";
-        $ss = substr($ss,LINELENGTH);
-    }
-    #final_line
-    while (length $ss < LINELENGTH){
-        $ss .= $s;
-    }
-    print substr($ss, 0, ($n % LINELENGTH)), "\n";
-print STDERR "\n";
-}
-
-
-my $iub = [
-    [ 'a', 0.27 ],
-    [ 'c', 0.12 ],
-    [ 'g', 0.12 ],
-    [ 't', 0.27 ],
-    [ 'B', 0.02 ],
-    [ 'D', 0.02 ],
-    [ 'H', 0.02 ],
-    [ 'K', 0.02 ],
-    [ 'M', 0.02 ],
-    [ 'N', 0.02 ],
-    [ 'R', 0.02 ],
-    [ 'S', 0.02 ],
-    [ 'V', 0.02 ],
-    [ 'W', 0.02 ],
-    [ 'Y', 0.02 ]
-];
-
-my $homosapiens = [
-    [ 'a', 0.3029549426680 ],
-    [ 'c', 0.1979883004921 ],
-    [ 'g', 0.1975473066391 ],
-    [ 't', 0.3015094502008 ]
-];
-
-$alu =
-    'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
-    'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
-    'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
-    'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
-    'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
-    'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
-    'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
-
-######################################################################
-#main
-
-my $n = ($ARGV[0] || 1000) ;
-
-makeCumulative $iub;
-makeCumulative $homosapiens;
-
-makeRepeatFasta ('ONE', 'Homo sapiens alu', $alu, $n*2);
-makeRandomFasta ('TWO', 'IUB ambiguity codes', $n*3, $iub);
-makeRandomFasta ('THREE', 'Homo sapiens frequency', $n*5, $homosapiens);
-
-exit 0;
-
-#END OF FILE

data/sources/perl/fasta.perl-4.perl

@@ -1,122 +0,0 @@
-# The Computer Language Benchmarks game
-# http://shootout.alioth.debian.org/
-#
-# contributed by David Pyke
-# tweaked by Danny Sauer
-# optimized by Steffen Mueller
-# tweaked by Kuang-che Wu
-
-use strict;
-use warnings;
-use constant IM => 139968;
-use constant IA => 3877;
-use constant IC => 29573;
-
-use constant LINELENGTH => 60;
-
-my $LAST = 42;
-sub gen_random {
-    return map {( ($_[0] * ($LAST = ($LAST * IA + IC) % IM)) / IM )} 1..($_[1]||1);
-}
-
-sub makeCumulative {
-    my $genelist = shift;
-    my $cp = 0.0;
-
-    $_->[1] = $cp += $_->[1] foreach @$genelist;
-}
-
-sub selectRandom {
-    my $genelist = shift;
-    my $number = shift || 1;
-    my @r = gen_random(1, $number);
-
-    my $s;
-    foreach my $r (@r) {
-        foreach (@$genelist){
-            if ($r < $_->[1]) { $s .= $_->[0]; last; }
-        }
-    }
-
-    return $s;
-}
-
-
-sub makeRandomFasta {
-    my ($id, $desc, $n, $genelist) = @_;
-
-    print ">", $id, " ", $desc, "\n";
-
-    # print whole lines
-    foreach (1 .. int($n / LINELENGTH) ){
-        print selectRandom($genelist, LINELENGTH), "\n";
-    }
-    # print remaining line (if required)
-    if ($n % LINELENGTH){
-        print selectRandom($genelist, $n % LINELENGTH), "\n";
-    }
-}
-
-sub makeRepeatFasta {
-    my ($id, $desc, $s, $n) = @_;
-
-    print ">", $id, " ", $desc, "\n";
-
-    my $r = length $s;
-    my $ss = $s . $s . substr($s, 0, $n % $r);
-    for my $j(0..int($n / LINELENGTH)-1) {
-	my $i = $j*LINELENGTH % $r;
-	print substr($ss, $i, LINELENGTH), "\n";
-    }
-    if ($n % LINELENGTH) {
-	print substr($ss, -($n % LINELENGTH)), "\n";
-    }
-}
-
-
-my $iub = [
-    [ 'a', 0.27 ],
-    [ 'c', 0.12 ],
-    [ 'g', 0.12 ],
-    [ 't', 0.27 ],
-    [ 'B', 0.02 ],
-    [ 'D', 0.02 ],
-    [ 'H', 0.02 ],
-    [ 'K', 0.02 ],
-    [ 'M', 0.02 ],
-    [ 'N', 0.02 ],
-    [ 'R', 0.02 ],
-    [ 'S', 0.02 ],
-    [ 'V', 0.02 ],
-    [ 'W', 0.02 ],
-    [ 'Y', 0.02 ]
-];
-
-my $homosapiens = [
-    [ 'a', 0.3029549426680 ],
-    [ 'c', 0.1979883004921 ],
-    [ 'g', 0.1975473066391 ],
-    [ 't', 0.3015094502008 ]
-];
-
-my $alu =
-    'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
-    'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
-    'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
-    'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
-    'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
-    'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
-    'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
-
-######################################################################
-#main
-
-my $n = ($ARGV[0] || 1000) ;
-
-makeCumulative($iub);
-makeCumulative($homosapiens);
-
-makeRepeatFasta ('ONE', 'Homo sapiens alu', $alu, $n*2);
-makeRandomFasta ('TWO', 'IUB ambiguity codes', $n*3, $iub);
-makeRandomFasta ('THREE', 'Homo sapiens frequency', $n*5, $homosapiens);
-