@teselagen/sequence-utils 0.3.30 → 0.3.32-beta.1

package/mapAnnotationsToRows.d.ts

@@ -1,3 +1 @@
-export default function mapAnnotationsToRows(annotations: any, sequenceLength: any, bpsPerRow: any, { splitForwardReverse }?: {
-    splitForwardReverse: any;
-}): {};
+export default function mapAnnotationsToRows(annotations: any, sequenceLength: any, bpsPerRow: any, { splitForwardReverse }?: {}): {};

package/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@teselagen/sequence-utils",
-  "version": "0.3.30",
+  "version": "0.3.32-beta.1",
   "type": "module",
   "dependencies": {
     "escape-string-regexp": "5.0.0",

package/src/adjustBpsToReplaceOrInsert.test.js

@@ -1,6 +1,6 @@
 //tnr: half finished test.
 
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 
 import adjustBpsToReplaceOrInsert from "./adjustBpsToReplaceOrInsert";

package/src/cutSequenceByRestrictionEnzyme.test.js

@@ -1,6 +1,6 @@
 /* eslint-disable no-unused-expressions */
 
-import chai from "chai";
+import * as chai from "chai";
 import cutSequenceByRestrictionEnzyme from "./cutSequenceByRestrictionEnzyme.js";
 import enzymeList from "./aliasedEnzymesByName";
 

package/src/deleteSequenceDataAtRange.test.js

@@ -1,6 +1,6 @@
 //tnr: half finished test.
 
-import chai from "chai";
+import * as chai from "chai";
 
 import { getRangeLength } from "@teselagen/range-utils";
 import { cloneDeep } from "lodash-es";

package/src/diffUtils.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import assert from "assert";
 import { map } from "lodash-es";
 import tidyUpSequenceData from "./tidyUpSequenceData";

package/src/doesEnzymeChopOutsideOfRecognitionSite.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import doesEnzymeChopOutsideOfRecognitionSite from "./doesEnzymeChopOutsideOfRecognitionSite.js";
 import enzymeList from "./aliasedEnzymesByName";
 

package/src/filterSequenceString.test.js

@@ -1,5 +1,4 @@
 import filterSequenceString from "./filterSequenceString";
-import { expect } from "vitest";
 
 describe("filterSequenceString", () => {
   it("should not filter u's and should convert t's to u's from isOligo=true seqs", () => {

package/src/findApproxMatches.js

@@ -0,0 +1,50 @@
+/**
+ * Find approximate matches of a search sequence within a target sequence
+ *
+ * @param {string} searchSeq - The sequence to search for
+ * @param {string} targetSeq - The sequence to search within
+ * @param {number} maxMismatches - Maximum number of mismatches allowed
+ * @param {boolean} circular - Whether to treat the target sequence as circular (default: false)
+ * @returns {Array} - Array of objects containing { index, match, mismatchPositions }
+ */
+export default function findApproxMatches(
+  searchSeq,
+  targetSeq,
+  maxMismatches,
+  circular = false
+) {
+  const matches = [];
+  const lenA = searchSeq.length;
+  const lenB = targetSeq.length;
+
+  // Extend targetSeq to simulate circularity, in case circular = true
+  const targetSeqExtended = circular
+    ? targetSeq + targetSeq.slice(0, lenA - 1)
+    : targetSeq;
+  const limit = circular ? lenB : lenB - lenA + 1;
+
+  for (let i = 0; i < limit; i++) {
+    const window = targetSeqExtended.slice(i, i + lenA);
+    let mismatchCount = 0;
+    const mismatchPositions = [];
+
+    for (let j = 0; j < lenA; j++) {
+      if (searchSeq[j] !== window[j]) {
+        mismatchPositions.push(j);
+        mismatchCount++;
+        if (mismatchCount > maxMismatches) break;
+      }
+    }
+
+    if (mismatchCount <= maxMismatches) {
+      matches.push({
+        index: i,
+        match: window,
+        mismatchPositions,
+        numMismatches: mismatchPositions.length // Keep for backwards compatibility
+      });
+    }
+  }
+
+  return matches;
+}

package/src/findApproxMatches.test.js

@@ -0,0 +1,126 @@
+import findApproxMatches from "./findApproxMatches";
+
+describe("findApproxMatches", () => {
+  it("returns exact matches with maxMismatches=0", () => {
+    // Test with DNA sequence
+    expect(findApproxMatches("ATG", "GATGC", 0)).toEqual([
+      { index: 1, match: "ATG", mismatchPositions: [], numMismatches: 0 }
+    ]);
+
+    // Test with no matches
+    expect(findApproxMatches("ATG", "GCCTA", 0)).toEqual([]);
+  });
+
+  it("finds matches with allowed mismatches", () => {
+    // One mismatch allowed, one actual mismatch
+    expect(findApproxMatches("ATG", "ACTG", 1)).toEqual([
+      { index: 1, match: "CTG", mismatchPositions: [0], numMismatches: 1 }
+    ]);
+
+    // Two mismatches allowed, two actual mismatches
+    expect(findApproxMatches("ATGC", "ACGA", 2)).toEqual([
+      { index: 0, match: "ACGA", mismatchPositions: [1, 3], numMismatches: 2 }
+    ]);
+
+    // Multiple matches with mismatches
+    expect(findApproxMatches("AGT", "AGTCAATAGTAAGTG", 1)).toEqual([
+      { index: 0, match: "AGT", mismatchPositions: [], numMismatches: 0 },
+      { index: 4, match: "AAT", mismatchPositions: [1], numMismatches: 1 },
+      { index: 7, match: "AGT", mismatchPositions: [], numMismatches: 0 },
+      { index: 11, match: "AGT", mismatchPositions: [], numMismatches: 0 }
+    ]);
+  });
+
+  it("respects the maximum mismatch threshold", () => {
+    // Three mismatches are too many when max is 2
+    expect(findApproxMatches("ATGC", "ACAA", 2)).toEqual([]);
+
+    // Three mismatches are allowed when max is 3
+    expect(findApproxMatches("ATGC", "ACAA", 3)).toEqual([
+      {
+        index: 0,
+        match: "ACAA",
+        mismatchPositions: [1, 2, 3],
+        numMismatches: 3
+      }
+    ]);
+  });
+
+  it("handles circular sequences correctly", () => {
+    // Non-circular sequence
+    expect(findApproxMatches("ATG", "TGA", 0, false)).toEqual([]);
+
+    // Circular sequence - match wraps around the end
+    expect(findApproxMatches("ATG", "TGA", 0, true)).toEqual([
+      { index: 2, match: "ATG", mismatchPositions: [], numMismatches: 0 }
+    ]);
+
+    // Circular sequence with mismatches
+    expect(findApproxMatches("ATG", "TGC", 1, true)).toEqual([
+      { index: 2, match: "CTG", mismatchPositions: [0], numMismatches: 1 }
+    ]);
+  });
+
+  it("handles edge cases", () => {
+    // Empty search sequence - returns matches at every position
+    expect(findApproxMatches("", "ATGC", 0)).toEqual([
+      { index: 0, match: "", mismatchPositions: [], numMismatches: 0 },
+      { index: 1, match: "", mismatchPositions: [], numMismatches: 0 },
+      { index: 2, match: "", mismatchPositions: [], numMismatches: 0 },
+      { index: 3, match: "", mismatchPositions: [], numMismatches: 0 },
+      { index: 4, match: "", mismatchPositions: [], numMismatches: 0 }
+    ]);
+
+    // Empty target sequence
+    expect(findApproxMatches("ATG", "", 0)).toEqual([]);
+
+    // Search sequence longer than target
+    expect(findApproxMatches("ATGCG", "ATGC", 0)).toEqual([]);
+
+    // Exactly matching length sequences
+    expect(findApproxMatches("ATGC", "ATGC", 0)).toEqual([
+      { index: 0, match: "ATGC", mismatchPositions: [], numMismatches: 0 }
+    ]);
+
+    // Sequences with special characters
+    expect(findApproxMatches("AT-G", "AT-GC", 0)).toEqual([
+      { index: 0, match: "AT-G", mismatchPositions: [], numMismatches: 0 }
+    ]);
+  });
+
+  it("handles larger sequences efficiently", () => {
+    const longTarget = "ATGCGATCGATCGATCGATCGATCGATCGATCG";
+    const longSearch = "ATCGATCG";
+
+    // The actual positions where the pattern appears in the sequence
+    const expected = [
+      { index: 5, match: "ATCGATCG", mismatchPositions: [], numMismatches: 0 },
+      { index: 9, match: "ATCGATCG", mismatchPositions: [], numMismatches: 0 },
+      { index: 13, match: "ATCGATCG", mismatchPositions: [], numMismatches: 0 },
+      { index: 17, match: "ATCGATCG", mismatchPositions: [], numMismatches: 0 },
+      { index: 21, match: "ATCGATCG", mismatchPositions: [], numMismatches: 0 },
+      { index: 25, match: "ATCGATCG", mismatchPositions: [], numMismatches: 0 }
+    ];
+
+    // Only include indices where we have full matches (length of search string)
+    const actual = findApproxMatches(longSearch, longTarget, 0).filter(
+      m => m.match.length === longSearch.length
+    );
+
+    expect(actual).toEqual(expected);
+  });
+
+  it("tracks exact positions of mismatches", () => {
+    // Test specific positions of mismatches
+    const result = findApproxMatches("ATGCTA", "ATCCAA", 2);
+
+    expect(result).toEqual([
+      {
+        index: 0,
+        match: "ATCCAA",
+        mismatchPositions: [2, 4],
+        numMismatches: 2
+      }
+    ]);
+  });
+});

package/src/generateSequenceData.test.js

@@ -1,5 +1,5 @@
 import generateSequenceData from "./generateSequenceData";
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 import { map } from "lodash-es";
 

package/src/getDigestFragmentsForRestrictionEnzymes.test.js

@@ -1,5 +1,5 @@
 /* eslint-disable no-unused-expressions */
-import chai from "chai";
+import * as chai from "chai";
 import getDigestFragmentsForRestrictionEnzymes from "./getDigestFragmentsForRestrictionEnzymes.js";
 import enzymeList from "./aliasedEnzymesByName";
 

package/src/getLeftAndRightOfSequenceInRangeGivenPosition.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import cutSequenceByRestrictionEnzyme from "./cutSequenceByRestrictionEnzyme.js";
 import enzymeList from "./aliasedEnzymesByName";
 import getLeftAndRightOfSequenceInRangeGivenPosition from "./getLeftAndRightOfSequenceInRangeGivenPosition";

package/src/getPossiblePartsFromSequenceAndEnzymes.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 import getPossiblePartsFromSequenceAndEnzymes from "./getPossiblePartsFromSequenceAndEnzymes";
 import enzymeList from "./aliasedEnzymesByName";

package/src/getReverseComplementAnnotation.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 import getReverseComplementAnnotation from "./getReverseComplementAnnotation";
 chai.should();

package/src/getReverseComplementSequenceAndAnnotations.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 import getReverseComplementSequenceAndAnnotations from "./getReverseComplementSequenceAndAnnotations";
 chai.should();

package/src/getReverseComplementSequenceString.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 import getReverseComplementSequenceString from "./getReverseComplementSequenceString";
 chai.should();

package/src/getReverseSequenceString.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import getReverseSequenceString from "./getReverseSequenceString";
 chai.should();
 describe("getReverseSequenceAndAnnotations", () => {

package/src/getSequenceDataBetweenRange.test.js

@@ -1,6 +1,6 @@
 //tnr: half finished test.
 
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 
 import getSequenceDataBetweenRange from "./getSequenceDataBetweenRange";

package/src/getVirtualDigest.test.js

@@ -1,5 +1,5 @@
 import chaiSubset from "chai-subset";
-import chai from "chai";
+import * as chai from "chai";
 
 //UNDER CONSTRUCTION
 import getVirtualDigest from "./getVirtualDigest";

package/src/guessIfSequenceIsDnaAndNotProtein.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 import guessIfSequenceIsDnaAndNotProtein from "./guessIfSequenceIsDnaAndNotProtein";
 chai.should();
 describe("guessIfSequenceIsDnaAndNotProtein", () => {

package/src/index.js

@@ -40,6 +40,7 @@ export { default as getDegenerateRnaStringFromAAString } from "./getDegenerateRn
 export { default as getVirtualDigest } from "./getVirtualDigest";
 export { default as isEnzymeType2S } from "./isEnzymeType2S";
 export { default as insertGapsIntoRefSeq } from "./insertGapsIntoRefSeq";
+export { default as findApproxMatches } from "./findApproxMatches";
 export { default as adjustBpsToReplaceOrInsert } from "./adjustBpsToReplaceOrInsert";
 export { default as calculatePercentGC } from "./calculatePercentGC";
 export { default as calculateTm } from "./calculateTm";

package/src/insertSequenceDataAtPosition.test.js

@@ -1,6 +1,6 @@
 //tnr: half finished test.
 
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 
 import tidyUpSequenceData from "./tidyUpSequenceData";

package/src/insertSequenceDataAtPositionOrRange.test.js

@@ -1,6 +1,6 @@
 //tnr: half finished test.
 
-import chai from "chai";
+import * as chai from "chai";
 
 import { getRangeLength } from "@teselagen/range-utils";
 import assert from "assert";

package/src/mapAnnotationsToRows.test.js

@@ -1,4 +1,4 @@
-import chai from "chai";
+import * as chai from "chai";
 
 import { expect } from "chai";
 import chaiSubset from "chai-subset";

package/src/tidyUpSequenceData.test.js

@@ -1,6 +1,6 @@
 import assert from "assert";
 import tidyUpSequenceData from "./tidyUpSequenceData";
-import chai from "chai";
+import * as chai from "chai";
 import chaiSubset from "chai-subset";
 chai.use(chaiSubset);
 chai.should();

package/tidyUpAnnotation.d.ts

@@ -4,7 +4,7 @@ export default function tidyUpAnnotation(_annotation: any, { sequenceData, conve
     annotationType: any;
     provideNewIdsForAnnotations: any;
     doNotProvideIdsForAnnotations: any;
-    messages?: any[] | undefined;
+    messages?: never[] | undefined;
     mutative: any;
     allowNonStandardGenbankTypes: any;
     featureTypes: any;