pydna 5.5.1__py3-none-any.whl → 5.5.3__py3-none-any.whl

{pydna-5.5.1.dist-info → pydna-5.5.3.dist-info}/METADATA

@@ -1,6 +1,6 @@
 Metadata-Version: 2.3
 Name: pydna
-Version: 5.5.1
+Version: 5.5.3
 Summary: Representing double stranded DNA and functions for simulating cloning and homologous recombination between DNA molecules.
 License: BSD
 Author: Björn F. Johansson
@@ -36,6 +36,7 @@ Requires-Dist: pydivsufsort (>=0.0.14)
 Requires-Dist: pyfiglet (==0.8.post1)
 Requires-Dist: pyparsing (>=2.4.7) ; extra == "download"
 Requires-Dist: pyperclip (>=1.8.2) ; extra == "clipboard"
+Requires-Dist: regex (>=2024.11.6,<2025.0.0)
 Requires-Dist: requests (>=2.26.0) ; extra == "download"
 Requires-Dist: scipy (>=1.11.3) ; (python_version >= "3.12") and (extra == "gel")
 Requires-Dist: scipy (>=1.9.3) ; (python_version < "3.12") and (extra == "gel")
@@ -46,11 +47,11 @@ Project-URL: Homepage, https://github.com/pydna-group/pydna#-pydna
 Project-URL: Repository, https://github.com/pydna-group/pydna/tree/master
 Description-Content-Type: text/markdown
 
-# ![icon](https://github.com/pydna-group/pydna/blob/master/docs/_static/pydna.resized.png?raw=true) pydna
+# ![icon](https://github.com/pydna-group/pydna/blob/master/docs/_static/banner.png?raw=true)
 
-| [![Tests & Coverage](https://github.com/pydna-group/pydna/actions/workflows/pydna_test_and_coverage_workflow.yml/badge.svg?branch=dev_bjorn)](https://github.com/pydna-group/pydna/actions/workflows/pydna_test_and_coverage_workflow.yml) | [![codecov](https://codecov.io/gh/BjornFJohansson/pydna/branch/master/graph/badge.svg)](https://codecov.io/gh/BjornFJohansson/pydna/branch/master) | [![PyPI version](https://badge.fury.io/py/pydna.svg)](https://badge.fury.io/py/pydna)                                                  | [![Google group : pydna](https://img.shields.io/badge/Google%20Group-pydna-blue.svg)](https://groups.google.com/g/pydna)          |
+| [![Tests & Coverage](https://github.com/pydna-group/pydna/actions/workflows/pydna_test_and_coverage_workflow.yml/badge.svg?branch=master)](https://github.com/pydna-group/pydna/actions/workflows/pydna_test_and_coverage_workflow.yml) | [![codecov](https://codecov.io/gh/pydna-group/pydna/branch/master/graph/badge.svg)](https://codecov.io/gh/pydna-group/pydna/branch/master) | [![PyPI version](https://badge.fury.io/py/pydna.svg)](https://badge.fury.io/py/pydna)                                                  | [![Google group : pydna](https://img.shields.io/badge/Google%20Group-pydna-blue.svg)](https://groups.google.com/g/pydna)          |
 | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | -------------------------------------------------------------------------------------------------------------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------- | --------------------------------------------------------------------------------------------------------------------------------- |
-| [![Documentation Status](https://github.com/pydna-group/pydna/actions/workflows/publish-docs.yml/badge.svg)](https://github.com/pydna-group/pydna/actions/workflows/publish-docs.yml)                                                      | [![GitHub issues](https://img.shields.io/github/issues/BjornFJohansson/pydna.svg)](https://github.com/pydna-group/pydna/issues)                    | [![Anaconda-Server Badge2](https://anaconda.org/bjornfjohansson/pydna/badges/license.svg)](https://anaconda.org/bjornfjohansson/pydna) | [![GitHub stars](https://img.shields.io/github/stars/BjornFJohansson/pydna.svg)](https://github.com/pydna-group/pydna/stargazers) |
+| [![Documentation Status](https://github.com/pydna-group/pydna/actions/workflows/publish-docs.yml/badge.svg)](https://github.com/pydna-group/pydna/actions/workflows/publish-docs.yml)                                                      | [![GitHub issues](https://img.shields.io/github/issues/pydna-group/pydna.svg)](https://github.com/pydna-group/pydna/issues)                    |  [![GitHub stars](https://img.shields.io/github/stars/pydna-group/pydna.svg)](https://github.com/pydna-group/pydna/stargazers) | |
 
 <!-- docs/index.rst-start -->
 
@@ -437,15 +438,11 @@ Feedback & suggestions are very welcome! Please create an issue with your questi
 
 If you don't have a github account, you can get in touch through the [google group](https://groups.google.com/d/forum/pydna) for pydna.
 
-Below are the instructions for developers who want to contribute to pydna. Please direct pull requests towards the `dev_bjorn` branch.
+Below are the instructions for developers who want to contribute to pydna. Please direct pull requests towards the `master` branch.
 
 ### Fork the repository and set up a dev branch 🍴
 
-Fork the entire repository (not just the `master` branch by unticking the "Copy the `master` branch only" box)
-
-![Fork](https://github.com/pydna-group/pydna/blob/master/docs/_static/create-fork.png?raw=true)
-
-Create your branch starting from `dev_bjorn`, and if your changes are related to an issue, call the branch `issue_<number>`.
+Fork the repository. Create your branch starting from `master`, and if your changes are related to an issue, call the branch `issue_<number>`.
 
 ```bash
 # Clone the repository
@@ -454,12 +451,6 @@ git clone https://github.com/<your-username>/pydna.git
 # Change to the repository directory
 cd pydna
 
-# Go to the dev_bjorn branch
-git checkout -b dev_bjorn
-
-# Pull the current version of dev_bjorn
-git pull origin dev_bjorn
-
 # Create your own branch
 git checkout -b issue_<number>
 ```
@@ -524,9 +515,22 @@ pre-commit install
    > **TIP:** The hooks are a series of checks that will be run before you commit your code. If any of the checks fail, the commit will not be allowed. Some of them auto-fix the code (e.g., `black` formatting), so you can simply do `git add .` and commit again. Others like `flake8` will prevent the commit to happen until the code is compliant.  For instance, if you import a module in a file and not use it, `flake8` will complain. For a full list of checks, see `.pre-commit-config.yaml`.
 5. Push the changes to your fork
 
+> **TIP:** The continuous integration pipeline also runs doctests. These are tests that validate that the docstring examples are correct. For example, the docstring of the function `pydna.utils.smallest_rotation` looks like this:
+> ```python
+> >>> from pydna.utils import smallest_rotation
+> >>> smallest_rotation("taaa")
+> 'aaat'
+> ```
+> doctest will fail if `smallest_rotation("taaa")` does not return `'aaat'`. If you make changes to some function, you may break the doctests, and this can be a bit hard to understand. If this happens, the CI tests will fail, with a message similar to this:
+> ```
+> =================================== FAILURES ===================================
+> ___________________ [doctest] pydna.assembly2.blunt_overlap ____________________
+> ```
+> This means that the doctest of the function `blunt_overlap` failed. You can run the same test locally with `python -m doctest src/pydna/assembly2.py` (use the appropriate path to the module file). That will give you information of what's failing. Fix, and re-run until it passes!
+
 ### Creating a PR 🔗
 
- * From your fork, make a PR towards the branch `dev_bjorn` in the original repository.
+ * From your fork, make a PR towards the branch `master` in the original repository.
  * Mention the issue number in the PR description (e.g., `Closes #123`).
  * Remember to click the "Allow edits from maintainers" checkbox so that we can make some changes to the PR if necessary.
 
@@ -582,7 +586,7 @@ Wang, Y., Xue, H., Pourcel, C., Du, Y., & Gautheret, D. (2021).
 In Cold Spring Harbor Laboratory (p. 2021.01.17.427048). [DOI](https://doi.org/10.1101/2021.01.17.427048)
 [PubMed](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8180056)
 
-[ShareYourCloning](https://shareyourcloning.org), a web application for designing and documenting DNA cloning strategies.
+[OpenCloning](https://opencloning.org), a web application for designing and documenting DNA cloning strategies.
 
 [An Automated Protein Synthesis Pipeline with Transcriptic and Snakemake](http://blog.booleanbiotech.com/transcriptic_protein_synthesis_pipeline.html)
 

pydna-5.5.3.dist-info/RECORD

@@ -0,0 +1,45 @@
+pydna/__init__.py,sha256=aHQGRBpQdABGgHMwN6CfDMKGvsOpCVSs2f5I5ir5DMw,12867
+pydna/_pretty.py,sha256=foRAxdL3Jiupuz7l38THBQZ7tu-5vQvLm1cKdDa7n6A,923
+pydna/_thermodynamic_data.py,sha256=9_w-97DpkbsWbJGHVijscMvUS_SFt7GxzrxspMRPZSg,10903
+pydna/all.py,sha256=xwkbR5Hn52xVfgLAXaEfIgtNwaBiGDbJFTQfa3Zi6HQ,1781
+pydna/amplicon.py,sha256=X4rCSanhlx1sPN0eAtcdAWg4Lw0WKrGQhv-cgZKtM3s,5343
+pydna/amplify.py,sha256=XRwmSMQ2d8Y379zcl56yU6rt1xWbSulWWHLqp-HRDc0,19260
+pydna/assembly.py,sha256=LM3-s3YysFvvkl1oooxoBjYLt0iMc3E1YLoqE05i8bs,19936
+pydna/assembly2.py,sha256=gyn-R2Jz3D6Pze27iE3IZ6JLvnqg72my9r-J34ZjWqI,98202
+pydna/codon.py,sha256=Nxa_03n2wxXKACkzi55bUN1t5xUU_DBRRwh_ZLIb9_o,2568
+pydna/common_sub_strings.py,sha256=A-gJeA2cEyxKKGQSFoC0BKvcXUGJZcnTUU7x2xlAovc,11574
+pydna/conftest.py,sha256=T5-WmHWLZH3U3ifxnbxd_oOiIFibIrkYpwNacCHlvsY,999
+pydna/contig.py,sha256=m0XV0LO2AbArPZkjyNCf8c7_b1EkXFtYwXHJVG4eTY8,8168
+pydna/cre_lox.py,sha256=sOj9R8_oFPGWs68vc4jf6LqWOXjMsVSwtJaeKl6ZF2M,4476
+pydna/crispr.py,sha256=iwu0Cjskzdb2r-In9633QIxQYKGmSNVOEM_dLK6lC54,3619
+pydna/design.py,sha256=BAoPb4M47yMkF1p4gGmbomZPFyTl0WuXkv8sLSY_Tg0,29067
+pydna/download.py,sha256=7tT8LAEy2Vg05spGfbCea_sol6pUOOBVbxOtyk2mnlQ,1085
+pydna/dseq.py,sha256=2N_dXX36niJItQzN61PoVweee0xxP04_amJ3cSExAtU,54232
+pydna/dseqrecord.py,sha256=9OSuxLqcJse3aIVZCVeN7bZCyohGt7WEXnnv1qBIcB0,47983
+pydna/fakeseq.py,sha256=uxyu1PXF-sVasEqhmyhMcsbpTy84uUtubDiZuxHNb9c,1174
+pydna/fusionpcr.py,sha256=tfIfGGkNoZjg_dodcEx9wTc12aLRnC7J3g-Vg3Jg1uA,2821
+pydna/gateway.py,sha256=iwNHrDIOqKl6_3Rdz7z7c8n_kcLQZuuu72oxNIjyyL8,8686
+pydna/gel.py,sha256=QE1uhnjWXLl2nXgbLs_1TWbPixgUa0-z_UR8jZaByS4,3371
+pydna/genbank.py,sha256=rH677VRklVKBpPoFRsl7Az8fZvrC8TD2lNrNoHO1wU8,8856
+pydna/genbankfile.py,sha256=ii0_RjNGnsfUThTN01c5PRLSZkQT3WlYDvoC6R6ozAA,1451
+pydna/genbankfixer.py,sha256=rJ7qMODx19aha6g8eHC28UfaCsRM983XbTMZXNRdE8w,20510
+pydna/genbankrecord.py,sha256=u9RNBifT0j8rrA2bSdWajodtwm42P52_VlXsxKeOvq0,5566
+pydna/goldengate.py,sha256=LvUWAzhG9OhN1wil7osJIkjfqwBLh355a18wCZO1TvI,1778
+pydna/ladders.py,sha256=fKfWwezxQpX4qon9YCMIwchMBkGVOu8-C02xXk90J-E,3310
+pydna/ligate.py,sha256=ap8xgS4aL9cH4w38e-kpw1Ixa7DtpYF_ipezrVXiHG0,1965
+pydna/parsers.py,sha256=FW2RhZrxWX9wUYJcmt0qi1n7DZP0RfsNaXHhG0eVTWg,7319
+pydna/primer.py,sha256=k9Z_fHfBcY_rGnOtfys806rQBDtvyKwKl2ceSx3_w9A,2272
+pydna/readers.py,sha256=tKoonGlIB9ACeOMnzjhbCya1ooqhFMQIO_G36azN81E,1575
+pydna/seq.py,sha256=82gR1g2D8jfPy1So1pSJvlXYk4zkcKx_qmgvcydxth4,7579
+pydna/seqrecord.py,sha256=haLp1316KQkROkQ0HkJp-RfgWN-eDyLPzTGFLjgXwHk,23363
+pydna/sequence_picker.py,sha256=Pco9IrUwNSiS0wQ5hp5FMfE9kIN9XOwXasKLF9OA6DM,1402
+pydna/sequence_regex.py,sha256=DYuAJkWm_GqEGMpd0pE-Mad_B6POUP8gwjSCFR8RfXw,1259
+pydna/threading_timer_decorator_exit.py,sha256=D91kqjKSavWDnXyc1Fo-CwPYtbmR2DjTXnBYSRXKmSA,2793
+pydna/tm.py,sha256=0r4Aqjt_qanfqR8GNvqNh8us7AKM6JvaQKqHYsswAz4,11143
+pydna/types.py,sha256=OE7iwA3b7f_T6EoBnYbRl9CFrY6OrSkAfuyY-R5kins,1389
+pydna/user_cloning.py,sha256=VSpYX1tdbcD_PzEt69Jz6Lud-yAkYMVXnzVd4v2usnE,692
+pydna/utils.py,sha256=BwBOcr2HyLAPAVdpXEEDiwJ5MeWW096EOekvfyXxbDM,25227
+pydna-5.5.3.dist-info/LICENSE.txt,sha256=u8QfcsnNXZM0UCexerK_MvyA2lPWgeGyUtSYXvLG6Oc,6119
+pydna-5.5.3.dist-info/METADATA,sha256=Orph3mLdDMwKy21DsEucxGYPyLHX9p9FimxYMiaidYU,25090
+pydna-5.5.3.dist-info/WHEEL,sha256=b4K_helf-jlQoXBBETfwnf4B04YC67LOev0jo4fX5m8,88
+pydna-5.5.3.dist-info/RECORD,,

pydna/editor.py

@@ -1,119 +0,0 @@
-#!/usr/bin/env python3
-# -*- coding: utf-8 -*-
-# Copyright 2013-2023 by Björn Johansson.  All rights reserved.
-# This code is part of the Python-dna distribution and governed by its
-# license.  Please see the LICENSE.txt file that should have been included
-# as part of this package.
-"""This module provides a class for opening a sequence using an editor
-that accepts a file as a command line argument.
-
-ApE - A plasmid Editor [#]_ is and excellent editor for this purpose.
-
-References
-----------
-
-.. [#] http://biologylabs.utah.edu/jorgensen/wayned/ape/
-
-"""
-
-import time as _time
-import tempfile as _tempfile
-import os as _os
-import subprocess as _subprocess
-import operator as _operator
-import string as _string
-import copy as _copy
-import uuid as _uuid
-
-_wl = "{}{}-_.()".format(_string.ascii_letters, _string.digits)
-
-
-class Editor:
-    """
-    The Editor class needs to be instantiated before use.
-
-    Parameters
-    ----------
-
-    shell_command_for_editor : str
-        String containing the path to the editor
-
-    tmpdir : str, optional
-        String containing path to the temprary directory where sequence
-        files are stored before opening.
-
-    Examples
-    --------
-
-    >>> import pydna
-    >>> #ape = pydna.Editor("tclsh8.6 /home/bjorn/.ApE/apeextractor/ApE.vfs/lib/app-AppMain/AppMain.tcl")
-    >>> #ape.open("aaa") # This command opens the sequence in the ApE editor
-
-    """
-
-    def __init__(self, shell_command_for_editor, tmpdir=None):
-        self.path_to_editor = shell_command_for_editor
-        self.tmpdir = tmpdir or _os.path.join(_tempfile.gettempdir(), "ApE")
-        try:
-            _os.makedirs(self.tmpdir)
-        except OSError:
-            pass
-
-    def open(self, seq_to_open):
-        """Open a sequence for editing in an external (DNA) editor.
-
-        Parameters
-        ----------
-        args : SeqRecord or Dseqrecord object
-
-        """
-        seq = _copy.deepcopy(seq_to_open)
-        for feature in seq.features:
-            qf = feature.qualifiers
-            if "label" not in qf:
-                try:
-                    qf["label"] = qf["note"]
-                except KeyError:
-                    qf["label"] = ["feat{}".format(len(feature))]
-            if "ApEinfo_fwdcolor" not in qf:
-                qf["ApEinfo_fwdcolor"] = "#ffff49"
-            if "ApEinfo_revcolor" not in qf:
-                qf["ApEinfo_revcolor"] = "#ffe6cc"
-
-        seq.features.sort(key=_operator.attrgetter("location.start"))
-        name = "{name}.gb".format(
-            name="".join(c for c in seq.name.strip().replace(" ", "_") if c in _wl)
-            or _uuid.uuid3(_uuid.NAMESPACE_DNS, seq.name)
-        )
-        tdir = _tempfile.mkdtemp(dir=self.tmpdir)
-        tpth = _os.path.join(tdir, name)
-
-        with open(tpth, "w") as f:
-            f.write(seq.format("gb"))
-
-        _subprocess.Popen(
-            "{} {}".format(self.path_to_editor, tpth),
-            shell=True,
-            stdout=_tempfile.TemporaryFile(),
-            stderr=_tempfile.TemporaryFile(),
-        ).pid
-        _time.sleep(0.5)
-
-
-apeloader = Editor(_os.getenv("pydna_ape"))
-
-
-def ape(*args, **kwargs):
-    """docstring."""
-    return apeloader.open(*args, **kwargs)
-
-
-if __name__ == "__main__":
-    import os as _os
-
-    cached = _os.getenv("pydna_cached_funcs", "")
-    _os.environ["pydna_cached_funcs"] = ""
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cached_funcs"] = cached

pydna/myenzymes.py

@@ -1,51 +0,0 @@
-#!/usr/bin/env python3
-# -*- coding: utf-8 -*-
-# Copyright 2013-2023 by Björn Johansson.  All rights reserved.
-# This code is part of the Python-dna distribution and governed by its
-# license.  Please see the LICENSE.txt file that should have been included
-# as part of this package.
-"""This module establish a RestrictionBatch based on enzymes found in a text file specified in the enzymes entry
-in the python.ini file or by the environment variable pydna_enzymes.
-
-The text file will be searched for all enzymes in the biopython
-AllEnzymes batch which is located in the Bio.Restriction package.
-
-The pydna.myenzymes.myenzymes contains a new restriction batch with the enzymes contained
-within the file specified.
-"""
-
-import os as _os
-import re as _re
-from Bio.Restriction import AllEnzymes as _AllEnzymes
-from Bio.Restriction import RestrictionBatch as _RestrictionBatch
-import logging as _logging
-import traceback as _traceback
-
-_module_logger = _logging.getLogger("pydna." + __name__)
-
-
-_text = ""
-
-
-try:
-    with open(_os.environ["pydna_enzymes"], encoding="utf-8") as _f:
-        _text = _f.read()
-except FileNotFoundError:
-    _module_logger.warning("%s not found.", _os.environ["pydna_enzymes"])
-except IsADirectoryError:
-    _module_logger.warning("%s is a directory.", _os.environ["pydna_enzymes"])
-except IOError:
-    _module_logger.warning("%s found, but could not be read.", _os.environ["pydna_enzymes"])
-except Exception:
-    _module_logger.warning(_traceback.format_exc())
-
-
-myenzymes = _RestrictionBatch([e for e in _AllEnzymes if str(e).lower() in _re.split(r"\W+", _text.lower())])
-
-if __name__ == "__main__":
-    cache = _os.getenv("pydna_cache")
-    _os.environ["pydna_cache"] = "nocache"
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cache"] = cache

pydna/myprimers.py

@@ -1,219 +0,0 @@
-#!/usr/bin/env python3
-# -*- coding: utf-8 -*-
-# Copyright 2013-2023 by Björn Johansson.  All rights reserved.
-# This code is part of the Python-dna distribution and governed by its
-# license.  Please see the LICENSE.txt file that should have been included
-# as part of this package.
-"""
-Provides a practical way to access a list of primer sequences in a text file.
-
-The path of a text file can be specified in the pydna.ini file or by the
-´pydna_primers´ environment variable.
-
-The file is expected to contain sequences in FASTA, Genbank or EMBL formats or
-any format readable by the parse_primers function.
-
-The primer list is expected to follow the convension below. The primer name is
-expected to begin with the number.
-
-can have the format below for example:
-
-::
-
-    >2_third_primer
-    tgagtagtcgtagtcgtcgtat
-
-    >1_second_primer
-    tgatcgtcatgctgactatactat
-
-    >0_first_primer
-    ctaggatcgtagatctagctg
-    ...
-
-The primerlist funtion returns a list of :class:`pydna.primer.Primer` objects
-primerdict returns a dict where the key is the id of the object.
-"""
-
-import os as _os
-import re as _re
-from typing import Iterable
-from pathlib import Path
-import copy as _copy
-from keyword import iskeyword as _iskeyword
-from pydna.parsers import parse_primers as _parse_primers
-from pydna._pretty import pretty_str as _pretty_str
-from collections import UserList as _UserList
-from pydna.utils import open_folder as _open_folder
-from builtins import __dict__ as _kw
-
-
-class PrimerList(_UserList):
-    """Read a text file with primers.
-
-    The primers can be of any format readable by the parse_primers
-    function. Lines beginning with # are ignored. Path defaults to
-    the path given by the pydna_primers environment variable.
-
-    The primer list does not accept new primers. Use the
-    assign_numbers_to_new_primers method and paste the new
-    primers at the top of the list.
-
-    The primer list remembers the numbers of accessed primers.
-    The indices of accessed primers are stored in the .accessed
-    property.
-    """
-
-    def __init__(
-        self,
-        initlist: Iterable = None,
-        path: (str, Path) = None,
-        *args,
-        identifier: str = "p",
-        **kwargs,
-    ):
-        if initlist:
-            self.data = initlist
-            self.path = None
-        else:
-            self.path = Path(path or _os.environ["pydna_primers"])
-            self.path.parent.mkdir(parents=True, exist_ok=True)
-            self.data = _parse_primers(self.path.read_text())[::-1]
-        # super().__init__(*args, **kwargs)
-        self.accessed_indices = []
-        if identifier.isidentifier() and not _iskeyword(identifier) and identifier not in _kw:
-            self.identifier = identifier
-        else:
-            raise ValueError(f"{identifier} is not a valid identifier.")
-
-    def __getitem__(self, i):
-        """Save indices of accessed items."""
-        if isinstance(i, slice):
-            result = self.__class__(self.data[i])
-            for ind in range(i.start, i.stop, i.step or 1):
-                if ind not in self.accessed_indices:
-                    self.accessed_indices.append(ind)
-        else:
-            try:
-                result = self.data[i]
-            except IndexError as e:
-                raise (e)
-            else:
-                if i not in self.accessed_indices:
-                    self.accessed_indices.append(i)
-        return result
-
-    def __setitem__(self, i, item):
-        """Items already present can be set to the same value."""
-        if abs(i) > len(self):
-            raise IndexError(f"index {i} does not exist.")
-        else:
-            if str(item.seq).lower() != str(self.data[i].seq).lower():
-                raise ValueError("Cannot change existing primer.")
-        if i not in self.accessed_indices:
-            self.accessed_indices.append(i)
-
-    @property
-    def accessed(self):
-        """docstring."""
-        return [self.data[i] for i in self.accessed_indices]
-
-    def assign_numbers(self, lst: list):
-        """Find new primers in lst.
-
-        Returns a string containing new primers with their assigned
-        numbers. This string can be copied and pasted to the primer
-        text file.
-        """
-        new = []
-        found = []
-        oldstrs = [str(p.seq).upper() for p in self.data]
-        # no = len(oldstrs)
-        no, *rest = self.data[-1].name.split("_")
-        no = int(no) + 1
-        for p in lst[::-1]:
-            try:
-                i = oldstrs.index(str(p.seq).upper())
-            except ValueError:
-                i = no + len(new)
-                # suffix = p.id.removeprefix(f"{str(i)}_") # use this after removing python 3.8
-                suffix = p.id[len(f"{str(i)}_") :] if p.id.startswith(f"{str(i)}_") else p.id
-                # suffix.lstrip("_")
-                newprimer = _copy.copy(p)
-                newprimer.id = f"{i}_{suffix}"
-                new.append(newprimer)
-            else:
-                found.append(self[i])
-        new = new[::-1]
-        newold = new + found
-        return _pretty_str("\n".join([p.format("primer") for p in newold]))
-
-    def pydna_code_from_list(self, lst: list):
-        """Pydna code for a list of primer objects."""
-        indices = []
-        prstrs = [str(p.seq).upper() for p in self.data]
-        err = None
-        for p in lst:
-            try:
-                prstrs.index(str(p.seq).upper())
-            except ValueError as e:
-                print(f"{p.format('primer')}")
-                err = e
-            else:
-                indices.append(self.data.index(p))
-        if err:
-            raise ValueError("At least one primer not in list.")
-
-        curly = "{}"
-        msg = "from pydna.parsers import parse_primers\n\n"
-        msg += f"{self.identifier} = {curly}\n\n"
-        msg += ", ".join(f"{self.identifier}[{i}]" for i in indices)
-        msg += " = parse_primers('''\n\n"
-        msg += "\n".join(self[i].format("primer") for i in indices)
-        msg += "\n''')"
-        return _pretty_str(msg)
-
-    def open_folder(self):
-        """Open folder where primer file is located."""
-        if self.path:
-            _open_folder(self.path.parent)
-        else:
-            raise ValueError("path property not set.")
-
-    code = pydna_code_from_list
-
-
-def check_primer_numbers(pl: list = None):
-    """Find primers whose number do not match position in list."""
-    if not pl:
-        pl = PrimerList()
-    primers_with_wrong_number = []
-    for i, p in enumerate(pl):
-        if not p.name.startswith(str(i)):
-            primers_with_wrong_number.append(p)
-    return primers_with_wrong_number
-
-
-def undefined_sequence(pl: list = None):
-    """Primers in list with N or n instead of a sequence."""
-    if not pl:
-        pl = PrimerList()
-    return [p for p in pl if _re.match("N+", str(p.seq.upper()))]
-
-
-def find_duplicate_primers(pl: list = None):
-    """Find a list of lists with duplicated primer sequences."""
-    if not pl:
-        pl = PrimerList()
-    pg = {}
-    for p in pl:
-        pg.setdefault(str(p.seq).upper(), []).append(p)
-    return [pl for ps, pl in pg.items() if len(pl) > 1]
-
-
-if __name__ == "__main__":
-    cache = _os.getenv("pydna_cache")
-    _os.environ["pydna_cache"] = "nocache"
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cache"] = cache

pydna-5.5.1.dist-info/RECORD

@@ -1,44 +0,0 @@
-pydna/__init__.py,sha256=_BLqB7eQOWvmMql1-tqh-BSkXMYerYFDdAYpwAAxWEw,13391
-pydna/_pretty.py,sha256=eMjYTy19AUTA-nntiYEql3FPVe4WzTLSZ4f0Jd6SLfo,1172
-pydna/_thermodynamic_data.py,sha256=9_w-97DpkbsWbJGHVijscMvUS_SFt7GxzrxspMRPZSg,10903
-pydna/all.py,sha256=i2dR9cAccr3AdtAMMeH4jazpVjxWjfvu8LB3LD9hwgY,2099
-pydna/amplicon.py,sha256=09_R_-LNFydsTR9GxNtcFDVjypglp28mbWpnrOJEcq0,5466
-pydna/amplify.py,sha256=fjj0GU9Hx7_fzCaqrb1n5T2gQ7mvm5frraQ7b64zdFA,18965
-pydna/assembly.py,sha256=Rewf15nWeeUeMwJl5Laxm4nms_UC3zXI7qMtEbBGRpE,19532
-pydna/codon.py,sha256=Nxa_03n2wxXKACkzi55bUN1t5xUU_DBRRwh_ZLIb9_o,2568
-pydna/common_sub_strings.py,sha256=JD0gXGMymcQCsQtq1OlKuI4QIykKXbo5-OJ8N9XAuuE,11841
-pydna/conftest.py,sha256=T5-WmHWLZH3U3ifxnbxd_oOiIFibIrkYpwNacCHlvsY,999
-pydna/contig.py,sha256=aNKtXGaHY0c70tEEMHk_9lDMk9DQzjFRO6LK-GPtdwc,7991
-pydna/crispr.py,sha256=VbOe_nDVmdhlnYvnnmukJJhRMZr1gk1UK6qOJCCs988,3824
-pydna/design.py,sha256=IE04UXQqAkpX1leTZN8KPJjdd9gj1Es_4HNcTZML5Dw,28781
-pydna/download.py,sha256=uFoAvWYXr1C30071p9OweMdemvKO-1F2pB5CHo2k31U,1307
-pydna/dseq.py,sha256=-iOK3uHplIgYfwbImHzJA2aZ8uXsBwXZbWwkO01-IMM,53601
-pydna/dseqrecord.py,sha256=qVWbAWT672TNYAx_R_TDqbTnlxbL2mN-c-I14PyetR0,47238
-pydna/editor.py,sha256=Au3kZ5DYqa6MYB3kXJePHOJOioSJ5w7jtlZ8kfHvKm8,3471
-pydna/fakeseq.py,sha256=eGeivoppQ8vSPQqggxFXARmUhU6oEBfdnIkGDR_v9UQ,1449
-pydna/fusionpcr.py,sha256=uRuHbwmZ2H5SThDUYW-KwxMB1DwqA2Khof7KXiMdxN8,2783
-pydna/gateway.py,sha256=bZUASiC93WKwofnqBmG6cKahxXHnXHA26K64BAf8HMM,8447
-pydna/gel.py,sha256=yCPXNlF-3HzPVjQxa_NZjpC9UXTPfZBzCmW9m5kWkHo,3554
-pydna/genbank.py,sha256=mPtictXh-oOEdj2H6MtDYP2eaJK7vnap-QS33pEMRIk,8933
-pydna/genbankfile.py,sha256=wpCBYTysYqFwrGBIN8ean2MAAocdA_7OJ9avHEho9fw,1652
-pydna/genbankfixer.py,sha256=D2-I30fIPMndyefNzOaeAYbu6LGHC_SnOyjxJhhMfYw,20695
-pydna/genbankrecord.py,sha256=EWRQ9EB7xzIAVqk7ico0bL_JSjR92LXt0UTSQ0HztEI,5771
-pydna/goldengate.py,sha256=Fmkbb4kkau9h1o6I-MiQZ0rNHwmD4-1IK0BJaL1MblI,1774
-pydna/ladders.py,sha256=2SaTq7_Y8XLvEBK0UqgkB9aWePzG0g84cPiNtJfggx0,3574
-pydna/ligate.py,sha256=41YYBcZxGl1PzABZoi-zkRlRcR6sYCzT4rp5HE45A9Q,2205
-pydna/myenzymes.py,sha256=v9e9JnykCw6lqoZ4zNcW6cH3DGtGxl0O1WXzJkyhhyk,1834
-pydna/myprimers.py,sha256=JtpdejRP6MkKplLv-p5NCMzxBTepYN0CVHSxxP3ms3Q,7362
-pydna/parsers.py,sha256=UlG5xh4EsNNPaPK4SoEE6KL52YxkQfLvKJiDm3DB5s4,6927
-pydna/primer.py,sha256=7AYWIhr1YbjG0Gak94bU6bTlsRUgWCIbKTndgsgWZ2M,2533
-pydna/readers.py,sha256=dsihpjRopxWeeab1bRAK4TRHMBLYK_SpK1j2llHrHk0,1850
-pydna/seq.py,sha256=Qwbx1uo-JIYXIuySXevNtxoDgohENHTTTCjPMnn4yjo,7703
-pydna/seqrecord.py,sha256=oz2YZR3_tkNj7YgdWmJr0MyREJZvCgvmq1g8hzuzNyQ,23530
-pydna/sequence_picker.py,sha256=jYbGUparKyIhDD30BzT2x-olnPpDjv-xvyaeIk6_V4E,1659
-pydna/threading_timer_decorator_exit.py,sha256=D91kqjKSavWDnXyc1Fo-CwPYtbmR2DjTXnBYSRXKmSA,2793
-pydna/tm.py,sha256=YVXgDMB_AxNyzPR9fYT1YWlfy80paKTl2r0bkLFNxU8,11330
-pydna/user_cloning.py,sha256=VSpYX1tdbcD_PzEt69Jz6Lud-yAkYMVXnzVd4v2usnE,692
-pydna/utils.py,sha256=7CQ8tkVcTcNY_k1eBbP242ax3X2MMZGZ1cPhHcDY8y4,22084
-pydna-5.5.1.dist-info/LICENSE.txt,sha256=u8QfcsnNXZM0UCexerK_MvyA2lPWgeGyUtSYXvLG6Oc,6119
-pydna-5.5.1.dist-info/METADATA,sha256=mJGG_H_ccfb97ELbilQYUxFvjIVBNYt7X2Tdwe2Pp0Y,24485
-pydna-5.5.1.dist-info/WHEEL,sha256=b4K_helf-jlQoXBBETfwnf4B04YC67LOev0jo4fX5m8,88
-pydna-5.5.1.dist-info/RECORD,,