pydna 5.5.1__py3-none-any.whl → 5.5.3__py3-none-any.whl

pydna/assembly2.py

@@ -0,0 +1,2627 @@
+# -*- coding: utf-8 -*-
+"""
+Improved implementation of the assembly module. To see a list of issues with the previous implementation,
+see [issues tagged with fixed-with-new-assembly-model](https://github.com/pydna-group/pydna/issues?q=is%3Aissue%20state%3Aopen%20label%3Afixed-with-new-assembly-model)
+"""
+
+import networkx as _nx
+import itertools as _itertools
+from Bio.SeqFeature import SimpleLocation, Location
+from Bio.Seq import reverse_complement
+from Bio.Restriction.Restriction import RestrictionBatch
+import regex
+import copy
+
+from pydna.utils import (
+    shift_location as _shift_location,
+    flatten,
+    location_boundaries as _location_boundaries,
+    locations_overlap as _locations_overlap,
+    sum_is_sticky,
+    limit_iterator,
+    create_location,
+)
+from pydna._pretty import pretty_str as _pretty_str
+from pydna.common_sub_strings import common_sub_strings as common_sub_strings_str
+from pydna.dseqrecord import Dseqrecord as _Dseqrecord
+from pydna.dseq import Dseq as _Dseq
+from pydna.primer import Primer as _Primer
+from pydna.seqrecord import SeqRecord as _SeqRecord
+from pydna.types import (
+    CutSiteType,
+    # TODO: allow user to enforce multi-site
+    EdgeRepresentationAssembly,
+    SubFragmentRepresentationAssembly,
+    AssemblyAlgorithmType,
+    SequenceOverlap,
+    AssemblyEdgeType,
+)
+from pydna.gateway import gateway_overlap, find_gateway_sites
+from pydna.cre_lox import cre_loxP_overlap
+
+from typing import TYPE_CHECKING, Callable
+
+if TYPE_CHECKING:
+    from Bio.Restriction import AbstractCut as _AbstractCut
+
+
+def gather_overlapping_locations(
+    locs: list[Location], fragment_length: int
+) -> list[tuple[Location, ...]]:
+    """
+    Turn a list of locations into a list of tuples of those locations, where each tuple contains
+    locations that overlap. For example, if locs = [loc1, loc2, loc3], and loc1 and loc2 overlap,
+    the output will be [(loc1, loc2), (loc3,)].
+    """
+    # Make a graph with all the locations as nodes
+    G = _nx.Graph()
+    for i, loc in enumerate(locs):
+        G.add_node(i, location=loc)
+
+    # Add edges between nodes that overlap
+    for i in range(len(locs)):
+        for j in range(i + 1, len(locs)):
+            if _locations_overlap(locs[i], locs[j], fragment_length):
+                G.add_edge(i, j)
+
+    # Get groups of overlapping locations
+    groups = list()
+    for loc_set in _nx.connected_components(G):
+        groups.append(tuple(locs[i] for i in loc_set))
+
+    # Sort by location of the first element in each group (does not matter which since they are overlapping)
+    groups.sort(key=lambda x: _location_boundaries(x[0])[0])
+
+    return groups
+
+
+def ends_from_cutsite(
+    cutsite: CutSiteType, seq: _Dseq
+) -> tuple[tuple[str, str], tuple[str, str]]:
+    """Get the sticky or blunt ends created by a restriction enzyme cut.
+
+    Args:
+        cutsite (CutSiteType): A tuple ((cut_watson, ovhg), enzyme) describing where the cut occurs
+        seq (_Dseq): The DNA sequence being cut
+
+    Raises:
+        ValueError: If cutsite is None
+
+    Returns:
+        tuple[tuple[str, str], tuple[str, str]]: A tuple of two tuples, each containing the type of end ('5\'', '3\'', or 'blunt')
+        and the sequence of the overhang. The first tuple is for the left end, second for the right end.
+
+    >>> from Bio.Restriction import NotI
+    >>> x = _Dseq("ctcgGCGGCCGCcagcggccg")
+    >>> x.get_cutsites(NotI)
+    [((6, -4), NotI)]
+    >>> ends_from_cutsite(x.get_cutsites(NotI)[0], x)
+    (("5'", 'ggcc'), ("5'", 'ggcc'))
+    """
+
+    if cutsite is None:
+        raise ValueError("None is not supported")
+
+    cut_watson, cut_crick, ovhg = seq.get_cut_parameters(cutsite, is_left=None)
+    if ovhg < 0:
+        # TODO check the edge in circular
+        return (
+            ("5'", str(seq[cut_watson:cut_crick].reverse_complement()).lower()),
+            ("5'", str(seq[cut_watson:cut_crick]).lower()),
+        )
+    elif ovhg > 0:
+        return (
+            ("3'", str(seq[cut_crick:cut_watson]).lower()),
+            ("3'", str(seq[cut_crick:cut_watson].reverse_complement()).lower()),
+        )
+
+    return ("blunt", ""), ("blunt", "")
+
+
+def restriction_ligation_overlap(
+    seqx: _Dseqrecord,
+    seqy: _Dseqrecord,
+    enzymes=RestrictionBatch,
+    partial=False,
+    allow_blunt=False,
+) -> list[SequenceOverlap]:
+    """Assembly algorithm to find overlaps that would result from restriction and ligation.
+
+    Like in sticky and gibson, the order matters (see example below of partial overlap)
+
+    Args:
+        seqx (_Dseqrecord): The first sequence
+        seqy (_Dseqrecord): The second sequence
+        enzymes (RestrictionBatch): The enzymes to use
+        partial (bool): Whether to allow partial overlaps
+        allow_blunt (bool): Whether to allow blunt ends
+    Returns:
+        list[SequenceOverlap]: A list of overlaps between the two sequences
+
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from pydna.assembly2 import restriction_ligation_overlap
+    >>> from Bio.Restriction import EcoRI, RgaI, DrdI, EcoRV
+    >>> x = Dseqrecord("ccGAATTCaa")
+    >>> y = Dseqrecord("aaaaGAATTCgg")
+    >>> restriction_ligation_overlap(x, y, [EcoRI])
+    [(3, 5, 4)]
+    >>> restriction_ligation_overlap(y, x, [EcoRI])
+    [(5, 3, 4)]
+
+    Partial overlap, note how it is not symmetric
+
+    >>> x = Dseqrecord("GACTAAAGGGTC")
+    >>> y = Dseqrecord("AAGCGATCGCAAGCGATCGCAA")
+    >>> restriction_ligation_overlap(x, y, [RgaI, DrdI], partial=True)
+    [(6, 5, 1), (6, 15, 1)]
+    >>> restriction_ligation_overlap(y, x, [RgaI, DrdI], partial=True)
+    []
+
+    Blunt overlap, returns length of the overlap 0
+
+    >>> x = Dseqrecord("aaGATATCcc")
+    >>> y = Dseqrecord("ttttGATATCaa")
+    >>> restriction_ligation_overlap(x, y, [EcoRV], allow_blunt=True)
+    [(5, 7, 0)]
+    >>> restriction_ligation_overlap(y, x, [EcoRV], allow_blunt=True)
+    [(7, 5, 0)]
+
+    """
+    cuts_x = seqx.seq.get_cutsites(*enzymes)
+    cuts_y = seqy.seq.get_cutsites(*enzymes)
+    # If blunt ends are allowed, something similar to this could be done to allow
+    # joining with linear sequence ends, but for now it messes up with the only_adjacent_edges
+    # case
+    # if allow_blunt:
+    #     if not seqx.circular:
+    #         cuts_x.append(((len(seqx), 0), None))
+    #     if not seqy.circular:
+    #         cuts_y.append(((0, 0), None))
+    matches = list()
+    for cut_x, cut_y in _itertools.product(cuts_x, cuts_y):
+        # A blunt end
+        if allow_blunt and cut_x[0][1] == cut_y[0][1] == 0:
+            matches.append((cut_x[0][0], cut_y[0][0], 0))
+            continue
+
+        # Otherwise, test overhangs
+        overlap = sum_is_sticky(
+            ends_from_cutsite(cut_x, seqx.seq)[0],
+            ends_from_cutsite(cut_y, seqy.seq)[1],
+            partial,
+        )
+        if not overlap:
+            continue
+        x_watson, x_crick, x_ovhg = seqx.seq.get_cut_parameters(cut_x, is_left=False)
+        y_watson, y_crick, y_ovhg = seqy.seq.get_cut_parameters(cut_y, is_left=True)
+        # Positions where the overlap would start for full overlap
+        left_x = x_watson if x_ovhg < 0 else x_crick
+        left_y = y_watson if y_ovhg < 0 else y_crick
+
+        # Correct por partial overlaps
+        left_x += abs(x_ovhg) - overlap
+
+        matches.append((left_x, left_y, overlap))
+    return matches
+
+
+def combine_algorithms(*algorithms: AssemblyAlgorithmType) -> AssemblyAlgorithmType:
+    """
+    Combine assembly algorithms, if any of them returns a match, the match is returned.
+
+    This can be used for example in a ligation where you want to allow both sticky and blunt end ligation.
+    """
+
+    def combined(seqx, seqy, limit):
+        matches = list()
+        for algorithm in algorithms:
+            matches += algorithm(seqx, seqy, limit)
+        return matches
+
+    return combined
+
+
+def blunt_overlap(
+    seqx: _Dseqrecord, seqy: _Dseqrecord, limit=None
+) -> list[SequenceOverlap]:
+    """
+    Assembly algorithm to find blunt overlaps. Used for blunt ligation.
+
+    It basically returns [(len(seqx), 0, 0)] if the right end of seqx is blunt and the
+    left end of seqy is blunt (compatible with blunt ligation). Otherwise, it returns an empty list.
+
+    Args:
+        seqx (_Dseqrecord): The first sequence
+        seqy (_Dseqrecord): The second sequence
+        limit (int): There for compatibility, but it is ignored
+
+    Returns:
+        list[SequenceOverlap]: A list of overlaps between the two sequences
+
+    >>> from pydna.assembly2 import blunt_overlap
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> x = Dseqrecord("AAAAAA")
+    >>> y = Dseqrecord("TTTTTT")
+    >>> blunt_overlap(x, y)
+    [(6, 0, 0)]
+    """
+    if (
+        seqx.seq.three_prime_end()[0] == "blunt"
+        and seqy.seq.five_prime_end()[0] == "blunt"
+    ):
+        return [(len(seqx), 0, 0)]
+    return []
+
+
+def common_sub_strings(
+    seqx: _Dseqrecord, seqy: _Dseqrecord, limit=25
+) -> list[SequenceOverlap]:
+    """
+    Assembly algorithm to find common substrings of length == limit. see the docs of
+    the function common_sub_strings_str for more details. It is case insensitive.
+
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> x = Dseqrecord("TAAAAAAT")
+    >>> y = Dseqrecord("CCaAaAaACC")
+    >>> common_sub_strings(x, y, limit=5)
+    [(1, 2, 6), (1, 3, 5), (2, 2, 5)]
+    """
+    query_seqx = str(seqx.seq).upper()
+    query_seqy = str(seqy.seq).upper()
+    if seqx.circular:
+        query_seqx = query_seqx * 2
+    if seqy.circular:
+        query_seqy = query_seqy * 2
+    results = common_sub_strings_str(query_seqx, query_seqy, limit)
+
+    if not seqx.circular and not seqy.circular:
+        return results
+
+    # Remove matches that start on the second copy of the sequence
+    if seqx.circular:
+        results = [r for r in results if r[0] < len(seqx)]
+    if seqy.circular:
+        results = [r for r in results if r[1] < len(seqy)]
+
+    # Trim lengths that span more than the sequence
+    if seqx.circular or seqy.circular:
+        max_match_length = min(len(seqx), len(seqy))
+        results = [(r[0], r[1], min(r[2], max_match_length)) for r in results]
+
+    # Edge case where the sequences are identical
+    if len(seqx.seq) == len(seqy.seq):
+        full_match = next((r for r in results if r[2] == len(seqx.seq)), None)
+        if full_match is not None:
+            return [full_match]
+
+    # Remove duplicate matches, see example below
+    # Let's imagine the following two sequences, where either seqy or both are circular
+    # seqx: 01234
+    # seqy: 123450, circular
+    #
+    # common_sub_strings would return [(0, 5, 5), (1, 0, 4)]
+    # Actually, (1, 0, 4) is a subset of (0, 5, 5), the part
+    # that does not span the origin. To remove matches like this,
+    # We find matches where the origin is spanned in one of the sequences
+    # only, and then remove the subset of that match that does not span the origin.
+    shifted_matches = set()
+    for x, y, length in results:
+        x_span_origin = seqx.circular and x + length > len(seqx)
+        y_span_origin = seqy.circular and y + length > len(seqy)
+        if x_span_origin and not y_span_origin:
+            shift = len(seqx) - x
+            shifted_matches.add((0, y + shift, length - shift))
+        elif not x_span_origin and y_span_origin:
+            shift = len(seqy) - y
+            shifted_matches.add((x + shift, 0, length - shift))
+    return [r for r in results if r not in shifted_matches]
+
+
+def gibson_overlap(seqx: _Dseqrecord, seqy: _Dseqrecord, limit=25):
+    """
+    Assembly algorithm to find terminal overlaps (e.g. for Gibson assembly).
+    The order matters, we want alignments like:
+
+    ```
+    seqx:    oooo------xxxx
+    seqy:              xxxx------oooo
+    Product: oooo------xxxx------oooo
+
+    Not like:
+
+    seqx:               oooo------xxxx
+    seqy:     xxxx------oooo
+    Product (unwanted): oooo
+    ```
+
+    Args:
+        seqx (_Dseqrecord): The first sequence
+        seqy (_Dseqrecord): The second sequence
+        limit (int): Minimum length of the overlap
+
+    Returns:
+        list[SequenceOverlap]: A list of overlaps between the two sequences
+
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from pydna.assembly2 import gibson_overlap
+    >>> x = Dseqrecord("ttactaAAAAAA")
+    >>> y = Dseqrecord("AAAAAAcgcacg")
+    >>> gibson_overlap(x, y, limit=5)
+    [(6, 0, 6), (7, 0, 5)]
+    >>> gibson_overlap(y, x, limit=5)
+    []
+    """
+
+    # Because Gibson enzymes remove 5' overhangs, we remove them from the sequence
+    # when looking for homology, then we shift the location of the second fragment accordingly.
+    # This is only relevant for linear fragments, so we don't need to worry about
+    # shifting locations for circular fragments.
+    trim_x_left = -seqx.seq.ovhg if seqx.seq.ovhg < 0 else 0
+    trim_x_right = seqx.seq.watson_ovhg() if seqx.seq.watson_ovhg() < 0 else None
+    trim_y_left = -seqy.seq.ovhg if seqy.seq.ovhg < 0 else 0
+    trim_y_right = seqy.seq.watson_ovhg() if seqy.seq.watson_ovhg() < 0 else None
+
+    stringx = str(seqx.seq[trim_x_left:trim_x_right]).upper()
+    stringy = str(seqy.seq[trim_y_left:trim_y_right]).upper()
+    # We have to convert to list because we need to modify the matches
+    matches = [
+        list(m)
+        for m in common_sub_strings_str(stringx, stringy, limit)
+        if (m[1] == 0 and m[0] + m[2] == len(stringx))
+    ]
+    for match in matches:
+        match[0] += trim_x_left
+        match[1] += trim_y_left
+
+    # convert to tuples again
+    return [tuple(m) for m in matches]
+
+
+def sticky_end_sub_strings(seqx: _Dseqrecord, seqy: _Dseqrecord, limit: bool = False):
+    """
+    Assembly algorithm for ligation of sticky ends.
+
+    For now, if limit 0 / False (default) only full overlaps are considered.
+    Otherwise, partial overlaps are also returned.
+
+    Args:
+        seqx (_Dseqrecord): The first sequence
+        seqy (_Dseqrecord): The second sequence
+        limit (bool): Whether to allow partial overlaps
+
+    Returns:
+        list[SequenceOverlap]: A list of overlaps between the two sequences
+
+
+    Ligation of fully overlapping sticky ends, note how the order matters
+
+    >>> from pydna.dseq import Dseq
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from pydna.assembly2 import sticky_end_sub_strings
+    >>> x = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 0, 3))
+    >>> y = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 3, 0))
+    >>> sticky_end_sub_strings(x, y, limit=False)
+    [(3, 0, 3)]
+    >>> sticky_end_sub_strings(y, x, limit=False)
+    []
+
+    Ligation of partially overlapping sticky ends, specified with limit=True
+
+    >>> x = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 0, 2))
+    >>> y = Dseqrecord(Dseq.from_full_sequence_and_overhangs("AAAAAA", 3, 0))
+    >>> sticky_end_sub_strings(x, y, limit=False)
+    []
+    >>> sticky_end_sub_strings(x, y, limit=True)
+    [(4, 0, 2)]
+
+    """
+    overlap = sum_is_sticky(
+        seqx.seq.three_prime_end(), seqy.seq.five_prime_end(), limit
+    )
+    if overlap:
+        return [(len(seqx) - overlap, 0, overlap)]
+    return []
+
+
+def zip_match_leftwards(
+    seqx: _SeqRecord, seqy: _SeqRecord, match: SequenceOverlap
+) -> SequenceOverlap:
+    """
+    Starting from the rightmost edge of the match, return a new match encompassing the max
+    number of bases. This can be used to return a longer match if a primer aligns for longer
+    than the limit or a shorter match if there are mismatches. This is convenient to maintain
+    as many features as possible. It is used in PCR assembly.
+
+    >>> seq = _Dseqrecord('AAAAACGTCCCGT')
+    >>> primer = _Dseqrecord('ACGTCCCGT')
+    >>> match = (13, 9, 0) # an empty match at the end of each
+    >>> zip_match_leftwards(seq, primer, match)
+    (4, 0, 9)
+
+    Works in circular molecules if the match spans the origin:
+    >>> seq = _Dseqrecord('TCCCGTAAAAACG', circular=True)
+    >>> primer = _Dseqrecord('ACGTCCCGT')
+    >>> match = (6, 9, 0)
+    >>> zip_match_leftwards(seq, primer, match)
+    (10, 0, 9)
+
+    """
+
+    query_x = seqrecord2_uppercase_DNA_string(seqx)
+    query_y = seqrecord2_uppercase_DNA_string(seqy)
+
+    # In circular sequences, the match may go beyond the left-most edge of the sequence if it spans
+    # the origin:
+    # Primer:          ACGTCCCGT
+    #                  |||||||||
+    # Circular seq:    ACGTCCCGT -> Equivalent to Dseqrecord('CCCGTACGT', circular=True)
+    #                      ^
+    #                      Origin
+    # We would start from the last T and move leftwards, but we would stop at the origin
+    # For those cases we shift by length, then go back
+
+    end_on_x = match[0] + match[2]
+    if isinstance(seqx, _Dseqrecord) and seqx.circular and end_on_x <= len(seqx):
+        end_on_x += len(seqx)
+
+    end_on_y = match[1] + match[2]
+    if isinstance(seqy, _Dseqrecord) and seqy.circular and end_on_y <= len(seqy):
+        end_on_y += len(seqy)
+
+    count = 0
+    for x, y in zip(reversed(query_x[:end_on_x]), reversed(query_y[:end_on_y])):
+        if x != y:
+            break
+        count += 1
+
+    # Shift back by length if needed
+    start_on_x = (end_on_x - count) % len(seqx)
+    start_on_y = (end_on_y - count) % len(seqy)
+
+    return (start_on_x, start_on_y, count)
+
+
+def zip_match_rightwards(
+    seqx: _Dseqrecord, seqy: _Dseqrecord, match: SequenceOverlap
+) -> SequenceOverlap:
+    """Same as zip_match_leftwards, but towards the right."""
+
+    query_x = seqrecord2_uppercase_DNA_string(seqx)
+    query_y = seqrecord2_uppercase_DNA_string(seqy)
+
+    start_on_x, start_on_y, _ = match
+    count = 0
+    for x, y in zip(query_x[start_on_x:], query_y[start_on_y:]):
+        if x != y:
+            break
+        count += 1
+    return (start_on_x, start_on_y, count)
+
+
+def seqrecord2_uppercase_DNA_string(seqr: _SeqRecord) -> str:
+    """
+    Transform a Dseqrecord to a sequence string where U is replaced by T, everything is upper case and
+    circular sequences are repeated twice. This is used for PCR, to support primers with U's (e.g. for USER cloning).
+    """
+    out = str(seqr.seq).upper().replace("U", "T")
+    if isinstance(seqr, _Dseqrecord) and seqr.circular:
+        return out * 2
+    return out
+
+
+def primer_template_overlap(
+    seqx: _Dseqrecord | _Primer, seqy: _Dseqrecord | _Primer, limit=25, mismatches=0
+) -> list[SequenceOverlap]:
+    """
+    Assembly algorithm to find overlaps between a primer and a template. It accepts mismatches.
+    When there are mismatches, it only returns the common part between the primer and the template.
+
+    If seqx is a primer and seqy is a template, it represents the binding of a forward primer.
+    If seqx is a template and seqy is a primer, it represents the binding of a reverse primer,
+    where the primer has been passed as its reverse complement (see examples).
+
+    Args:
+        seqx (_Dseqrecord | _Primer): The primer
+        seqy (_Dseqrecord | _Primer): The template
+        limit (int): Minimum length of the overlap
+        mismatches (int): Maximum number of mismatches (only substitutions, no deletion or insertion)
+
+    Returns:
+        list[SequenceOverlap]: A list of overlaps between the primer and the template
+
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from pydna.primer import Primer
+    >>> from pydna.assembly2 import primer_template_overlap
+    >>> template = Dseqrecord("AATTAGCAGCGATCGAGT", circular=True)
+    >>> primer = Primer("TTAGCAGC")
+    >>> primer_template_overlap(primer, template, limit=8, mismatches=0)
+    [(0, 2, 8)]
+
+    This actually represents the binding of the primer `GCTGCTAA` (reverse complement)
+    >>> primer_template_overlap(template, primer, limit=8, mismatches=0)
+    [(2, 0, 8)]
+    >>> primer_template_overlap(primer, template.reverse_complement(), limit=8, mismatches=0)
+    []
+    >>> primer_template_overlap(primer.reverse_complement(), template, limit=8, mismatches=0)
+    []
+    """
+
+    if isinstance(seqx, _Primer) and isinstance(seqy, _Dseqrecord):
+        primer = seqx
+        template = seqy
+        reverse_primer = False
+    elif isinstance(seqx, _Dseqrecord) and isinstance(seqy, _Primer):
+        primer = seqy
+        template = seqx
+        reverse_primer = True
+    else:
+        raise ValueError(
+            "One of the sequences must be a primer and the other a Dseqrecord"
+        )
+
+    if len(primer) < limit:
+        return []
+
+    subject = seqrecord2_uppercase_DNA_string(template)
+    query = (
+        seqrecord2_uppercase_DNA_string(primer[:limit])
+        if reverse_primer
+        else seqrecord2_uppercase_DNA_string(primer[-limit:])
+    )
+
+    re_matches = list(
+        regex.finditer(
+            "(" + query + "){s<=" + str(mismatches) + "}", subject, overlapped=True
+        )
+    )
+    re_matches += list(
+        regex.finditer(
+            "(?r)(" + query + "){s<=" + str(mismatches) + "}", subject, overlapped=True
+        )
+    )
+
+    out = set()
+    for re_match in re_matches:
+
+        start, end = re_match.span()
+
+        # For circular sequences the same match is returned twice unless it falls
+        # on the origin, we eliminate duplicates here
+        if start >= len(template):
+            continue
+
+        # This extends match beyond the limit if the primer aligns more than that
+        # and reduces the match if the primer has mismatches
+        if reverse_primer:
+            # Match in the same format as other assembly algorithms
+            starting_match = (start, 0, end - start)
+            out.add(zip_match_rightwards(template, primer, starting_match))
+        else:
+            # Match in the same format as other assembly algorithms
+            starting_match = (len(primer) - limit, start, end - start)
+            out.add(zip_match_leftwards(primer, template, starting_match))
+
+    return list(sorted(out))
+
+
+def fill_left(seq: _Dseq) -> _Dseq:
+    """Fill the left overhang of a sequence with the complementary sequence."""
+    new_watson = seq.watson
+    new_crick = seq.crick
+
+    # Watson 5' overhang
+    if seq.ovhg < 0:
+        new_crick = new_crick + reverse_complement(seq.watson[: -seq.ovhg])
+    # Crick 5' overhang
+    elif seq.ovhg > 0:
+        new_watson = reverse_complement(seq.crick[-seq.ovhg :]) + new_watson
+
+    return _Dseq(new_watson, new_crick, 0)
+
+
+def fill_right(seq: _Dseq) -> _Dseq:
+    """Fill the right overhang of a sequence with the complementary sequence."""
+    new_watson = seq.watson
+    new_crick = seq.crick
+
+    # Watson 3' overhang
+    watson_ovhg = seq.watson_ovhg()
+    if watson_ovhg < 0:
+        new_watson = new_watson + reverse_complement(seq.crick[:-watson_ovhg])
+
+    # Crick 3' overhang
+    elif watson_ovhg > 0:
+        new_crick = reverse_complement(seq.watson[-watson_ovhg:]) + new_crick
+
+    return _Dseq(new_watson, new_crick, seq.ovhg)
+
+
+def fill_dseq(seq: _Dseq) -> _Dseq:
+    """Fill the overhangs of a sequence with the complementary sequence."""
+    return fill_left(fill_right(seq))
+
+
+def reverse_complement_assembly(
+    assembly: EdgeRepresentationAssembly, fragments: list[_Dseqrecord]
+) -> EdgeRepresentationAssembly:
+    """Complement an assembly, i.e. reverse the order of the fragments and the orientation of the overlaps."""
+    new_assembly = list()
+    for u, v, locu, locv in assembly:
+        f_u = fragments[abs(u) - 1]
+        f_v = fragments[abs(v) - 1]
+        new_assembly.append((-v, -u, locv._flip(len(f_v)), locu._flip(len(f_u))))
+    return new_assembly[::-1]
+
+
+def filter_linear_subassemblies(
+    linear_assemblies: list[EdgeRepresentationAssembly],
+    circular_assemblies: list[EdgeRepresentationAssembly],
+    fragments: list[_Dseqrecord],
+) -> list[EdgeRepresentationAssembly]:
+    """Remove linear assemblies which are sub-assemblies of circular assemblies"""
+    all_circular_assemblies = circular_assemblies + [
+        reverse_complement_assembly(c, fragments) for c in circular_assemblies
+    ]
+    filtered_assemblies = [
+        assem
+        for assem in linear_assemblies
+        if not any(is_sublist(assem, c, True) for c in all_circular_assemblies)
+    ]
+    # I don't think the line below is necessary, but just in case
+    # filtered_assemblies = [l for l in filtered_assemblies if not any(is_sublist(reverse_complement_assembly(l, fragments), c, True) for c in all_circular_assemblies)]
+    return filtered_assemblies
+
+
+def remove_subassemblies(
+    assemblies: list[EdgeRepresentationAssembly],
+) -> list[EdgeRepresentationAssembly]:
+    """Filter out subassemblies, i.e. assemblies that are contained within another assembly.
+
+    For example:
+        [(1, 2, '1[8:14]:2[1:7]'), (2, 3, '2[10:17]:3[1:8]')]
+        [(1, 2, '1[8:14]:2[1:7]')]
+    The second one is a subassembly of the first one.
+    """
+
+    # Sort by length, longest first
+    assemblies = sorted(assemblies, key=len, reverse=True)
+
+    filtered_assemblies = list()
+    for assembly in assemblies:
+        # Check if this assembly is a subassembly of any of the assemblies we have already found
+        if not any(is_sublist(assembly, a) for a in filtered_assemblies):
+            filtered_assemblies.append(assembly)
+
+    return filtered_assemblies
+
+
+def assembly2str(assembly: EdgeRepresentationAssembly) -> str:
+    """Convert an assembly to a string representation, for example:
+    ((1, 2, [8:14], [1:7]),(2, 3, [10:17], [1:8]))
+    becomes:
+    ('1[8:14]:2[1:7]', '2[10:17]:3[1:8]')
+
+    The reason for this is that by default, a feature '[8:14]' when present in a tuple
+    is printed to the console as `SimpleLocation(ExactPosition(8), ExactPosition(14), strand=1)` (very long).
+    """
+    return str(tuple(f"{u}{lu}:{v}{lv}" for u, v, lu, lv in assembly))
+
+
+def assembly2str_tuple(assembly: EdgeRepresentationAssembly) -> str:
+    """Convert an assembly to a string representation, like
+    ((1, 2, [8:14], [1:7]),(2, 3, [10:17], [1:8]))
+    """
+    return str(tuple((u, v, str(lu), str(lv)) for u, v, lu, lv in assembly))
+
+
+def assembly_has_mismatches(
+    fragments: list[_Dseqrecord], assembly: EdgeRepresentationAssembly
+) -> bool:
+    """Check if an assembly has mismatches. This should never happen and if so it returns an error."""
+    for u, v, loc_u, loc_v in assembly:
+        seq_u = fragments[u - 1] if u > 0 else fragments[-u - 1].reverse_complement()
+        seq_v = fragments[v - 1] if v > 0 else fragments[-v - 1].reverse_complement()
+        # TODO: Check issue where extraction failed, and whether it would give problems here
+        if (
+            str(loc_u.extract(seq_u).seq).upper()
+            != str(loc_v.extract(seq_v).seq).upper()
+        ):
+            return True
+    return False
+
+
+def assembly_is_circular(
+    assembly: EdgeRepresentationAssembly, fragments: list[_Dseqrecord]
+) -> bool:
+    """
+    Based on the topology of the locations of an assembly, determine if it is circular.
+    This does not work for insertion assemblies, that's why assemble takes the optional argument is_insertion.
+    """
+    if assembly[0][0] != assembly[-1][1]:
+        return False
+    elif (
+        isinstance(fragments[abs(assembly[0][0]) - 1], _Dseqrecord)
+        and fragments[abs(assembly[0][0]) - 1].circular
+    ):
+        return True
+    else:
+        return (
+            _location_boundaries(assembly[0][2])[0]
+            > _location_boundaries(assembly[-1][3])[0]
+        )
+
+
+def assemble(
+    fragments: list[_Dseqrecord],
+    assembly: EdgeRepresentationAssembly,
+    is_insertion: bool = False,
+) -> _Dseqrecord:
+    """Generate a Dseqrecord from an assembly and a list of fragments."""
+
+    if is_insertion:
+        is_circular = False
+    else:
+        is_circular = assembly_is_circular(assembly, fragments)
+
+    subfragment_representation = edge_representation2subfragment_representation(
+        assembly, is_circular
+    )
+
+    # Sanity check
+    for asm_edge in assembly:
+        u, v, loc_u, loc_v = asm_edge
+        f_u = fragments[u - 1] if u > 0 else fragments[-u - 1].reverse_complement()
+        f_v = fragments[v - 1] if v > 0 else fragments[-v - 1].reverse_complement()
+        seq_u = str(loc_u.extract(f_u).seq).upper()
+        seq_v = str(loc_v.extract(f_v).seq).upper()
+        if seq_u != seq_v:
+            raise ValueError("Mismatch in assembly")
+
+    # We transform into Dseqrecords (for primers)
+    dseqr_fragments = [
+        f if isinstance(f, _Dseqrecord) else _Dseqrecord(f) for f in fragments
+    ]
+    subfragments = get_assembly_subfragments(
+        dseqr_fragments, subfragment_representation
+    )
+
+    # Length of the overlaps between consecutive assembly fragments
+    fragment_overlaps = [len(e[-1]) for e in assembly]
+
+    out_dseqrecord = _Dseqrecord(subfragments[0])
+
+    for fragment, overlap in zip(subfragments[1:], fragment_overlaps):
+        # Shift the features of the right fragment to the left by `overlap`
+        new_features = [
+            f._shift(len(out_dseqrecord) - overlap) for f in fragment.features
+        ]
+        # Join the left sequence including the overlap with the right sequence without the overlap
+        # we use fill_right / fill_left so that it works for ligation of sticky ends
+        out_dseqrecord = _Dseqrecord(
+            fill_right(out_dseqrecord.seq) + fill_left(fragment.seq)[overlap:],
+            features=out_dseqrecord.features + new_features,
+        )
+
+    # For circular assemblies, close the loop and wrap origin-spanning features
+    if is_circular:
+        overlap = fragment_overlaps[-1]
+
+        # Special case for blunt circularisation
+        if overlap == 0:
+            return out_dseqrecord.looped()
+
+        # Remove trailing overlap
+        out_dseqrecord = _Dseqrecord(
+            fill_dseq(out_dseqrecord.seq)[:-overlap],
+            features=out_dseqrecord.features,
+            circular=True,
+        )
+        for feature in out_dseqrecord.features:
+            start, end = _location_boundaries(feature.location)
+            if start >= len(out_dseqrecord) or end > len(out_dseqrecord):
+                # Wrap around the origin
+                feature.location = _shift_location(
+                    feature.location, 0, len(out_dseqrecord)
+                )
+
+    return out_dseqrecord
+
+
+def annotate_primer_binding_sites(
+    input_dseqr: _Dseqrecord, fragments: list[_Dseqrecord]
+) -> _Dseqrecord:
+    """Annotate the primer binding sites in a Dseqrecord."""
+    fwd, _, rvs = fragments
+    start_rvs = len(input_dseqr) - len(rvs)
+
+    output_dseqr = copy.deepcopy(input_dseqr)
+    output_dseqr.add_feature(
+        x=0,
+        y=len(fwd),
+        type_="primer_bind",
+        strand=1,
+        label=[fwd.name],
+        note=["sequence: " + str(fwd.seq)],
+    )
+    output_dseqr.add_feature(
+        x=start_rvs,
+        y=len(output_dseqr),
+        type_="primer_bind",
+        strand=-1,
+        label=[rvs.name],
+        note=["sequence: " + str(rvs.seq)],
+    )
+    return output_dseqr
+
+
+def edge_representation2subfragment_representation(
+    assembly: EdgeRepresentationAssembly, is_circular: bool
+) -> SubFragmentRepresentationAssembly:
+    """
+    Turn this kind of edge representation fragment 1, fragment 2, right edge on 1, left edge on 2
+    a = [(1, 2, 'loc1a', 'loc2a'), (2, 3, 'loc2b', 'loc3b'), (3, 1, 'loc3c', 'loc1c')]
+    Into this: fragment 1, left edge on 1, right edge on 1
+    b = [(1, 'loc1c', 'loc1a'), (2, 'loc2a', 'loc2b'), (3, 'loc3b', 'loc3c')]
+    """
+
+    if is_circular:
+        temp = list(assembly[-1:]) + list(assembly)
+    else:
+        temp = (
+            [(None, assembly[0][0], None, None)]
+            + list(assembly)
+            + [(assembly[-1][1], None, None, None)]
+        )
+    edge_pairs = zip(temp, temp[1:])
+    subfragment_representation = list()
+    for (_u1, v1, _, start_location), (_u2, _v2, end_location, _) in edge_pairs:
+        subfragment_representation.append((v1, start_location, end_location))
+
+    return tuple(subfragment_representation)
+
+
+def subfragment_representation2edge_representation(
+    assembly: SubFragmentRepresentationAssembly, is_circular: bool
+) -> EdgeRepresentationAssembly:
+    """
+    Turn this kind of subfragment representation fragment 1, left edge on 1, right edge on 1
+    a = [(1, 'loc1c', 'loc1a'), (2, 'loc2a', 'loc2b'), (3, 'loc3b', 'loc3c')]
+    Into this: fragment 1, fragment 2, right edge on 1, left edge on 2
+    b = [(1, 2, 'loc1a', 'loc2a'), (2, 3, 'loc2b' 'loc3b'), (3, 1, 'loc3c', 'loc1c')]
+    """
+
+    edge_representation = []
+
+    # Iterate through the assembly pairwise to create the edge representation
+    for i in range(len(assembly) - 1):
+        frag1, left1, right1 = assembly[i]
+        frag2, left2, right2 = assembly[i + 1]
+        # Create the edge between the current and next fragment
+        edge_representation.append((frag1, frag2, right1, left2))
+
+    if is_circular:
+        # Add the edge from the last fragment back to the first
+        frag_last, left_last, right_last = assembly[-1]
+        frag_first, left_first, right_first = assembly[0]
+        edge_representation.append((frag_last, frag_first, right_last, left_first))
+
+    return tuple(edge_representation)
+
+
+def get_assembly_subfragments(
+    fragments: list[_Dseqrecord],
+    subfragment_representation: SubFragmentRepresentationAssembly,
+) -> list[_Dseqrecord]:
+    """From the fragment representation returned by edge_representation2subfragment_representation, get the subfragments that are joined together.
+
+    Subfragments are the slices of the fragments that are joined together
+
+    For example:
+    ```
+      --A--
+    TACGTAAT
+      --B--
+     TCGTAACGA
+
+    Gives: TACGTAA / CGTAACGA
+    ```
+    To reproduce:
+    ```
+    a = Dseqrecord('TACGTAAT')
+    b = Dseqrecord('TCGTAACGA')
+    f = Assembly([a, b], limit=5)
+    a0 = f.get_linear_assemblies()[0]
+    print(assembly2str(a0))
+    a0_subfragment_rep =edge_representation2subfragment_representation(a0, False)
+    for f in get_assembly_subfragments([a, b], a0_subfragment_rep):
+        print(f.seq)
+
+    # prints TACGTAA and CGTAACGA
+    ```
+
+    Subfragments: `cccccgtatcgtgt`, `atcgtgtactgtcatattc`
+    """
+    subfragments = list()
+    for node, start_location, end_location in subfragment_representation:
+        seq = (
+            fragments[node - 1]
+            if node > 0
+            else fragments[-node - 1].reverse_complement()
+        )
+        subfragments.append(extract_subfragment(seq, start_location, end_location))
+    return subfragments
+
+
+def extract_subfragment(
+    seq: _Dseqrecord, start_location: Location, end_location: Location
+) -> _Dseqrecord:
+    """Extract a subfragment from a sequence for an assembly, given the start and end locations of the subfragment."""
+    start = 0 if start_location is None else _location_boundaries(start_location)[0]
+    end = None if end_location is None else _location_boundaries(end_location)[1]
+
+    # Special case, some of it could be handled by better Dseqrecord slicing in the future
+    if (
+        seq.circular
+        and start_location is not None
+        and end_location is not None
+        and _locations_overlap(start_location, end_location, len(seq))
+    ):
+        # The overhang is different for origin-spanning features, for instance
+        # for a feature join{[12:13], [0:3]} in a sequence of length 13, the overhang
+        # is -4, not 9
+        ovhg = start - end if end > start else start - end - len(seq)
+        # edge case
+        if abs(ovhg) == len(seq):
+            ovhg = 0
+        dummy_cut = ((start, ovhg), None)
+        open_seq = seq.apply_cut(dummy_cut, dummy_cut)
+        return _Dseqrecord(fill_dseq(open_seq.seq), features=open_seq.features)
+
+    return seq[start:end]
+
+
+def is_sublist(sublist: list, my_list: list, my_list_is_cyclic: bool = False) -> bool:
+    """Returns True if argument sublist is a sublist of argument my_list (can be treated as cyclic), False otherwise.
+
+    Examples
+    --------
+    >>> is_sublist([1, 2], [1, 2, 3], False)
+    True
+    >>> is_sublist([1, 2], [1, 3, 2], False)
+    False
+
+    # See the case here for cyclic lists
+    >>> is_sublist([3, 1], [1, 2, 3], False)
+    False
+    >>> is_sublist([3, 1], [1, 2, 3], True)
+    True
+    """
+    n = len(sublist)
+    if my_list_is_cyclic:
+        my_list = my_list + my_list
+    for i in range(len(my_list) - n + 1):
+        # Just in case tuples were passed
+        if list(my_list[i : i + n]) == list(sublist):
+            return True
+    return False
+
+
+def circular_permutation_min_abs(lst: list) -> list:
+    """Returns the circular permutation of lst with the smallest absolute value first.
+
+    Examples
+    --------
+    >>> circular_permutation_min_abs([1, 2, 3])
+    [1, 2, 3]
+    >>> circular_permutation_min_abs([3, 1, 2])
+    [1, 2, 3]
+    """
+    min_abs_index = min(range(len(lst)), key=lambda i: abs(lst[i]))
+    return lst[min_abs_index:] + lst[:min_abs_index]
+
+
+class Assembly:
+    """Assembly of a list of DNA fragments into linear or circular constructs.
+    Accepts a list of Dseqrecords (source fragments) to
+    initiate an Assembly object. Several methods are available for analysis
+    of overlapping sequences, graph construction and assembly.
+
+    The assembly contains a directed graph, where nodes represent fragments and
+    edges represent overlaps between fragments. :
+    - The node keys are integers, representing the index of the fragment in the
+    input list of fragments. The sign of the node key represents the orientation
+    of the fragment, positive for forward orientation, negative for reverse orientation.
+    - The edges contain the locations of the overlaps in the fragments. For an edge (u, v, key):
+        - u and v are the nodes connected by the edge.
+        - key is a string that represents the location of the overlap. In the format:
+        'u[start:end](strand):v[start:end](strand)'.
+        - Edges have a 'locations' attribute, which is a list of two FeatureLocation objects,
+        representing the location of the overlap in the u and v fragment, respectively.
+        - You can think of an edge as a representation of the join of two fragments.
+
+    If fragment 1 and 2 share a subsequence of 6bp, [8:14] in fragment 1 and [1:7] in fragment 2,
+    there will be 4 edges representing that overlap in the graph, for all possible
+    orientations of the fragments (see add_edges_from_match for details):
+    - `(1, 2, '1[8:14]:2[1:7]')`
+    - `(2, 1, '2[1:7]:1[8:14]')`
+    - `(-1, -2, '-1[0:6]:-2[10:16]')`
+    - `(-2, -1, '-2[10:16]:-1[0:6]')`
+
+    An assembly can be thought of as a tuple of graph edges, but instead of representing them with node indexes and keys, we represent them
+    as u, v, locu, locv, where u and v are the nodes connected by the edge, and locu and locv are the locations of the overlap in the first
+    and second fragment. Assemblies are then represented as:
+    - Linear: ((1, 2, [8:14], [1:7]), (2, 3, [10:17], [1:8]))
+    - Circular: ((1, 2, [8:14], [1:7]), (2, 3, [10:17], [1:8]), (3, 1, [12:17], [1:6]))
+    Note that the first and last fragment are the same in a circular assembly.
+
+    The following constrains are applied to remove duplicate assemblies:
+    - Circular assemblies: the first subfragment is not reversed, and has the smallest index in the input fragment list.
+      use_fragment_order is ignored.
+    - Linear assemblies:
+        - Using uid (see add_edges_from_match) to identify unique edges.
+
+    Parameters
+    ----------
+    frags : list
+        A list of Dseqrecord objects.
+    limit : int, optional
+        The shortest shared homology to be considered, this is passed as the third argument to the `algorithm` function.
+        For certain algorithms, this might be ignored.
+    algorithm : function, optional
+        The algorithm used to determine the shared sequences. It's a function that takes two Dseqrecord objects as inputs,
+        and will get passed the third argument (limit), that may or may not be used. It must return a list of overlaps
+        (see common_sub_strings for an example).
+    use_fragment_order : bool, optional
+        It's set to True by default to reproduce legacy pydna behaviour: only assemblies that start with the first fragment and end with the last are considered.
+        You should set it to False.
+    use_all_fragments : bool, optional
+        Constrain the assembly to use all fragments.
+
+
+    Examples
+    --------
+
+    from assembly2 import Assembly, assembly2str
+    from pydna.dseqrecord import Dseqrecord
+
+    example_fragments = (
+        Dseqrecord('AacgatCAtgctcc', name='a'),
+        Dseqrecord('TtgctccTAAattctgc', name='b'),
+        Dseqrecord('CattctgcGAGGacgatG', name='c'),
+    )
+
+    asm = Assembly(example_fragments, limit=5, use_fragment_order=False)
+    print('Linear ===============')
+    for assembly in asm.get_linear_assemblies():
+        print(' ', assembly2str(assembly))
+    print('Circular =============')
+    for assembly in asm.get_circular_assemblies():
+        print(' ', assembly2str(assembly))
+
+    # Prints
+    Linear ===============
+        ('1[8:14]:2[1:7]', '2[10:17]:3[1:8]')
+        ('2[10:17]:3[1:8]', '3[12:17]:1[1:6]')
+        ('3[12:17]:1[1:6]', '1[8:14]:2[1:7]')
+        ('1[1:6]:3[12:17]',)
+        ('2[1:7]:1[8:14]',)
+        ('3[1:8]:2[10:17]',)
+    Circular =============
+        ('1[8:14]:2[1:7]', '2[10:17]:3[1:8]', '3[12:17]:1[1:6]')
+
+    """
+
+    def __init__(
+        self,
+        frags: list[_Dseqrecord],
+        limit: int = 25,
+        algorithm: AssemblyAlgorithmType = common_sub_strings,
+        use_fragment_order: bool = True,
+        use_all_fragments: bool = False,
+    ):
+        # TODO: allow for the same fragment to be included more than once?
+        self.G = _nx.MultiDiGraph()
+        # Add positive and negative nodes for forward and reverse fragments
+        self.G.add_nodes_from((i + 1, {"seq": f}) for (i, f) in enumerate(frags))
+        self.G.add_nodes_from(
+            (-(i + 1), {"seq": f.reverse_complement()}) for (i, f) in enumerate(frags)
+        )
+
+        # Iterate over all possible combinations of fragments
+        fragment_pairs = _itertools.combinations(
+            filter(lambda x: x > 0, self.G.nodes), 2
+        )
+        for i, j in fragment_pairs:
+            # All the relative orientations of the fragments in the pair
+            for u, v in _itertools.product([i, -i], [j, -j]):
+                u_seq = self.G.nodes[u]["seq"]
+                v_seq = self.G.nodes[v]["seq"]
+                matches = algorithm(u_seq, v_seq, limit)
+                for match in matches:
+                    self.add_edges_from_match(match, u, v, u_seq, v_seq)
+
+        self.fragments = frags
+        self.limit = limit
+        self.algorithm = algorithm
+        self.use_fragment_order = use_fragment_order
+        self.use_all_fragments = use_all_fragments
+
+        return
+
+    @classmethod
+    def assembly_is_valid(
+        cls,
+        fragments: list[_Dseqrecord | _Primer],
+        assembly: EdgeRepresentationAssembly,
+        is_circular: bool,
+        use_all_fragments: bool,
+        is_insertion: bool = False,
+    ) -> bool:
+        """
+        Returns True if the assembly is valid, False otherwise. See function comments for conditions tested.
+        """
+        if is_circular is None:
+            return False
+
+        # Linear assemblies may get begin-1-end, begin-2-end, these are removed here.
+        if len(assembly) == 0:
+            return False
+
+        if use_all_fragments and len(fragments) != len(
+            set(flatten(map(abs, e[:2]) for e in assembly))
+        ):
+            return False
+
+        # Here we check whether subsequent pairs of fragments are compatible, for instance:
+        # Compatible (overlap of 1 and 2 occurs before overlap of 2 and 3):
+        # (1,2,[2:9],[0:7]), (2,3,[12:19],[0:7])
+        #    -- A --
+        # 1 gtatcgtgt     -- B --
+        # 2   atcgtgtactgtcatattc
+        # 3               catattcaa
+        # Incompatible (overlap of 1 and 2 occurs after overlap of 2 and 3):
+        # (1,2,[2:9],[13:20]), (2,3,[0:7],[0:7])
+        #                 -- A --
+        #  1 -- B --    gtatcgtgt
+        #  2 catattcccccccatcgtgtactgt
+        #  3 catattcaa
+        # Redundant: overlap of 1 and 2 ends at the same spot as overlap of 2 and 3
+        # (1,2,[2:9],[1:8]), (2,3,[0:8],[0:8])
+        #    -- A --
+        #  gtatcgtgt
+        #   catcgtgtactgtcatattc
+        #   catcgtgtactgtcatattc
+        #   -- B ---
+        if is_circular:
+            # In a circular assembly, first and last fragment must be the same
+            if assembly[0][0] != assembly[-1][1]:
+                return False
+            edge_pairs = zip(assembly, assembly[1:] + assembly[:1])
+        else:
+            edge_pairs = zip(assembly, assembly[1:])
+
+        for (_u1, v1, _, start_location), (_u2, _v2, end_location, _) in edge_pairs:
+            # Incompatible as described in figure above
+            fragment = fragments[abs(v1) - 1]
+            if (
+                isinstance(fragment, _Primer) or not fragment.circular
+            ) and _location_boundaries(start_location)[1] >= _location_boundaries(
+                end_location
+            )[
+                1
+            ]:
+                return False
+
+        # Fragments are used only once
+        nodes_used = [
+            f[0]
+            for f in edge_representation2subfragment_representation(
+                assembly, is_circular or is_insertion
+            )
+        ]
+        if len(nodes_used) != len(set(map(abs, nodes_used))):
+            return False
+
+        return True
+
+    def add_edges_from_match(
+        self,
+        match: SequenceOverlap,
+        u: int,
+        v: int,
+        first: _Dseqrecord,
+        secnd: _Dseqrecord,
+    ):
+        """Add edges to the graph from a match returned by the `algorithm` function (see pydna.common_substrings). For
+        format of edges (see documentation of the Assembly class).
+
+        Matches are directional, because not all `algorithm` functions return the same match for (u,v) and (v,u). For example,
+        homologous recombination does but sticky end ligation does not. The function returns two edges:
+        - Fragments in the orientation they were passed, with locations of the match (u, v, loc_u, loc_v)
+        - Reverse complement of the fragments with inverted order, with flipped locations (-v, -u, flip(loc_v), flip(loc_u))/
+
+        """
+        x_start, y_start, length = match
+        if length == 0:
+            # Edge case, blunt ligation
+            locs = [SimpleLocation(x_start, x_start), SimpleLocation(y_start, y_start)]
+        else:
+            # We use shift_location with 0 to wrap origin-spanning features
+            locs = [
+                _shift_location(
+                    SimpleLocation(x_start, x_start + length), 0, len(first)
+                ),
+                _shift_location(
+                    SimpleLocation(y_start, y_start + length), 0, len(secnd)
+                ),
+            ]
+
+        # Flip the locations to get the reverse complement
+        rc_locs = [locs[0]._flip(len(first)), locs[1]._flip(len(secnd))]
+
+        # Unique id that identifies the edge in either orientation
+        uid = f"{u}{locs[0]}:{v}{locs[1]}"
+
+        combinations = (
+            (u, v, locs),
+            (-v, -u, rc_locs[::-1]),
+        )
+
+        for u, v, l in combinations:
+            self.G.add_edge(u, v, f"{u}{l[0]}:{v}{l[1]}", locations=l, uid=uid)
+
+    def format_assembly_edge(
+        self, graph_edge: tuple[int, int, str]
+    ) -> AssemblyEdgeType:
+        """Go from the (u, v, key) to the (u, v, locu, locv) format."""
+        u, v, key = graph_edge
+        locu, locv = self.G.get_edge_data(u, v, key)["locations"]
+        return u, v, locu, locv
+
+    def get_linear_assemblies(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[EdgeRepresentationAssembly]:
+        """Get linear assemblies, applying the constrains described in __init__, ensuring that paths represent
+        real assemblies (see assembly_is_valid). Subassemblies are removed (see remove_subassemblies).
+        """
+
+        # Copy the graph since we will add the begin and end mock nodes
+        G = _nx.MultiDiGraph(self.G)
+        G.add_nodes_from(["begin", "end"])
+
+        if self.use_fragment_order:
+            # Path must start with the first fragment and end with the last
+            G.add_edge("begin", 1)
+            G.add_edge("begin", -1)
+            G.add_edge(len(self.fragments), "end")
+            G.add_edge(-len(self.fragments), "end")
+        else:
+            for node in filter(lambda x: type(x) is int, G.nodes):
+                G.add_edge("begin", node)
+                G.add_edge(node, "end")
+
+        unique_linear_paths = self.get_unique_linear_paths(G)
+        possible_assemblies = self.get_possible_assembly_number(unique_linear_paths)
+        if possible_assemblies > max_assemblies:
+            raise ValueError(
+                f"Too many assemblies ({possible_assemblies} pre-validation) to assemble"
+            )
+
+        assemblies = sum(
+            map(lambda x: self.node_path2assembly_list(x, False), unique_linear_paths),
+            [],
+        )
+
+        out = [
+            a
+            for a in assemblies
+            if self.assembly_is_valid(self.fragments, a, False, self.use_all_fragments)
+        ]
+        if only_adjacent_edges:
+            out = [a for a in out if self.assembly_uses_only_adjacent_edges(a, False)]
+        return remove_subassemblies(out)
+
+    def node_path2assembly_list(
+        self, cycle: list[int], circular: bool
+    ) -> list[EdgeRepresentationAssembly]:
+        """Convert a node path in the format [1, 2, 3] (as returned by _nx.cycles.simple_cycles) to a list of all
+          possible assemblies.
+
+        There may be multiple assemblies for a given node path, if there are several edges connecting two nodes,
+        for example two overlaps between 1 and 2, and single overlap between 2 and 3 should return 3 assemblies.
+        """
+        combine = list()
+        pairing = (
+            zip(cycle, cycle[1:] + cycle[:1]) if circular else zip(cycle, cycle[1:])
+        )
+        for u, v in pairing:
+            combine.append([(u, v, key) for key in self.G[u][v]])
+        return [
+            tuple(map(self.format_assembly_edge, x))
+            for x in _itertools.product(*combine)
+        ]
+
+    def get_unique_linear_paths(
+        self, G_with_begin_end: _nx.MultiDiGraph, max_paths=10000
+    ) -> list[list[int]]:
+        """Get unique linear paths from the graph, removing those that contain the same node twice."""
+        # We remove the begin and end nodes, and get all paths without edges
+        # e.g. we will get [1, 2, 3] only once, even if multiple edges connect
+        # 1 and 2 or 2 and 3, by converting to DiGraph.
+
+        # Cutoff has a different meaning of what one would expect, see https://github.com/networkx/networkx/issues/2762
+        node_paths = [
+            x[1:-1]
+            for x in limit_iterator(
+                _nx.all_simple_paths(
+                    _nx.DiGraph(G_with_begin_end),
+                    "begin",
+                    "end",
+                    cutoff=(len(self.fragments) + 1),
+                ),
+                max_paths,
+            )
+        ]
+
+        # Remove those that contain the same node twice
+        node_paths = [x for x in node_paths if len(x) == len(set(map(abs, x)))]
+
+        if self.use_all_fragments:
+            node_paths = [x for x in node_paths if len(x) == len(self.fragments)]
+
+        # For each path, we check if there are reverse complement duplicates
+        # See: https://github.com/manulera/OpenCloning_backend/issues/160
+        unique_node_paths = list()
+        for p in node_paths:
+            if [-x for x in p[::-1]] not in unique_node_paths:
+                unique_node_paths.append(p)
+
+        return unique_node_paths
+
+    def get_possible_assembly_number(self, paths: list[list[int]]) -> int:
+        """
+        Get the number of possible assemblies from a list of node paths. Basically, for each path
+        passed as a list of integers / nodes, we calculate the number of paths possible connecting
+        the nodes in that order, given the graph (all the edges connecting them).
+        """
+        possibilities = 0
+        for path in paths:
+            this_path = 1
+            for u, v in zip(path, path[1:]):
+                if v in self.G[u]:
+                    this_path *= len(self.G[u][v])
+            possibilities += this_path
+        return possibilities
+
+    def get_circular_assemblies(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[EdgeRepresentationAssembly]:
+        """Get circular assemblies, applying the constrains described in __init__, ensuring that paths represent
+        real assemblies (see assembly_is_valid)."""
+        # The constrain of circular sequence is that the first node is the fragment with the smallest index in its initial orientation,
+        # this is ensured by the circular_permutation_min_abs function + the filter below
+        sorted_cycles = map(
+            circular_permutation_min_abs,
+            limit_iterator(
+                _nx.cycles.simple_cycles(self.G, length_bound=len(self.fragments)),
+                10000,
+            ),
+        )
+        sorted_cycles = filter(lambda x: x[0] > 0, sorted_cycles)
+        # cycles.simple_cycles returns lists [1,2,3] not assemblies, see self.cycle2circular_assemblies
+
+        # We apply constrains already here because sometimes the combinatorial explosion is too large
+        if self.use_all_fragments:
+            sorted_cycles = [c for c in sorted_cycles if len(c) == len(self.fragments)]
+
+        # Remove cycles with duplicates
+        sorted_cycles = [c for c in sorted_cycles if len(c) == len(set(map(abs, c)))]
+        possible_assembly_number = self.get_possible_assembly_number(
+            [c + c[:1] for c in sorted_cycles]
+        )
+        if possible_assembly_number > max_assemblies:
+            raise ValueError(
+                f"Too many assemblies ({possible_assembly_number} pre-validation) to assemble"
+            )
+
+        assemblies = sum(
+            map(lambda x: self.node_path2assembly_list(x, True), sorted_cycles), []
+        )
+
+        out = [
+            a
+            for a in assemblies
+            if self.assembly_is_valid(self.fragments, a, True, self.use_all_fragments)
+        ]
+        if only_adjacent_edges:
+            out = [a for a in out if self.assembly_uses_only_adjacent_edges(a, True)]
+        return out
+
+    def format_insertion_assembly(
+        self, assembly: EdgeRepresentationAssembly
+    ) -> EdgeRepresentationAssembly | None:
+        """Sorts the fragment representing a cycle so that they represent an insertion assembly if possible,
+        else returns None.
+
+        Here we check if one of the joins between fragments represents the edges of an insertion assembly
+        The fragment must be linear, and the join must be as indicated below
+
+        ```
+        --------         -------           Fragment 1
+            ||            ||
+            xxxxxxxx      ||               Fragment 2
+                  ||      ||
+                  oooooooooo               Fragment 3
+        ```
+        The above example will be [(1, 2, [4:6], [0:2]), (2, 3, [6:8], [0:2]), (3, 1, [8:10], [9:11)])]
+
+        These could be returned in any order by simple_cycles, so we sort the edges so that the first
+        and last `u` and `v` match the fragment that gets the insertion (1 in the example above).
+        """
+        edge_pair_index = list()
+
+        # Pair edges with one another
+        for i, ((_u1, v1, _, end_location), (_u2, _v2, start_location, _)) in enumerate(
+            zip(assembly, assembly[1:] + assembly[:1])
+        ):
+            fragment = self.fragments[abs(v1) - 1]
+            # Find the pair of edges that should be last and first  ((3, 1, [8:10], [9:11)]), (1, 2, [4:6], [0:2]) in
+            # the example above. Only one of the pairs of edges should satisfy this condition for the topology to make sense.
+            left_of_insertion = _location_boundaries(start_location)[0]
+            right_of_insertion = _location_boundaries(end_location)[0]
+            if not fragment.circular and (
+                right_of_insertion >= left_of_insertion
+                # The below condition is for single-site integration.
+                # The reason to use locations_overlap instead of equality is because the location might extend
+                # left of right. For example, let's take ACCGGTTT as homology arm for an integration:
+                #
+                # insert aaACCGGTTTccACCGGTTTtt
+                # genome aaACCGGTTTtt
+                #
+                # The locations of homology on the genome are [0:10] and [2:12], so not identical
+                # but they overlap.
+                or _locations_overlap(start_location, end_location, len(fragment))
+            ):
+                edge_pair_index.append(i)
+
+        if len(edge_pair_index) != 1:
+            return None
+
+        shift_by = (edge_pair_index[0] + 1) % len(assembly)
+        return assembly[shift_by:] + assembly[:shift_by]
+
+    def format_insertion_assembly_edge_case(
+        self, assembly: EdgeRepresentationAssembly
+    ) -> EdgeRepresentationAssembly:
+        """
+        Edge case from https://github.com/manulera/OpenCloning_backend/issues/329
+        """
+        same_assembly = assembly[:]
+
+        if len(assembly) != 2:
+            return same_assembly
+        ((f1, f2, loc_f1_1, loc_f2_1), (_f2, _f1, loc_f2_2, loc_f1_2)) = assembly
+
+        if f1 != _f1 or _f2 != f2:
+            return same_assembly
+
+        if loc_f2_1 == loc_f2_2 or loc_f1_2 == loc_f1_1:
+            return same_assembly
+
+        fragment1 = self.fragments[abs(f1) - 1]
+        fragment2 = self.fragments[abs(f2) - 1]
+
+        if not _locations_overlap(
+            loc_f1_1, loc_f1_2, len(fragment1)
+        ) or not _locations_overlap(loc_f2_2, loc_f2_1, len(fragment2)):
+            return same_assembly
+
+        # Sort to make compatible with insertion assembly
+        if _location_boundaries(loc_f1_1)[0] > _location_boundaries(loc_f1_2)[0]:
+            new_assembly = same_assembly[::-1]
+        else:
+            new_assembly = same_assembly[:]
+
+        ((f1, f2, loc_f1_1, loc_f2_1), (_f2, _f1, loc_f2_2, loc_f1_2)) = new_assembly
+
+        fragment1 = self.fragments[abs(f1) - 1]
+        if fragment1.circular:
+            return same_assembly
+        fragment2 = self.fragments[abs(f2) - 1]
+
+        # Extract boundaries
+        f2_1_start, _ = _location_boundaries(loc_f2_1)
+        f2_2_start, f2_2_end = _location_boundaries(loc_f2_2)
+        f1_1_start, _ = _location_boundaries(loc_f1_1)
+        f1_2_start, f1_2_end = _location_boundaries(loc_f1_2)
+
+        overlap_diff = len(fragment1[f1_1_start:f1_2_end]) - len(
+            fragment2[f2_1_start:f2_2_end]
+        )
+
+        if overlap_diff == 0:
+            assert False, "Overlap is 0"
+
+        if overlap_diff > 0:
+            new_loc_f1_1 = create_location(
+                f1_1_start, f1_2_start - overlap_diff, len(fragment1)
+            )
+            new_loc_f2_1 = create_location(f2_1_start, f2_2_start, len(fragment2))
+        else:
+            new_loc_f2_1 = create_location(
+                f2_1_start, f2_2_start + overlap_diff, len(fragment2)
+            )
+            new_loc_f1_1 = create_location(f1_1_start, f1_2_start, len(fragment1))
+
+        new_assembly = [
+            (f1, f2, new_loc_f1_1, new_loc_f2_1),
+            new_assembly[1],
+        ]
+
+        return new_assembly
+
+    def get_insertion_assemblies(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[EdgeRepresentationAssembly]:
+        """Assemblies that represent the insertion of a fragment or series of fragment inside a linear construct. For instance,
+        digesting CCCCGAATTCCCCGAATTC with EcoRI and inserting the fragment with two overhangs into the EcoRI site of AAAGAATTCAAA.
+        This is not so much meant for the use-case of linear fragments that represent actual linear fragments, but for linear
+        fragments that represent a genome region. This can then be used to simulate homologous recombination.
+        """
+        if only_adjacent_edges:
+            raise NotImplementedError(
+                "only_adjacent_edges not implemented for insertion assemblies"
+            )
+
+        cycles = limit_iterator(_nx.cycles.simple_cycles(self.G), 10000)
+
+        # We apply constrains already here because sometimes the combinatorial explosion is too large
+        if self.use_all_fragments:
+            cycles = [c for c in cycles if len(c) == len(self.fragments)]
+
+        # Remove cycles with duplicates
+        cycles = [c for c in cycles if len(c) == len(set(map(abs, c)))]
+
+        possible_assembly_number = self.get_possible_assembly_number(
+            [c + c[:1] for c in cycles]
+        )
+
+        if possible_assembly_number > max_assemblies:
+            raise ValueError(
+                f"Too many assemblies ({possible_assembly_number} pre-validation) to assemble"
+            )
+
+        # We find cycles first
+        iterator = limit_iterator(_nx.cycles.simple_cycles(self.G), 10000)
+        assemblies = sum(
+            map(lambda x: self.node_path2assembly_list(x, True), iterator), []
+        )
+        # We format the edge case
+        assemblies = [self.format_insertion_assembly_edge_case(a) for a in assemblies]
+        # We select those that contain exactly only one suitable edge
+        assemblies = [
+            b
+            for a in assemblies
+            if (b := self.format_insertion_assembly(a)) is not None
+        ]
+        # First fragment should be in the + orientation
+        assemblies = list(filter(lambda x: x[0][0] > 0, assemblies))
+        return [
+            a
+            for a in assemblies
+            if self.assembly_is_valid(
+                self.fragments, a, False, self.use_all_fragments, is_insertion=True
+            )
+        ]
+
+    def assemble_linear(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[_Dseqrecord]:
+        """Assemble linear constructs, from assemblies returned by self.get_linear_assemblies."""
+        assemblies = self.get_linear_assemblies(only_adjacent_edges, max_assemblies)
+        return [assemble(self.fragments, a) for a in assemblies]
+
+    def assemble_circular(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[_Dseqrecord]:
+        """Assemble circular constructs, from assemblies returned by self.get_circular_assemblies."""
+        assemblies = self.get_circular_assemblies(only_adjacent_edges, max_assemblies)
+        return [assemble(self.fragments, a) for a in assemblies]
+
+    def assemble_insertion(
+        self, only_adjacent_edges: bool = False
+    ) -> list[_Dseqrecord]:
+        """Assemble insertion constructs, from assemblies returned by self.get_insertion_assemblies."""
+        assemblies = self.get_insertion_assemblies(only_adjacent_edges)
+        return [assemble(self.fragments, a, is_insertion=True) for a in assemblies]
+
+    def get_locations_on_fragments(self) -> dict[int, dict[str, list[Location]]]:
+        """Get a dictionary where the keys are the nodes in the graph, and the values are dictionaries with keys
+        `left`, `right`, containing (for each fragment) the locations where the fragment is joined to another fragment on its left
+        and right side. The values in `left` and `right` are often the same, except in restriction-ligation with partial overlap enabled,
+        where we can end up with a situation like this:
+
+        GGTCTCCCCAATT and aGGTCTCCAACCAA as fragments
+
+        # Partial overlap in assembly 1[9:11]:2[8:10]
+        GGTCTCCxxAACCAA
+        CCAGAGGGGTTxxTT
+
+        # Partial overlap in 2[10:12]:1[7:9]
+        aGGTCTCCxxCCAATT
+        tCCAGAGGTTGGxxAA
+
+        Would return
+        {
+            1: {'left': [7:9], 'right': [9:11]},
+            2: {'left': [8:10], 'right': [10:12]},
+            -1: {'left': [2:4], 'right': [4:6]},
+            -2: {'left': [2:4], 'right': [4:6]}
+        }
+
+        """
+
+        locations_on_fragments = dict()
+        for node in self.G.nodes:
+            this_dict = {"left": list(), "right": list()}
+            for edge in self.G.edges(data=True):
+                for i, key in enumerate(["right", "left"]):
+                    if edge[i] == node:
+                        edge_location = edge[2]["locations"][i]
+                        if edge_location not in this_dict[key]:
+                            this_dict[key].append(edge_location)
+            this_dict["left"] = sorted(
+                this_dict["left"], key=lambda x: _location_boundaries(x)[0]
+            )
+            this_dict["right"] = sorted(
+                this_dict["right"], key=lambda x: _location_boundaries(x)[0]
+            )
+            locations_on_fragments[node] = this_dict
+
+        return locations_on_fragments
+
+    def assembly_uses_only_adjacent_edges(self, assembly, is_circular: bool) -> bool:
+        """
+        Check whether only adjacent edges within each fragment are used in the assembly. This is useful to check if a cut and ligate assembly is valid,
+        and prevent including partially digested fragments. For example, imagine the following fragment being an input for a digestion
+        and ligation assembly, where the enzyme cuts at the sites indicated by the vertical lines:
+
+        ```
+                 x       y       z
+          -------|-------|-------|---------
+        ```
+
+        We would only want assemblies that contain subfragments start-x, x-y, y-z, z-end, and not start-x, y-end, for instance.
+        The latter would indicate that the fragment was partially digested.
+        """
+
+        locations_on_fragments = self.get_locations_on_fragments()
+        for node in locations_on_fragments:
+            fragment_len = len(self.fragments[abs(node) - 1])
+            for side in ["left", "right"]:
+                locations_on_fragments[node][side] = gather_overlapping_locations(
+                    locations_on_fragments[node][side], fragment_len
+                )
+
+        allowed_location_pairs = dict()
+        for node in locations_on_fragments:
+            if not is_circular:
+                # We add the existing ends of the fragment
+                left = [(None,)] + locations_on_fragments[node]["left"]
+                right = locations_on_fragments[node]["right"] + [(None,)]
+
+            else:
+                # For circular assemblies, we add the first location at the end
+                # to allow for the last edge to be used
+                left = locations_on_fragments[node]["left"]
+                right = (
+                    locations_on_fragments[node]["right"][1:]
+                    + locations_on_fragments[node]["right"][:1]
+                )
+
+            pairs = list()
+            for pair in zip(left, right):
+                pairs += list(_itertools.product(*pair))
+            allowed_location_pairs[node] = pairs
+
+        fragment_assembly = edge_representation2subfragment_representation(
+            assembly, is_circular
+        )
+        for node, start_location, end_location in fragment_assembly:
+            if (start_location, end_location) not in allowed_location_pairs[node]:
+                return False
+        return True
+
+    def __repr__(self):
+        # https://pyformat.info
+        return _pretty_str(
+            "Assembly\n"
+            "fragments..: {sequences}\n"
+            "limit(bp)..: {limit}\n"
+            "G.nodes....: {nodes}\n"
+            "algorithm..: {al}".format(
+                sequences=" ".join("{}bp".format(len(x)) for x in self.fragments),
+                limit=self.limit,
+                nodes=self.G.order(),
+                al=self.algorithm.__name__,
+            )
+        )
+
+
+class PCRAssembly(Assembly):
+    """
+    An assembly that represents a PCR, where `fragments` is a list of primer, template, primer (in that order).
+    It always uses the `primer_template_overlap` algorithm and accepts the `mismatches` argument to indicate
+    the number of mismatches allowed in the overlap. Only supports substitution mismatches, not indels.
+    """
+
+    def __init__(self, frags: list[_Dseqrecord | _Primer], limit=25, mismatches=0):
+
+        value_error = ValueError(
+            "PCRAssembly assembly must be initialised with a list/tuple of primer, template, primer"
+        )
+        if len(frags) != 3:
+            raise value_error
+
+        # Validate the inputs: should be a series of primer, template, primer
+        wrong_fragment_class = (
+            not isinstance(frags[0], _Primer),
+            isinstance(frags[1], _Primer),
+            not isinstance(frags[2], _Primer),
+        )
+        if any(wrong_fragment_class):
+            raise value_error
+
+        # TODO: allow for the same fragment to be included more than once?
+        self.G = _nx.MultiDiGraph()
+        # Add positive and negative nodes for forward and reverse fragments
+        self.G.add_nodes_from((i + 1, {"seq": f}) for (i, f) in enumerate(frags))
+        self.G.add_nodes_from(
+            (-(i + 1), {"seq": f.reverse_complement()}) for (i, f) in enumerate(frags)
+        )
+
+        pairs = list()
+        primer_ids = list()
+        for i in range(0, len(frags), 3):
+            # primer, template, primer
+            p1, t, p2 = (i + 1, i + 2, i + 3)
+            primer_ids += [p1, p2]
+            pairs += list(_itertools.product([p1, p2], [t, -t]))
+            pairs += list(_itertools.product([t, -t], [-p1, -p2]))
+
+        for u, v in pairs:
+            u_seq = self.G.nodes[u]["seq"]
+            v_seq = self.G.nodes[v]["seq"]
+            matches = primer_template_overlap(u_seq, v_seq, limit, mismatches)
+            for match in matches:
+                self.add_edges_from_match(match, u, v, u_seq, v_seq)
+
+        # These two are constrained
+        self.use_fragment_order = False
+        self.use_all_fragments = True
+
+        self.fragments = frags
+        self.limit = limit
+        self.algorithm = primer_template_overlap
+
+        return
+
+    def get_linear_assemblies(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[EdgeRepresentationAssembly]:
+        if only_adjacent_edges:
+            raise NotImplementedError(
+                "only_adjacent_edges not implemented for PCR assemblies"
+            )
+
+        return super().get_linear_assemblies(max_assemblies=max_assemblies)
+
+    def get_circular_assemblies(self, only_adjacent_edges: bool = False):
+        raise NotImplementedError(
+            "get_circular_assemblies not implemented for PCR assemblies"
+        )
+
+    def get_insertion_assemblies(self, only_adjacent_edges: bool = False):
+        raise NotImplementedError(
+            "get_insertion_assemblies not implemented for PCR assemblies"
+        )
+
+
+class SingleFragmentAssembly(Assembly):
+    """
+    An assembly that represents the circularisation or splicing of a single fragment.
+    """
+
+    def __init__(self, frags: [_Dseqrecord], limit=25, algorithm=common_sub_strings):
+
+        if len(frags) != 1:
+            raise ValueError(
+                "SingleFragmentAssembly assembly must be initialised with a single fragment"
+            )
+        # TODO: allow for the same fragment to be included more than once?
+        self.G = _nx.MultiDiGraph()
+        frag = frags[0]
+        # Add positive and negative nodes for forward and reverse fragments
+        self.G.add_node(1, seq=frag)
+
+        matches = algorithm(frag, frag, limit)
+        for match in matches:
+            self.add_edges_from_match(match, 1, 1, frag, frag)
+
+        # To avoid duplicated outputs
+        self.G.remove_edges_from([(-1, -1)])
+
+        # These two are constrained
+        self.use_fragment_order = True
+        self.use_all_fragments = True
+
+        self.fragments = frags
+        self.limit = limit
+        self.algorithm = algorithm
+
+        return
+
+    def get_circular_assemblies(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[EdgeRepresentationAssembly]:
+        # We don't want the same location twice
+        assemblies = filter(
+            lambda x: x[0][2] != x[0][3],
+            super().get_circular_assemblies(only_adjacent_edges, max_assemblies),
+        )
+        return [
+            a
+            for a in assemblies
+            if self.assembly_is_valid(self.fragments, a, True, self.use_all_fragments)
+        ]
+
+    def get_insertion_assemblies(
+        self, only_adjacent_edges: bool = False, max_assemblies: int = 50
+    ) -> list[EdgeRepresentationAssembly]:
+        """This could be renamed splicing assembly, but the essence is similar"""
+
+        if only_adjacent_edges:
+            raise NotImplementedError(
+                "only_adjacent_edges not implemented for insertion assemblies"
+            )
+
+        def splicing_assembly_filter(x):
+            # We don't want the same location twice
+            if x[0][2] == x[0][3]:
+                return False
+            # We don't want to get overlap only (e.g. GAATTCcatGAATTC giving GAATTC)
+            left_start, _ = _location_boundaries(x[0][2])
+            _, right_end = _location_boundaries(x[0][3])
+            if left_start == 0 and right_end == len(self.fragments[0]):
+                return False
+            return True
+
+        # We don't want the same location twice
+        assemblies = filter(
+            splicing_assembly_filter,
+            super().get_insertion_assemblies(max_assemblies=max_assemblies),
+        )
+        return [
+            a
+            for a in assemblies
+            if self.assembly_is_valid(
+                self.fragments, a, False, self.use_all_fragments, is_insertion=True
+            )
+        ]
+
+    def get_linear_assemblies(self):
+        raise NotImplementedError("Linear assembly does not make sense")
+
+
+def common_function_assembly_products(
+    frags: list[_Dseqrecord],
+    limit: int | None,
+    algorithm: Callable,
+    circular_only: bool,
+    filter_results_function: Callable | None = None,
+) -> list[_Dseqrecord]:
+    """Common function to avoid code duplication. Could be simplified further
+    once SingleFragmentAssembly and Assembly are merged.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    limit : int or None
+        Minimum overlap length required, or None if not applicable
+    algorithm : Callable
+        Function that determines valid overlaps between fragments
+    circular_only : bool
+        If True, only return circular assemblies
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+    """
+    if len(frags) == 1:
+        asm = SingleFragmentAssembly(frags, limit, algorithm)
+    else:
+        asm = Assembly(
+            frags, limit, algorithm, use_fragment_order=False, use_all_fragments=True
+        )
+    output_assemblies = asm.get_circular_assemblies()
+    if not circular_only and len(frags) > 1:
+        output_assemblies += filter_linear_subassemblies(
+            asm.get_linear_assemblies(), output_assemblies, frags
+        )
+    if not circular_only and len(frags) == 1:
+        output_assemblies += asm.get_insertion_assemblies()
+
+    if filter_results_function:
+        output_assemblies = [a for a in output_assemblies if filter_results_function(a)]
+
+    return [assemble(frags, a) for a in output_assemblies]
+
+
+def gibson_assembly(
+    frags: list[_Dseqrecord], limit: int = 25, circular_only: bool = False
+) -> list[_Dseqrecord]:
+    """Returns the products for Gibson assembly.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    limit : int, optional
+        Minimum overlap length required, by default 25
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+    """
+    return common_function_assembly_products(
+        frags, limit, gibson_overlap, circular_only
+    )
+
+
+def in_fusion_assembly(
+    frags: list[_Dseqrecord], limit: int = 25, circular_only: bool = False
+) -> list[_Dseqrecord]:
+    """Returns the products for in-fusion assembly. This is the same as Gibson
+    assembly, but with a different name.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    limit : int, optional
+        Minimum overlap length required, by default 25
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+    """
+    return gibson_assembly(frags, limit)
+
+
+def fusion_pcr_assembly(
+    frags: list[_Dseqrecord], limit: int = 25, circular_only: bool = False
+) -> list[_Dseqrecord]:
+    """Returns the products for fusion PCR assembly. This is the same as Gibson
+    assembly, but with a different name.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    limit : int, optional
+        Minimum overlap length required, by default 25
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+    """
+    return gibson_assembly(frags, limit)
+
+
+def in_vivo_assembly(
+    frags: list[_Dseqrecord], limit: int = 25, circular_only: bool = False
+) -> list[_Dseqrecord]:
+    """Returns the products for in vivo assembly (IVA), which relies on homologous recombination between the fragments.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    limit : int, optional
+        Minimum overlap length required, by default 25
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+    """
+    return common_function_assembly_products(
+        frags, limit, common_sub_strings, circular_only
+    )
+
+
+def restriction_ligation_assembly(
+    frags: list[_Dseqrecord],
+    enzymes: list["_AbstractCut"],
+    allow_blunt: bool = True,
+    circular_only: bool = False,
+) -> list[_Dseqrecord]:
+    """Returns the products for restriction ligation assembly:
+    * Finds cutsites in the fragments
+    * Finds all products that could be assembled by ligating the fragments based on those cutsites
+    * Will NOT return products that combine an existing end with an end generated by the same enzyme (see example below)
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    enzymes : list[_AbstractCut]
+        List of restriction enzymes to use
+    allow_blunt : bool, optional
+        If True, allow blunt end ligations, by default True
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+
+    Examples
+    --------
+    In the example below, we plan to assemble a plasmid from a backbone and an insert, using the EcoRI and SalI enzymes.
+    Note how 2 circular products are returned, one contains the insert (`acgt`)
+    and the desired part of the backbone (`cccccc`), the other contains the
+    reversed insert (`tgga`) and the cut-out part of the backbone (`aaa`).
+
+    >>> from pydna.assembly2 import restriction_ligation_assembly
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from Bio.Restriction import EcoRI, SalI
+    >>> backbone = Dseqrecord("cccGAATTCaaaGTCGACccc", circular=True)
+    >>> insert = Dseqrecord("ggGAATTCaggtGTCGACgg")
+    >>> products = restriction_ligation_assembly([backbone, insert], [EcoRI, SalI], circular_only=True)
+    >>> products[0].seq
+    Dseq(o22)
+    TCGACccccccGAATTCaggtG
+    AGCTGggggggCTTAAGtccaC
+    >>> products[1].seq
+    Dseq(o19)
+    AATTCaaaGTCGACacctG
+    TTAAGtttCAGCTGtggaC
+
+    Note that passing a pre-cut fragment will not work.
+
+    >>> restriction_products = insert.cut([EcoRI, SalI])
+    >>> cut_insert = restriction_products[1]
+    >>> restriction_ligation_assembly([backbone, cut_insert], [EcoRI, SalI], circular_only=True)
+    []
+
+    It also works with a single fragment, for circularization:
+
+    >>> seq = Dseqrecord("GAATTCaaaGAATTC")
+    >>> products =restriction_ligation_assembly([seq], [EcoRI])
+    >>> products[0].seq
+    Dseq(o9)
+    AATTCaaaG
+    TTAAGtttC
+    """
+
+    def algo(x, y, _l):
+        # By default, we allow blunt ends
+        return restriction_ligation_overlap(x, y, enzymes, False, allow_blunt)
+
+    return common_function_assembly_products(frags, None, algo, circular_only)
+
+
+def golden_gate_assembly(
+    frags: list[_Dseqrecord],
+    enzymes: list["_AbstractCut"],
+    allow_blunt: bool = True,
+    circular_only: bool = False,
+) -> list[_Dseqrecord]:
+    """Returns the products for Golden Gate assembly. This is the same as
+    restriction ligation assembly, but with a different name. Check the documentation
+    for `restriction_ligation_assembly` for more details.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    enzymes : list[_AbstractCut]
+        List of restriction enzymes to use
+    allow_blunt : bool, optional
+        If True, allow blunt end ligations, by default True
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+
+    Examples
+    --------
+    See the example for `restriction_ligation_assembly`.
+    """
+    return restriction_ligation_assembly(frags, enzymes, allow_blunt, circular_only)
+
+
+def ligation_assembly(
+    frags: list[_Dseqrecord],
+    allow_blunt: bool = False,
+    allow_partial_overlap: bool = False,
+    circular_only: bool = False,
+) -> list[_Dseqrecord]:
+    """Returns the products for ligation assembly, as inputs pass the fragments (digested if needed) that
+    will be ligated.
+
+    For most cases, you probably should use `restriction_ligation_assembly` instead.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    allow_blunt : bool, optional
+        If True, allow blunt end ligations, by default False
+    allow_partial_overlap : bool, optional
+        If True, allow partial overlaps between sticky ends, by default False
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+
+
+    Examples
+    --------
+    In the example below, we plan to assemble a plasmid from a backbone and an insert,
+    using the EcoRI enzyme. The insert and insertion site in the backbone are flanked by
+    EcoRI sites, so there are two possible products depending on the orientation of the insert.
+
+    >>> from pydna.assembly2 import ligation_assembly
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from Bio.Restriction import EcoRI
+    >>> backbone = Dseqrecord("cccGAATTCaaaGAATTCccc", circular=True)
+    >>> backbone_cut = backbone.cut(EcoRI)[1]
+    >>> insert = Dseqrecord("ggGAATTCaggtGAATTCgg")
+    >>> insert_cut = insert.cut(EcoRI)[1]
+    >>> products = ligation_assembly([backbone_cut, insert_cut])
+    >>> products[0].seq
+    Dseq(o22)
+    AATTCccccccGAATTCaggtG
+    TTAAGggggggCTTAAGtccaC
+    >>> products[1].seq
+    Dseq(o22)
+    AATTCccccccGAATTCacctG
+    TTAAGggggggCTTAAGtggaC
+    """
+
+    def sticky_end_algorithm(x, y, _l):
+        return sticky_end_sub_strings(x, y, allow_partial_overlap)
+
+    if allow_blunt:
+        algo = combine_algorithms(sticky_end_algorithm, blunt_overlap)
+    else:
+        algo = sticky_end_algorithm
+
+    return common_function_assembly_products(frags, None, algo, circular_only)
+
+
+def assembly_is_multi_site(asm: list[EdgeRepresentationAssembly]) -> bool:
+    """Returns True if the assembly is a multi-site assembly, False otherwise."""
+
+    if len(asm) < 2:
+        return False
+
+    is_cycle = asm[0][1] == asm[-1][0]
+    asm2 = edge_representation2subfragment_representation(asm, is_cycle)
+
+    return all(f[1] != f[2] for f in asm2)
+
+
+def gateway_assembly(
+    frags: list[_Dseqrecord],
+    reaction_type: str,
+    greedy: bool = False,
+    circular_only: bool = False,
+    multi_site_only: bool = False,
+) -> list[_Dseqrecord]:
+    """Returns the products for Gateway assembly / Gateway cloning.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to assemble
+    reaction_type : str
+        Type of Gateway reaction, either 'BP' or 'LR'
+    greedy : bool, optional
+        If True, use greedy gateway consensus sites, by default False
+    circular_only : bool, optional
+        If True, only return circular assemblies, by default False
+    multi_site_only : bool, optional
+        If True, only return products that where 2 sites recombined. Even if input sequences
+        contain multiple att sites (typically 2), a product could be generated where only one
+        site recombines. That's typically not what you want, so you can set this to True to
+        only return products where both att sites recombined.
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of assembled DNA molecules
+
+
+    Examples
+    --------
+
+    Below an example with dummy Gateway sequences, composed with minimal sequences and the consensus
+    att sites.
+
+    >>> from pydna.assembly2 import gateway_assembly
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> attB1 = "ACAACTTTGTACAAAAAAGCAGAAG"
+    >>> attP1 = "AAAATAATGATTTTATTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGAACGAGAAGCGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTA"
+    >>> attR1 = "ACAACTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATG"
+    >>> attL1 = "CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGCAGGCT"
+    >>> seq1 = Dseqrecord("aaa" + attB1 + "ccc")
+    >>> seq2 = Dseqrecord("aaa" + attP1 + "ccc")
+    >>> seq3 = Dseqrecord("aaa" + attR1 + "ccc")
+    >>> seq4 = Dseqrecord("aaa" + attL1 + "ccc")
+    >>> products_BP = gateway_assembly([seq1, seq2], "BP")
+    >>> products_LR = gateway_assembly([seq3, seq4], "LR")
+    >>> len(products_BP)
+    2
+    >>> len(products_LR)
+    2
+
+    Now let's understand the `multi_site_only` parameter. Let's consider a case where we are swapping fragments
+    between two plasmids using an LR reaction. Experimentally, we expect to obtain two plasmids, resulting from the
+    swapping between the two att sites. That's what we get if we set `multi_site_only` to True.
+
+    >>> attL2 = 'aaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgctttcttataatgccaactttgtacaagaaagctg'
+    >>> attR2 = 'accactttgtacaagaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatg'
+    >>> insert = Dseqrecord("cccccc" + attL1 + "ccc" + attL2 + "cccccc", circular=True)
+    >>> backbone = Dseqrecord("ttttt" + attR1 + "aaa" + attR2, circular=True)
+    >>> products = gateway_assembly([insert, backbone], "LR", multi_site_only=True)
+    >>> len(products)
+    2
+
+    However, if we set `multi_site_only` to False, we get 4 products, which also include the intermediate products
+    where the two plasmids are combined into a single one through recombination of a single att site. This is an
+    intermediate of the reaction, and typically we don't want it:
+
+    >>> products = gateway_assembly([insert, backbone], "LR", multi_site_only=False)
+    >>> print([len(p) for p in products])
+    [469, 237, 232, 469]
+
+
+    """
+
+    if reaction_type not in ["BP", "LR"]:
+        raise ValueError(
+            f"Invalid reaction type: {reaction_type}, can only be BP or LR"
+        )
+
+    def algo(x, y, _l):
+        return gateway_overlap(x, y, reaction_type, greedy)
+
+    filter_results_function = None if not multi_site_only else assembly_is_multi_site
+
+    products = common_function_assembly_products(
+        frags, None, algo, circular_only, filter_results_function
+    )
+
+    if len(products) == 0:
+        # Build a list of all the sites in the fragments
+        sites_in_fragments = list()
+        for frag in frags:
+            sites_in_fragments.append(list(find_gateway_sites(frag, greedy).keys()))
+        formatted_strings = [
+            f'fragment {i + 1}: {", ".join(sites)}'
+            for i, sites in enumerate(sites_in_fragments)
+        ]
+        raise ValueError(
+            f"Inputs are not compatible for {reaction_type} reaction.\n\n"
+            + "\n".join(formatted_strings),
+        )
+    return products
+
+
+def common_function_integration_products(
+    frags: list[_Dseqrecord], limit: int | None, algorithm: Callable
+) -> list[_Dseqrecord]:
+    """Common function to avoid code duplication for integration products.
+
+    Parameters
+    ----------
+    frags : list[_Dseqrecord]
+        List of DNA fragments to integrate
+    limit : int or None
+        Minimum overlap length required, or None if not applicable
+    algorithm : Callable
+        Function that determines valid overlaps between fragments
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of integrated DNA molecules
+    """
+    if len(frags) == 1:
+        asm = SingleFragmentAssembly(frags, limit, algorithm)
+    else:
+        asm = Assembly(
+            frags, limit, algorithm, use_fragment_order=False, use_all_fragments=True
+        )
+
+    if frags[0].circular:
+        raise ValueError(
+            "Genome must be linear for integration assembly, use in vivo assembly instead"
+        )
+
+    # We only want insertions in the genome (first fragment)
+    output_assemblies = [a for a in asm.get_insertion_assemblies() if a[0][0] == 1]
+    return [assemble(frags, a, True) for a in output_assemblies]
+
+
+def common_handle_insertion_fragments(
+    genome: _Dseqrecord, inserts: list[_Dseqrecord]
+) -> list[_Dseqrecord]:
+    """Common function to handle / validate insertion fragments.
+
+    Parameters
+    ----------
+    genome : _Dseqrecord
+        Target genome sequence
+    inserts : list[_Dseqrecord] or _Dseqrecord
+        DNA fragment(s) to insert
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List containing genome and insert fragments
+    """
+    if not isinstance(genome, _Dseqrecord):
+        raise ValueError("Genome must be a Dseqrecord object")
+
+    if not isinstance(inserts, list) or not all(
+        isinstance(f, _Dseqrecord) for f in inserts
+    ):
+        raise ValueError("Inserts must be a list of Dseqrecord objects")
+
+    if len(inserts) == 0:
+        raise ValueError("Inserts must be a non-empty list of Dseqrecord objects")
+
+    return [genome] + inserts
+
+
+def common_function_excision_products(
+    genome: _Dseqrecord, limit: int | None, algorithm: Callable
+) -> list[_Dseqrecord]:
+    """Common function to avoid code duplication for excision products.
+
+    Parameters
+    ----------
+    genome : _Dseqrecord
+        Target genome sequence
+    limit : int or None
+        Minimum overlap length required, or None if not applicable
+    algorithm : Callable
+        Function that determines valid overlaps between fragments
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of excised DNA molecules
+    """
+    asm = SingleFragmentAssembly([genome], limit, algorithm)
+    return asm.assemble_circular() + asm.assemble_insertion()
+
+
+def homologous_recombination_integration(
+    genome: _Dseqrecord,
+    inserts: list[_Dseqrecord],
+    limit: int = 40,
+) -> list[_Dseqrecord]:
+    """Returns the products resulting from the integration of an insert (or inserts joined
+    through in vivo recombination) into the genome through homologous recombination.
+
+    Parameters
+    ----------
+    genome : _Dseqrecord
+        Target genome sequence
+    inserts : list[_Dseqrecord]
+        DNA fragment(s) to insert
+    limit : int, optional
+        Minimum homology length required, by default 40
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of integrated DNA molecules
+
+
+    Examples
+    --------
+
+    Below an example with a single insert.
+
+    >>> from pydna.assembly2 import homologous_recombination_integration
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> homology = "AAGTCCGTTCGTTTTACCTG"
+    >>> genome = Dseqrecord(f"aaaaaa{homology}ccccc{homology}aaaaaa")
+    >>> insert = Dseqrecord(f"{homology}gggg{homology}")
+    >>> products = homologous_recombination_integration(genome, [insert], 20)
+    >>> str(products[0].seq)
+    'aaaaaaAAGTCCGTTCGTTTTACCTGggggAAGTCCGTTCGTTTTACCTGaaaaaa'
+
+    Below an example with two inserts joined through homology.
+
+    >>> homology2 = "ATTACAGCATGGGAAGAAAGA"
+    >>> insert_1 = Dseqrecord(f"{homology}gggg{homology2}")
+    >>> insert_2 = Dseqrecord(f"{homology2}cccc{homology}")
+    >>> products = homologous_recombination_integration(genome, [insert_1, insert_2], 20)
+    >>> str(products[0].seq)
+    'aaaaaaAAGTCCGTTCGTTTTACCTGggggATTACAGCATGGGAAGAAAGAccccAAGTCCGTTCGTTTTACCTGaaaaaa'
+    """
+    fragments = common_handle_insertion_fragments(genome, inserts)
+
+    return common_function_integration_products(fragments, limit, common_sub_strings)
+
+
+def homologous_recombination_excision(
+    genome: _Dseqrecord, limit: int = 40
+) -> list[_Dseqrecord]:
+    """Returns the products resulting from the excision of a fragment from the genome through
+    homologous recombination.
+
+    Parameters
+    ----------
+    genome : _Dseqrecord
+        Target genome sequence
+    limit : int, optional
+        Minimum homology length required, by default 40
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List containing excised plasmid and remaining genome sequence
+
+    Examples
+    --------
+
+    Example of a homologous recombination event, where a plasmid is excised from the
+    genome (circular sequence of 25 bp), and that part is removed from the genome,
+    leaving a shorter linear sequence (32 bp).
+
+    >>> from pydna.assembly2 import homologous_recombination_excision
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> homology = "AAGTCCGTTCGTTTTACCTG"
+    >>> genome = Dseqrecord(f"aaaaaa{homology}ccccc{homology}aaaaaa")
+    >>> products = homologous_recombination_excision(genome, 20)
+    >>> products
+    [Dseqrecord(o25), Dseqrecord(-32)]
+    """
+    return common_function_excision_products(genome, limit, common_sub_strings)
+
+
+def cre_lox_integration(
+    genome: _Dseqrecord, inserts: list[_Dseqrecord]
+) -> list[_Dseqrecord]:
+    """Returns the products resulting from the integration of an insert (or inserts joined
+    through cre-lox recombination among them) into the genome through cre-lox integration.
+
+    Also works with lox66 and lox71 (see `pydna.cre_lox` for more details).
+
+    Parameters
+    ----------
+    genome : _Dseqrecord
+        Target genome sequence
+    inserts : list[_Dseqrecord] or _Dseqrecord
+        DNA fragment(s) to insert
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List of integrated DNA molecules
+
+    Examples
+    --------
+
+    Below an example of reversible integration and excision.
+
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from pydna.assembly2 import cre_lox_integration, cre_lox_excision
+    >>> from pydna.cre_lox import LOXP_SEQUENCE
+    >>> a = Dseqrecord(f"cccccc{LOXP_SEQUENCE}aaaaa")
+    >>> b = Dseqrecord(f"{LOXP_SEQUENCE}bbbbb", circular=True)
+    >>> [a, b]
+    [Dseqrecord(-45), Dseqrecord(o39)]
+    >>> res = cre_lox_integration(a, [b])
+    >>> res
+    [Dseqrecord(-84)]
+    >>> res2 = cre_lox_excision(res[0])
+    >>> res2
+    [Dseqrecord(o39), Dseqrecord(-45)]
+
+    Below an example with lox66 and lox71 (irreversible integration).
+    Here, the result of excision is still returned because there is a low
+    probability of it happening, but it's considered a rare event.
+
+    >>> lox66 = 'ATAACTTCGTATAGCATACATTATACGAACGGTA'
+    >>> lox71 = 'TACCGTTCGTATAGCATACATTATACGAAGTTAT'
+    >>> a = Dseqrecord(f"cccccc{lox66}aaaaa")
+    >>> b = Dseqrecord(f"{lox71}bbbbb", circular=True)
+    >>> res = cre_lox_integration(a, [b])
+    >>> res
+    [Dseqrecord(-84)]
+    >>> res2 = cre_lox_excision(res[0])
+    >>> res2
+    [Dseqrecord(o39), Dseqrecord(-45)]
+
+    """
+    fragments = common_handle_insertion_fragments(genome, inserts)
+    return common_function_integration_products(fragments, None, cre_loxP_overlap)
+
+
+def cre_lox_excision(genome: _Dseqrecord) -> list[_Dseqrecord]:
+    """Returns the products for CRE-lox excision.
+
+    Parameters
+    ----------
+    genome : _Dseqrecord
+        Target genome sequence
+
+    Returns
+    -------
+    list[_Dseqrecord]
+        List containing excised plasmid and remaining genome sequence
+
+    Examples
+    --------
+
+    Below an example of reversible integration and excision.
+
+    >>> from pydna.dseqrecord import Dseqrecord
+    >>> from pydna.assembly2 import cre_lox_integration, cre_lox_excision
+    >>> from pydna.cre_lox import LOXP_SEQUENCE
+    >>> a = Dseqrecord(f"cccccc{LOXP_SEQUENCE}aaaaa")
+    >>> b = Dseqrecord(f"{LOXP_SEQUENCE}bbbbb", circular=True)
+    >>> [a, b]
+    [Dseqrecord(-45), Dseqrecord(o39)]
+    >>> res = cre_lox_integration(a, [b])
+    >>> res
+    [Dseqrecord(-84)]
+    >>> res2 = cre_lox_excision(res[0])
+    >>> res2
+    [Dseqrecord(o39), Dseqrecord(-45)]
+
+    Below an example with lox66 and lox71 (irreversible integration).
+    Here, the result of excision is still returned because there is a low
+    probability of it happening, but it's considered a rare event.
+
+    >>> lox66 = 'ATAACTTCGTATAGCATACATTATACGAACGGTA'
+    >>> lox71 = 'TACCGTTCGTATAGCATACATTATACGAAGTTAT'
+    >>> a = Dseqrecord(f"cccccc{lox66}aaaaa")
+    >>> b = Dseqrecord(f"{lox71}bbbbb", circular=True)
+    >>> res = cre_lox_integration(a, [b])
+    >>> res
+    [Dseqrecord(-84)]
+    >>> res2 = cre_lox_excision(res[0])
+    >>> res2
+    [Dseqrecord(o39), Dseqrecord(-45)]
+    """
+    return common_function_excision_products(genome, None, cre_loxP_overlap)