chrislo-sourceclassifier 0.2.0 → 0.2.1

data/sources/gcc/echo.gcc

@@ -1,144 +0,0 @@
-/* -*- mode: c -*-
- * $Id: echo.gcc,v 1.1.1.1 2004-05-19 18:09:36 bfulgham Exp $
- * http://www.bagley.org/~doug/shootout/
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <unistd.h>
-#include <signal.h>
-#include <errno.h>
-#include <sys/types.h>
-#include <sys/socket.h>
-#include <sys/wait.h>
-#include <netinet/in.h>
-
-
-typedef int (*SOCKACTION_P)(int,struct sockaddr *,socklen_t);
-#define DATA "Hello there sailor\n"
-
-void myabort (char *m) { fprintf(stderr, "%s\n", m); exit(1); }
-void sysabort (char *m) { perror(m); exit(1); }
-
-int sigchld = 0;
-void reaper (int sig) { sigchld = 1; }
-
-int 
-genericSock(int port,SOCKACTION_P action,char *actionExceptionText) {
-    int ss, optval = 1;
-    struct sockaddr_in sin;
-    if ((ss = socket(PF_INET, SOCK_STREAM, 0)) == -1)
-	sysabort("socket");
-    if (setsockopt(ss, SOL_SOCKET, SO_REUSEADDR, &optval, sizeof(optval)) == -1)
-	sysabort("setsockopt");
-    memset(&sin,0,sizeof(sin));
-    sin.sin_family = AF_INET;
-    sin.sin_addr.s_addr = htonl(INADDR_LOOPBACK);
-    sin.sin_port = port; 
-    if (action(ss, (struct sockaddr *)&sin,(socklen_t)sizeof(sin)) == -1)
-	sysabort(actionExceptionText);
-
-    return(ss);
-}
-
-int
-server_sock () {
-    int ss = genericSock(0,(SOCKACTION_P)bind,"server/bind");
-    return(listen(ss,2),ss);
-}
-
-int
-client_sock (int port) {
-    return(genericSock(port,(SOCKACTION_P)connect,"client/connect"));
-}
-
-int
-get_port (int sock) {
-    struct sockaddr_in sin;
-    socklen_t slen = sizeof(sin);
-    if (getsockname(sock, (struct sockaddr *)&sin, &slen) == -1)
-	sysabort("server/getsockname");
-    return(sin.sin_port);
-}    
-
-void
-echo_client (int n, int port) {
-    int i, sock, olen, len, nwritten, nread;
-    char *offset, obuf[64], ibuf[64];
-    char *end = ibuf + sizeof(ibuf);
-
-    sock = client_sock(port);
-    strcpy(obuf, DATA);
-    olen = strlen(obuf);
-    for (i=0; i<n; i++) {
-	len = olen;
-	offset = obuf;
-	while (len > 0) {
-	    if ((nwritten = write(sock, offset, len)) == -1)
-		sysabort("client/write");
-	    offset += nwritten;
-	    len -= nwritten;
-	}
-	offset = ibuf;
-	while ((nread = read(sock, offset, (end - offset))) > 0) {
-	    offset += nread;
-	    if (*(offset-1) == '\n') break;
-	}
-	if (nread == -1)
-	    sysabort("client/read");
-	*offset = 0;
-	if ((strcmp(obuf, ibuf)) != 0) {
-	    char mbuf[128];
-	    sprintf(mbuf, "client: \"%s\" ne \"%s\"", obuf, ibuf);
-	    myabort(mbuf);
-	}
-    }
-    close(sock);
-}
-
-void
-echo_server (int n) {
-    int ssock, csock, len, nwritten, total_bytes;
-    pid_t pid;
-    char buf[64], *offset;
-    struct sockaddr_in sin;
-    socklen_t slen = sizeof(sin);
-    int status;
-
-    ssock = server_sock();
-    signal(SIGCHLD, reaper);
-    if ((pid = fork()) == -1)
-	sysabort("server/fork");
-    if (pid) {
-	/* parent is server */
-	if ((csock = accept(ssock, (struct sockaddr *)&sin, &slen)) == -1)
-	    sysabort("server/accept");
-	total_bytes = 0;
-	while ((len = read(csock, buf, sizeof(buf))) > 0) {
-	    if (sigchld) myabort("server/sigchld");
-	    offset = buf;
-	    total_bytes += len;
-	    while (len > 0) {
-		if ((nwritten = write(csock, offset, len)) == -1)
-		    sysabort("server/write");
-		offset += nwritten;
-		len -= nwritten;
-	    }
-	}
-	if (len == -1)
-	    sysabort("server/read");
-	close(csock);
-	fprintf(stdout, "server processed %d bytes\n", total_bytes);
-    } else {
-	/* child is client */
-	echo_client(n, get_port(ssock));
-    }
-    wait(&status);
-}
-
-int
-main(int argc, char *argv[]) {
-    echo_server((argc == 2) ? atoi(argv[1]) : 1);
-    return(0);
-}

data/sources/gcc/except.gcc

@@ -1,52 +0,0 @@
-/* -*- mode: c -*-
- * $Id: except.gcc,v 1.1.1.1 2004-05-19 18:09:42 bfulgham Exp $
- * http://www.bagley.org/~doug/shootout/
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-#include <setjmp.h>
-
-int HI = 0, LO = 0;
-
-static jmp_buf Hi_exception;
-static jmp_buf Lo_exception;
-
-void blowup (int n) {
-    if (n & 1) {
-	longjmp(Lo_exception, 1);
-    } else {
-	longjmp(Hi_exception, 1);
-    }
-}
-
-void lo_function (volatile int n) {
-    if (setjmp(Lo_exception) != 0) {
-	LO++;
-    } else {
-	blowup(n);
-    }
-}
-
-void hi_function (volatile int n) {
-    if (setjmp(Hi_exception) != 0) {
-	HI++;
-    } else {
-	lo_function(n);
-    }
-}
-
-void some_function (int n) {
-    hi_function(n);
-}
-
-int
-main(int argc, char *argv[]) {
-    int volatile N = ((argc == 2) ? atoi(argv[1]) : 1);
-
-    while (N) {
-	some_function(N--);
-    }
-    printf("Exceptions: HI=%d / LO=%d\n", HI, LO);
-    return(0);
-}

data/sources/gcc/fannkuch.gcc

@@ -1,105 +0,0 @@
-/*
- * The Computer Lannguage Shootout
- * http://shootout.alioth.debian.org/
- * Contributed by Heiner Marxen
- *
- * "fannkuch"	for C gcc
- *
- * $Id: fannkuch.gcc,v 1.5 2005-12-04 23:58:38 igouy-guest Exp $
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-
-#define Int	int
-#define Aint	int
-
-    static long
-fannkuch( int n )
-{
-    Aint*	perm;
-    Aint*	perm1;
-    Aint*	count;
-    long	flips;
-    long	flipsMax;
-    Int		r;
-    Int		i;
-    Int		k;
-    Int		didpr;
-    const Int	n1	= n - 1;
-
-    if( n < 1 ) return 0;
-
-    perm  = calloc(n, sizeof(*perm ));
-    perm1 = calloc(n, sizeof(*perm1));
-    count = calloc(n, sizeof(*count));
-
-    for( i=0 ; i<n ; ++i ) perm1[i] = i;	/* initial (trivial) permu */
-
-    r = n; didpr = 0; flipsMax = 0;
-    for(;;) {
-	if( didpr < 30 ) {
-	    for( i=0 ; i<n ; ++i ) printf("%d", (int)(1+perm1[i]));
-	    printf("\n");
-	    ++didpr;
-	}
-	for( ; r!=1 ; --r ) {
-	    count[r-1] = r;
-	}
-
-#define XCH(x,y)	{ Aint t_mp; t_mp=(x); (x)=(y); (y)=t_mp; }
-
-	if( ! (perm1[0]==0 || perm1[n1]==n1) ) {
-	    flips = 0;
-	    for( i=1 ; i<n ; ++i ) {	/* perm = perm1 */
-		perm[i] = perm1[i];
-	    }
-	    k = perm1[0];		/* cache perm[0] in k */
-	    do {			/* k!=0 ==> k>0 */
-		Int	j;
-		for( i=1, j=k-1 ; i<j ; ++i, --j ) {
-		    XCH(perm[i], perm[j])
-		}
-		++flips;
-		/*
-		 * Now exchange k (caching perm[0]) and perm[k]... with care!
-		 * XCH(k, perm[k]) does NOT work!
-		 */
-		j=perm[k]; perm[k]=k ; k=j;
-	    }while( k );
-	    if( flipsMax < flips ) {
-		flipsMax = flips;
-	    }
-	}
-
-	for(;;) {
-	    if( r == n ) {
-		return flipsMax;
-	    }
-	    /* rotate down perm[0..r] by one */
-	    {
-		Int	perm0 = perm1[0];
-		i = 0;
-		while( i < r ) {
-		    k = i+1;
-		    perm1[i] = perm1[k];
-		    i = k;
-		}
-		perm1[r] = perm0;
-	    }
-	    if( (count[r] -= 1) > 0 ) {
-		break;
-	    }
-	    ++r;
-	}
-    }
-}
-
-    int
-main( int argc, char* argv[] )
-{
-    int		n = (argc>1) ? atoi(argv[1]) : 0;
-
-    printf("Pfannkuchen(%d) = %ld\n", n, fannkuch(n));
-    return 0;
-}

data/sources/gcc/fannkuch.gcc-2.gcc

@@ -1,94 +0,0 @@
-/**
- * The Computer Language Benchmarks game
- * http://shootout.alioth.debian.org/
- *
- * Contributed by Rodney Drenth
- *
- */
-
-
-#include <stdio.h>
-#include <stdlib.h>
-
-void PrintPerm( int *perm, int n)
-{
-   while(n-- >0) printf("%d", 1+*perm++);
-   printf("\n");
-}
-#define XCNG(a,b,t) {t=a;a=b;b=t;}
-
-int fannkuch( int n )
-{
-   int      *count, *perm, *perm1, *perm2, *p1, *pA;
-   int      **prmts;
-   int      flips, maxFlips;
-   int      r, i, k, m, nx;
-   int      check = 30;
-
-    if (n <= 1)
-      return 0;
-
-   prmts = calloc( n, sizeof( int *));
-   perm1 = pA = calloc( (n+4)*n, sizeof(int));
-   perm2 = perm1 + n;
-   count = perm1 + 2*n;
-   perm  = perm1 + 3*n;
-   p1 = perm1 + 4*n;
-   for (r=0; r<n; r++) {
-      prmts[r] = perm1 + (4+r)*n;
-      p1[r] = perm1[r] = r;
-      count[r] = r+1;
-   }
-   for (nx=1; nx<n; nx++) {   // compute permutation operators
-      int *p2 = prmts[nx];
-      for (i=0; i<nx; i++) p2[i] = p1[i+1];
-      p2[i++] = p1[0];
-      for ( ; i<n; i++) p2[i] = p1[i];
-      p1=p2;
-   }
-
-   m = n-1;
-   maxFlips = 1;
-   r = 0;
-   while (1) {
-      if (check>0 ) {
-         PrintPerm( perm1, n);
-         check--;
-      }
-      k = perm1[0];
-      if ( perm1[k]!=0 && (perm1[m]!= m)) {
-         for (i=n; --i>0; ) 
-            perm[i] = perm1[i];   
-         perm[0] = k;
-         for (flips=0; k; flips++) { 
-            int l, *pk;
-            l = (k-1)/2;
-            for( pk = perm+k; l>=0; --l) {
-               XCNG(*(pk-l), *(perm+l), k);
-            };
-            // Note: final exchange leaves perm[0] in k
-          }
-         if (maxFlips < flips) maxFlips = flips;
-      }
-      r = 1;
-      while (--count[r] == 0) {
-         r = count[r] = r+1;
-         if (r== n) {
-            free(prmts); free(pA);
-            return maxFlips;
-         }
-      }
-      // generate permutation nx=5 first time.
-      XCNG(perm1,perm2,p1);
-      if (r>1) nx = r+1;
-      p1 = prmts[r]; 
-      for (i=0; i< nx; i++)
-         perm1[i] = perm2[p1[i]];
-   }
-}
-
-int main( int argc, char* argv[] )
-{
-    int      n = (argc>1) ? atoi(argv[1]) : 1;
-    printf("Pfannkuchen(%d) = %d\n", n, fannkuch(n));
-}

data/sources/gcc/fasta.gcc

@@ -1,158 +0,0 @@
-/* -*- mode: c -*-
- * $Id: fasta.gcc,v 1.1 2005-03-19 07:50:09 bfulgham Exp $
- * http://shootout.alioth.debian.org/
- *
- * by Paul Hsieh
- */
-
-#include <stdio.h>
-#include <stdlib.h>
-
-#define IM 139968
-#define IA   3877
-#define IC  29573
-
-double gen_random (double max) {
-    static long last = 42;
-    return max * (last = (last * IA + IC) % IM) / IM;
-}
-
-struct aminoacids {
-    char c;
-    double p;
-};
-
-/* Weighted selection from alphabet */
-
-void makeCumulative (struct aminoacids * genelist, int count) {
-    double cp = 0.0;
-    int i;
-
-    for (i=0; i < count; i++) {
-        cp += genelist[i].p;
-        genelist[i].p = cp;
-    }
-}
-
-char selectRandom (const struct aminoacids * genelist, int count) {
-    double r = gen_random (1);
-    int i, lo, hi;
-
-    if (r < genelist[0].p) return genelist[0].c;
-
-    lo = 0;
-    hi = count-1;
-
-    while (hi > lo+1) {
-        i = (hi + lo) / 2;
-        if (r < genelist[i].p) hi = i; else lo = i;
-    }
-    return genelist[hi].c;
-}
-
-/* Generate and write FASTA format */
-
-#define LINE_LENGTH (60)
-
-void makeRandomFasta (const char * id, const char * desc, const struct 
-aminoacids * genelist, int count, int n) {
-   int todo = n;
-   int i, m;
-
-   printf (">%s %s\n", id, desc);
-
-   for (; todo > 0; todo -= LINE_LENGTH) {
-       char pick[LINE_LENGTH+1];
-       if (todo < LINE_LENGTH) m = todo; else m = LINE_LENGTH;
-       for (i=0; i < m; i++) pick[i] = selectRandom (genelist, count);
-       pick[m] = '\0';
-       puts (pick);
-   }
-}
-
-void makeRepeatFasta (const char * id, const char * desc, const char * 
-s, int n) {
-   char * ss;
-   int todo = n, k = 0, kn = strlen (s);
-   int m;
-
-   ss = (char *) malloc (kn + 1);
-   memcpy (ss, s, kn+1);
-
-   printf (">%s %s\n", id, desc);
-
-   for (; todo > 0; todo -= LINE_LENGTH) {
-       if (todo < LINE_LENGTH) m = todo; else m = LINE_LENGTH;
-
-       while (m >= kn - k) {
-           printf ("%s", s+k);
-           m -= kn - k;
-           k = 0;
-       }
-
-       ss[k + m] = '\0';
-       puts (ss+k);
-       ss[k + m] = s[m+k];
-       k += m;
-   }
-
-   free (ss);
-}
-
-/* Main -- define alphabets, make 3 fragments */
-
-struct aminoacids iub[] = {
-    { 'a', 0.27 },
-    { 'c', 0.12 },
-    { 'g', 0.12 },
-    { 't', 0.27 },
-
-    { 'B', 0.02 },
-    { 'D', 0.02 },
-    { 'H', 0.02 },
-    { 'K', 0.02 },
-    { 'M', 0.02 },
-    { 'N', 0.02 },
-    { 'R', 0.02 },
-    { 'S', 0.02 },
-    { 'V', 0.02 },
-    { 'W', 0.02 },
-    { 'Y', 0.02 }
-};
-
-#define IUB_LEN (sizeof (iub) / sizeof (struct aminoacids))
-
-struct aminoacids homosapiens[] = {
-    { 'a', 0.3029549426680 },
-    { 'c', 0.1979883004921 },
-    { 'g', 0.1975473066391 },
-    { 't', 0.3015094502008 },
-};
-
-#define HOMOSAPIENS_LEN (sizeof (homosapiens) / sizeof (struct aminoacids))
-
-char * alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" \
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" \
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" \
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" \
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" \
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" \
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
-
-int main (int argc, char * argv[]) {
-    int n = 1000;
-
-    if (argc > 1) sscanf (argv[1], "%d", &n);
-
-    makeCumulative (iub, IUB_LEN);
-    makeCumulative (homosapiens, HOMOSAPIENS_LEN);
-
-    makeRepeatFasta ("ONE", "Homo sapiens alu", alu, n*2);
-    makeRandomFasta ("TWO", "IUB ambiguity codes", iub, IUB_LEN, n*3);
-    makeRandomFasta ("THREE", "Homo sapiens frequency", homosapiens, 
-HOMOSAPIENS_LEN, n*5);
-
-    return 0;
-}
-