bio 1.2.1 → 1.3.0

data/test/functional/bio/io/test_togows.rb

@@ -0,0 +1,267 @@
+#
+# test/functional/bio/io/test_togows.rb - Functional test for Bio::TogoWS
+#
+# Copyright::   Copyright (C) 2009
+#               Naohisa Goto <ng@bioruby.org>
+# License::     The Ruby License
+#
+#  $Id:$
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'uri'
+require 'bio/version'
+require 'bio/io/togows'
+require 'bio/db/genbank/genbank'
+require 'test/unit'
+
+module Bio
+
+  # common tests for both instance methods and class methods
+  module FuncTestTogoWSRESTcommon
+
+    bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4)).cleanpath.to_s
+    TestData = Pathname.new(File.join(bioruby_root, 'test', 'data')).cleanpath.to_s
+
+    def test_entry
+      result = nil
+      acc = 'AF237819'
+      assert_nothing_raised {
+        result = @togows.entry('genbank', acc)
+      }
+      assert(!result.to_s.strip.empty?)
+      gb = Bio::GenBank.new(result)
+      assert(gb.accessions.include?(acc))
+    end
+
+    def test_entry_multi
+      result = nil
+      accs = [ 'AF237819' ,'AB302966', 'AY582120' ]
+      assert_nothing_raised {
+        result = @togows.entry('genbank', accs)
+      }
+      assert(!result.to_s.strip.empty?)
+      count = 0
+      accs.each do |x|
+        assert_match(Regexp.new(x), result)
+        count += 1
+      end
+      assert_equal(accs.size, count)
+
+      # argument is a string
+      accs2 = accs.join(',')
+      result2 = nil
+      assert_nothing_raised {
+        result2 = @togows.entry('genbank', accs2)
+      }
+      assert(result2 == result)
+    end
+
+    def test_entry_with_format
+      result = nil
+      acc = 'AF237819'
+      assert_nothing_raised {
+        result = @togows.entry('genbank', acc, 'fasta')
+      }
+      assert(!result.to_s.strip.empty?)
+      assert_match(/^\>/, result)
+    end
+
+    def test_entry_with_key
+      result = nil
+      assert_nothing_raised {
+        result = @togows.entry('pubmed', '16381885', nil, 'authors')
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_entry_with_format_and_key
+      result = nil
+      assert_nothing_raised {
+        result = @togows.entry('pubmed', '16381885', 'json', 'authors')
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_search
+      result = nil
+      assert_nothing_raised {
+        result = @togows.search('nuccore', 'Milnesium tardigradum')
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_search_with_offset_limit
+      result = nil
+      assert_nothing_raised {
+        result = @togows.search('nuccore', 'Milnesium tardigradum', 2, 3)
+      }
+      assert(!result.to_s.strip.empty?)
+      ary = result.chomp.split(/\n/)
+      assert_equal(3, ary.size)
+    end
+
+    def test_search_with_offset_limit_format
+      result = nil
+      assert_nothing_raised {
+        result = @togows.search('nuccore', 'Milnesium tardigradum', 2, 3,
+                                'json')
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_convert
+      data = File.read(File.join(TestData, 'blast', 'b0002.faa.m0'))
+      result = nil
+      assert_nothing_raised {
+        result = @togows.convert(data, 'blast', 'gff')
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_retrieve
+      result = nil
+      assert_nothing_raised {
+        result = @togows.retrieve('AF237819')
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_retrieve_1id_1db
+      result = nil
+      assert_nothing_raised {
+        result = @togows.retrieve('hsa:124',
+                                  :database => 'gene',
+                                  :field => 'entry_id',
+                                  :format => 'json')
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_retrieve_1id_2db
+      result = nil
+      assert_nothing_raised {
+        result = @togows.retrieve('1.1.1.1',
+                                  :database => [ 'gene', 'enzyme' ])
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_retrieve_2id_2db
+      result = nil
+      assert_nothing_raised {
+        result = @togows.retrieve([ '1.1.1.1', 'hsa:124' ],
+                                  :database => [ 'gene', 'enzyme' ])
+      }
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_entry_database_list
+      result = nil
+      assert_nothing_raised {
+        result = @togows.entry_database_list
+      }
+      assert_kind_of(Array, result)
+      assert(!result.empty?)
+    end
+
+    def test_search_database_list
+      result = nil
+      assert_nothing_raised {
+        result = @togows.search_database_list
+      }
+      assert_kind_of(Array, result)
+      assert(!result.empty?)
+    end
+
+  end #FuncTestTogoWSRESTcommon
+
+  # functional test for Bio::TogoWS::REST
+  class FuncTestTogoWSREST < Test::Unit::TestCase
+
+    include FuncTestTogoWSRESTcommon
+
+    def setup
+      @togows = Bio::TogoWS::REST.new
+    end
+
+  end #class FuncTestTogoWSREST
+
+  # functional test for Bio::TogoWS::REST private methods
+  class FuncTestTogoWSRESTprivate < Test::Unit::TestCase
+
+    def setup
+      @togows = Bio::TogoWS::REST.new
+    end
+
+    def test_get
+      response = nil
+      acc = 'AF237819'
+      assert_nothing_raised {
+        response = @togows.instance_eval {
+          get('entry', 'genbank', acc, 'entry_id')
+        }
+      }
+      assert_kind_of(Net::HTTPResponse, response)
+      assert_equal("200", response.code)
+      result = response.body
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_get_dir
+      response = nil
+      assert_nothing_raised {
+        response = @togows.instance_eval {
+          get_dir('search')
+        }
+      }
+      assert_kind_of(Net::HTTPResponse, response)
+      assert_equal("200", response.code)
+      result = response.body
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_post_data
+      data = File.read(File.join(Bio::FuncTestTogoWSRESTcommon::TestData,
+                                 'blast', 'b0002.faa.m0'))
+      response = nil
+      assert_nothing_raised {
+        response = @togows.instance_eval {
+          post_data(data, 'convert', 'blast.gff')
+        }
+      }
+      assert_kind_of(Net::HTTPResponse, response)
+      assert_equal("200", response.code)
+      result = response.body
+      assert(!result.to_s.strip.empty?)
+    end
+
+    def test_database_list
+      result = nil
+      assert_nothing_raised {
+        result = @togows.instance_eval {
+          database_list('entry')
+        }
+      }
+      assert_kind_of(Array, result)
+      assert(!result.empty?)
+    end
+
+  end #class FuncTestTogoWSRESTprivate
+
+  if false # DISABLED because of the server load and execution time
+
+    # functional test for Bio::TogoWS::REST class methods
+    class FuncTestTogoWSRESTclassMethod < Test::Unit::TestCase
+      include FuncTestTogoWSRESTcommon
+      def setup
+        @togows = Bio::TogoWS::REST
+      end
+    end #class FuncTestTogoWSRESTclassMethod
+
+  end #if false
+
+end #module Bio

data/test/functional/bio/sequence/test_output_embl.rb

@@ -0,0 +1,51 @@
+#
+# test/functional/bio/sequence/test_output_embl.rb - Functional test for Bio::Sequence#output(:embl)
+#
+# Copyright::   Copyright (C) 2008
+#               Jan Aerts <jan.aerts@bbsrc.ac.uk>
+# License::     The Ruby License
+#
+#  $Id: test_output_embl.rb,v 1.1.2.2 2008/03/28 00:56:27 ngoto Exp $
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+require 'bio'
+
+module Bio
+class FuncTestSequenceOutputEMBL < Test::Unit::TestCase
+def setup
+  @seq = Bio::Sequence.auto('aattaaaacgccacgcaaggcgattctaggaaatcaaaacgacacgaaatgtggggtgggtgtttgggtaggaaagacagttgtcaacatcagggatttggattgaatcaaaaaaaaagtccttagatttcataaaagctaatcacgcctcaaaactggggcctatctcttcttttttgtcgcttcctgtcggtccttctctatttcttctccaacccctcatttttgaatatttacataacaaaccgttttactttctttggtcaaaattagacccaaaattctatattagtttaagatatgtggtctgtaatttattgttgtattgatataaaaattagttataagcgattatatttttatgctcaagtaactggtgttagttaactatattccaccacgataacctgattacataaaatatgattttaatcattttagtaaaccatatcgcacgttggatgattaattttaacggtttaataacacgtgattaaattatttttagaatgattatttacaaacggaaaagctatatgtgacacaataactcgtgcagtattgttagtttgaaaagtgtatttggtttcttatatttggcctcgattttcagtttatgtgctttttacaaagttttattttcgttatctgtttaacgcgacatttgttgtatggctttaccgatttgagaataaaatcatattacctttatgtagccatgtgtggtgtaatatataataatggtccttctacgaaaaaagcagatcacaattgaaataaagggtgaaatttggtgtcccttttcttcgtcgaaataacagaactaaataaaagaaagtgttatagtatattacgtccgaagaataatccatattcctgaaatacagtcaacatattatatatttagtactttatataaagttaggaattaaatcatatgttttatcgaccatattaagtcacaactttatcataaattaatctgtaattagaattccaagttcgccaccgaatttcgtaacctaatctacatataatagataaaatatatatatgtagagtaattatgatatctatgtatgtagtcatggtatatgaattttgaaattggcaaggtaacattgacggatcgtaacccaacaaataatattaattacaaaatgggtgggcgggaatagtatacaactcataattccactcactttttgtattattaggatatgaaataagagtaatcaacatgcataataaagatgtataatttcttcatcttaaaaaacataactacatggtttaatacacaattttaccttttatcaaaaaagtatttcacaattcactcgcaaattacgaaatgatggctagtgcttcaactccaaatttcgaatattttaaatcacgatgtgtagaaccttttatttactggatactaatcactagtttattgagccaaccaattagttaaatagaacaatcaatattatagccagatattttttcctttaaaaatatttaaaagaggggccagaaaagaaccagagagggaggccatgagacattattatcactagtcaaaaacaacaaaccctccttttgctttttcatataaattattatattttattttgcaggtttcttctcttcttcttcttcttcttcttcttcttcctcttggctgctttctttcatcatccataaagtgaaagctaacgcatagagagagccatatcgtcccaaaaaaagcaaaagtccaaaaaaaaacaactccaaaacattctctcttagctctttactctttagtttctctctctctctctgcctttctctttgttgaagttcatggatgctacgaagtggactcaggtacgtaaaaagatatctctctgctatatctgtttgtttgtagcttctccccgactctcacgctctctctctctctctctctctctttgtgtatctctctactcacataaatatatacatgtgtgtgtatgcatgtttatatgtatgtatgaaaccagtagtggttatacagatagtctatatagagatatcaatatgatgtgttttaatttagactttttatatatccgtttgaaacttccgaagttctcgaatggagttaaggaagttttgttctctacaagttcaatttttcttgtcattaattataaaactctgataactaatggataaaaaaggtatgctttgttagttaccttttgttcttggtgctcaggtcttaccatttttttcctaaattttaattagtctcctttctttaattaattttatgttaacgcactgacgatttaacgttaacaaaaaaacctagattctttttcttttcaatagagcataattattacttcaatttcatttatctcacactaaaccctaatcttggcgaaattccttttatatatataaatttaattaatttttccacaatcttggcggaattcaggactcggttttgcttgttattgttctctcttttaatttgacatggttagggaatacttaaagtatgtcttaattttatagggttttcaagaaatgataaacgtaaagccaatggagcaaatgatttctagcaccaacaacaacacaccgcaacaacaaccaacattcatcgccaccaacacaaggccaaacgccaccgcatccaatggtggctccggaggaaataccaacaacacggctacgatggaaactagaaaggcgaggccacaagagaaagtaaattgtccaagatgcaactcaacaaacacaaagttctgttattacaacaactacagtctcacgcaaccaagatacttctgcaaaggttgtcgaaggtattggaccgaaggtggctctcttcgtaacgtcccagtcggaggtagctcaagaaagaacaagagatcctctacacctttagcttcaccttctaatcccaaacttccagatctaaacccaccgattcttttctcaagccaaatccctaataagtcaaataaagatctcaacttgctatctttcccggtcatgcaagatcatcatcatcatggtatgtctcatttttttcatatgcccaagatagagaacaacaatacttcatcctcaatctatgcttcatcatctcctgtctcagctcttgagcttctaagatccaatggagtctcttcaagaggcatgaacacgttcttgcctggtcaaatgatggattcaaactcagtcctgtactcatctttagggtttccaacaatgcctgattacaaacagagtaataacaacctttcattctccattgatcatcatcaagggattggacataacaccatcaacagtaaccaaagagctcaagataacaatgatgacatgaatggagcaagtagggttttgttccctttttcagacatgaaagagctttcaagcacaacccaagagaagagtcatggtaataatacatattggaatgggatgttcagtaatacaggaggatcttcatggtgaaaaaaggttaaaaagagctcatgaactatcagctttcttctctttttctgtttttttctcctattttattatagtttttactttgatgatcttttgttttttctcacatggggaactttacttaaagttgtcagaacttagtttacagattgtctttttattccttctttctggttttccttttttcctttttttatcagtctttttaaaatatgtatttcataattgggtttgatcattcatatttattagtatcaaaatagagtctatgttcatgagggagtgttaaggggtgtgagggtagaagaataagtgaatacgggggcccg')
+  @seq.entry_id = 'AJ224122'
+  @seq.sequence_version = 3
+  @seq.topology = 'linear'
+  @seq.molecule_type = 'genomic DNA'
+  @seq.data_class = 'STD'
+  @seq.division = 'PLN'
+  @seq.primary_accession = 'AJ224122'
+  @seq.secondary_accessions = []
+  @seq.date_created = '27-FEB-1998 (Rel. 54, Created)'
+  @seq.date_modified = '14-NOV-2006 (Rel. 89, Last updated, Version 6)'
+  @seq.definition = 'Arabidopsis thaliana DAG1 gene'
+  @seq.keywords = ['BBFa gene', 'transcription factor']
+  @seq.species = 'Arabidopsis thaliana (thale cress)'
+  @seq.classification = ['Eukaryota', 'Viridiplantae', 'Streptophyta', 'Embryophyta', 'Tracheophyta',
+    'Spermatophyta', 'Magnoliophyta', 'eudicotyledons', 'core eudicotyledons', 'rosids',
+    'eurosids II', 'Brassicales', 'Brassicaceae', 'Arabidopsis']
+end
+
+def test_output_embl
+  assert_nothing_raised { @seq.output(:embl) }
+end
+
+def test_output_fasta
+  assert_nothing_raised { @seq.output(:fasta) }
+end
+
+end #class FuncTestSequenceOutputEMBL
+
+end #module Bio
+

data/test/functional/bio/test_command.rb

@@ -0,0 +1,301 @@
+#
+# test/unit/bio/test_command.rb - Functional test for external command execution methods in Bio::Command
+#
+# Copyright::	Copyright (C) 2008
+# 		Naohisa Goto <ng@bioruby.org>
+# License::	The Ruby License
+#
+#  $Id:$
+#
+
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 3, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+
+require 'test/unit'
+require 'tempfile'
+require 'bio/command'
+
+module Bio
+  class FuncTestCommandCall < Test::Unit::TestCase
+
+    def setup
+      case RUBY_PLATFORM
+      when /mswin32|bccwin32/
+        bioruby_root = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 3)).cleanpath.to_s
+        cmd = File.expand_path(File.join(bioruby_root, 'test', 'data', 'command', 'echoarg2.bat'))
+        @arg = [ cmd, 'test "argument 1"', '"test" argument 2', 'arg3' ]
+        @expected = '"""test"" argument 2"'
+      else
+        cmd = "/bin/echo"
+        @arg = [ cmd, "test (echo) command" ]
+        @expected = "test (echo) command"
+        unless FileTest.executable?(cmd) then
+          raise "Unsupported environment: /bin/echo not found"
+        end
+      end
+    end
+
+    def test_call_command
+      ret = Bio::Command.call_command(@arg) do |io|
+        io.close_write
+        io.read
+      end
+      assert_equal(@expected, ret.to_s.strip)
+    end
+
+    def test_call_command_popen
+      ret = Bio::Command.call_command_popen(@arg) do |io|
+        io.close_write
+        io.read
+      end
+      assert_equal(@expected, ret.to_s.strip)
+    end
+
+    def test_call_command_fork
+      begin
+        ret = Bio::Command.call_command_fork(@arg) do |io|
+          io.close_write
+          io.read
+        end
+      rescue Errno::ENOENT, NotImplementedError
+        # fork() not supported
+        return
+      end
+      assert_equal(@expected, ret.to_s.strip)
+    end
+
+    def test_call_command_open3
+      begin
+        ret = Bio::Command.call_command_open3(@arg) do |pin, pout, perr| 
+          t = Thread.start { perr.read }
+          begin
+            pin.close
+            output = pout.read
+          ensure
+            t.join
+          end
+          output
+        end
+      rescue NotImplementedError
+        # fork() not supported
+        return
+      end
+      assert_equal(@expected, ret.to_s.strip)
+    end
+
+  end #class FuncTestCommandCall
+
+  class FuncTestCommandQuery < Test::Unit::TestCase
+
+    def setup
+      @data = [ "987", "123", "567", "456", "345" ]
+      @sorted = @data.sort
+      case RUBY_PLATFORM
+      when /mswin32|bccwin32/
+        @sort = "sort"
+        @data = @data.join("\r\n") + "\r\n"
+      else
+        @sort = "/usr/bin/sort"
+        unless FileTest.executable?(@sort) then
+          raise "Unsupported environment: /usr/bin/sort not found"
+        end
+        @data = @data.join("\n") + "\n"
+      end
+    end
+
+    def test_query_command
+      ary = [ @sort ]
+      assert_equal('', Bio::Command.query_command(ary).to_s.strip)
+      str = Bio::Command.query_command(ary, @data).to_s
+      assert_equal(@sorted, str.strip.split(/\s+/))
+    end
+
+    def test_query_command_popen
+      ary = [ @sort ]
+      assert_equal('', Bio::Command.query_command_popen(ary).to_s.strip)
+      str = Bio::Command.query_command_popen(ary, @data).to_s
+      assert_equal(@sorted, str.strip.split(/\s+/))
+    end
+
+    def test_query_command_fork
+      ary = [ @sort ]
+      begin
+        str = Bio::Command.query_command_fork(ary).to_s
+      rescue Errno::ENOENT, NotImplementedError
+        # fork() not supported
+        return
+      end
+      assert_equal('', str.strip)
+      str = Bio::Command.query_command_fork(ary, @data).to_s
+      assert_equal(@sorted, str.strip.split(/\s+/))
+    end
+
+    def test_query_command_open3
+      ary = [ @sort ]
+      begin
+        str, err = Bio::Command.query_command_open3(ary)
+      rescue NotImplementedError
+        # fork() not supported
+        return
+      end
+      assert_equal('', str.to_s.strip)
+      str, err = Bio::Command.query_command_open3(ary, @data)
+      assert_equal(@sorted, str.to_s.strip.split(/\s+/))
+    end
+  end #class FuncTestCommandQuery
+
+  class FuncTestCommandChdir < Test::Unit::TestCase
+    def setup
+      case RUBY_PLATFORM
+      when /mswin32|bccwin32/
+        @arg = [ 'dir', '/B', '/-P' ]
+      else
+        cmd = '/bin/ls'
+        @arg = [ cmd ]
+        unless FileTest.executable?(cmd) then
+          raise "Unsupported environment: #{cmd} not found"
+        end
+      end
+      @tempfile = Tempfile.new('chdir')
+      @tempfile.close(false)
+      @filename = File.basename(@tempfile.path)
+      @dirname = File.dirname(@tempfile.path)
+    end
+
+    def teardown
+      @tempfile.close(true)
+    end
+
+    def test_call_command_chdir
+      str = nil
+      Bio::Command.call_command(@arg, { :chdir => @dirname }) do |io|
+        io.close_write
+        str = io.read
+      end
+      assert(str.index(@filename))
+    end
+
+    def test_call_command_popen_chdir
+      str = nil
+      Bio::Command.call_command_popen(@arg,
+                                      { :chdir => @dirname }) do |io|
+        io.close_write
+        str = io.read
+      end
+      assert(str.index(@filename))
+    end
+
+    def test_call_command_fork_chdir
+      str = nil
+      begin
+        Bio::Command.call_command_fork(@arg, 
+                                       { :chdir => @dirname }) do |io|
+          io.close_write
+          str = io.read
+        end
+      rescue Errno::ENOENT, NotImplementedError
+        # fork() not supported
+        return
+      end
+      assert(str.index(@filename))
+    end
+
+    def test_query_command_chdir
+      str = Bio::Command.query_command(@arg, nil,
+                                       { :chdir => @dirname }).to_s
+      assert(str.index(@filename))
+    end
+
+    def test_query_command_popen_chdir
+      str = Bio::Command.query_command_popen(@arg, nil,
+                                             { :chdir => @dirname }).to_s
+      assert(str.index(@filename))
+    end
+
+    def test_query_command_fork_chdir
+      begin
+        str = Bio::Command.query_command_fork(@arg, nil,
+                                              { :chdir => @dirname }).to_s
+      rescue Errno::ENOENT, NotImplementedError
+        # fork() not supported
+        return
+      end
+      assert(str.index(@filename))
+    end
+  end #class FuncTestCommandChdir
+
+  class FuncTestCommandBackports < Test::Unit::TestCase
+    def setup
+      if RUBY_VERSION < "1.8.3"
+        @notest = true
+      else
+        @notest = false
+      end
+    end
+
+    def test_remove_entry_secure
+      return if @notest
+      begin
+        tempfile = Tempfile.new('removed')
+        tempfile.close(false)
+        assert(File.exist?(tempfile.path))
+        Bio::Command.remove_entry_secure(tempfile.path)
+        assert_equal(false, File.exist?(tempfile.path))
+      ensure
+        tempfile.close(true) if tempfile
+      end
+    end
+
+    def test_mktmpdir_with_block
+      return if @notest
+      tmpdirpath = nil
+      Bio::Command.mktmpdir('bioruby') do |path|
+        tmpdirpath = path
+        assert(File.directory?(path))
+        assert_nothing_raised {
+          File.open(File.join(path, 'test'), 'w') do |w|
+            w.print "This is test."
+          end
+        }
+      end
+      assert_equal(false, File.directory?(tmpdirpath))
+    end
+
+    def test_mktmpdir_without_block
+      return if @notest
+      path = nil
+      begin
+        assert_nothing_raised {
+          path = Bio::Command.mktmpdir('bioruby')
+        }
+        assert(File.directory?(path))
+        assert_nothing_raised {
+          File.open(File.join(path, 'test'), 'w') do |w|
+            w.print "This is test."
+          end
+        }
+      ensure
+        Bio::Command.remove_entry_secure(path) if path
+      end
+    end
+  end #class FuncTestCommandBackports
+
+  class FuncTestCommandNet < Test::Unit::TestCase
+    def test_read_uri
+      assert_nothing_raised {
+        Bio::Command.read_uri("http://bioruby.open-bio.org/")
+      }
+    end
+
+    def test_start_http
+    end
+
+    def test_new_http
+    end
+
+    def test_post_form
+    end
+  end #class FuncTestCommandNet
+end #module Bio