@jbrowse/plugin-alignments 2.6.1 → 2.6.2

package/src/AlignmentsFeatureDetail/__snapshots__/index.test.tsx.snap

@@ -1,327 +0,0 @@
-// Jest Snapshot v1, https://goo.gl/fbAQLP
-
-exports[`open up a widget 1`] = `
-<div
-  class="MuiPaper-root MuiPaper-elevation MuiPaper-rounded MuiPaper-elevation1 css-1ps6pg7-MuiPaper-root"
-  data-testid="alignment-side-drawer"
->
-  <div
-    class="MuiPaper-root MuiPaper-elevation MuiPaper-rounded MuiPaper-elevation1 MuiAccordion-root MuiAccordion-rounded Mui-expanded MuiAccordion-gutters css-1elwnq4-MuiPaper-root-MuiAccordion-root"
-  >
-    <div
-      aria-expanded="true"
-      class="MuiButtonBase-root MuiAccordionSummary-root Mui-expanded MuiAccordionSummary-gutters css-sh22l5-MuiButtonBase-root-MuiAccordionSummary-root"
-      role="button"
-      tabindex="0"
-    >
-      <div
-        class="MuiAccordionSummary-content Mui-expanded MuiAccordionSummary-contentGutters css-o4b71y-MuiAccordionSummary-content"
-      >
-        <span
-          class="MuiTypography-root MuiTypography-button css-1f0on15-MuiTypography-root"
-        >
-           
-          ctgA_3_555_0:0:0_2:0... - match
-        </span>
-      </div>
-      <div
-        class="MuiAccordionSummary-expandIconWrapper Mui-expanded css-yw020d-MuiAccordionSummary-expandIconWrapper"
-      >
-        <svg
-          aria-hidden="true"
-          class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-ymsoo8-MuiSvgIcon-root-expandIcon"
-          data-testid="ExpandMoreIcon"
-          focusable="false"
-          viewBox="0 0 24 24"
-        >
-          <path
-            d="M16.59 8.59 12 13.17 7.41 8.59 6 10l6 6 6-6z"
-          />
-        </svg>
-      </div>
-    </div>
-    <div
-      class="MuiCollapse-root MuiCollapse-vertical MuiCollapse-entered css-pwcg7p-MuiCollapse-root"
-      style="min-height: 0px;"
-    >
-      <div
-        class="MuiCollapse-wrapper MuiCollapse-vertical css-smkl36-MuiCollapse-wrapper"
-      >
-        <div
-          class="MuiCollapse-wrapperInner MuiCollapse-vertical css-9l5vo-MuiCollapse-wrapperInner"
-        >
-          <div
-            class="MuiAccordion-region"
-            role="region"
-          >
-            <div
-              class="MuiAccordionDetails-root css-rqrb7m-MuiAccordionDetails-root-expansionPanelDetails"
-            >
-              <p
-                class="MuiTypography-root MuiTypography-body1 css-ahj2mt-MuiTypography-root"
-              >
-                Core details
-              </p>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                >
-                  Position
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  ctgA:3..102 (+)
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                >
-                  Name
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <span>
-                    ctgA_3_555_0:0:0_2:0:0_102d
-                  </span>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                >
-                  Length
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <span>
-                    100
-                  </span>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                >
-                  Type
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <span>
-                    match
-                  </span>
-                </div>
-              </div>
-              <hr
-                class="MuiDivider-root MuiDivider-fullWidth css-9mgopn-MuiDivider-root"
-              />
-              <p
-                class="MuiTypography-root MuiTypography-body1 css-ahj2mt-MuiTypography-root"
-              >
-                Attributes
-              </p>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                  style="width: 96px;"
-                >
-                  seq
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <div>
-                    TTGTTGCGGAGTTGAACAACGGCATTAGGAACACTTCCGTCTCTCACTTTTATACGATTATGATTGGTTCTTTAGCCTTGGTTTAGATTGGTAGTAGTAG
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                  style="width: 96px;"
-                >
-                  score
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <div>
-                    37
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                  style="width: 96px;"
-                >
-                  qual
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <button
-                    type="button"
-                  >
-                    Copy
-                  </button>
-                  <button
-                    type="button"
-                  >
-                    Show more
-                  </button>
-                  <div>
-                    17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 1...
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  aria-label="Mapping quality of the mate/next segment"
-                  class="css-18vnxxj-fieldDescription-fieldName"
-                  data-mui-internal-clone-element="true"
-                >
-                  MQ
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <div>
-                    37
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                  style="width: 96px;"
-                >
-                  CIGAR
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <div>
-                    100M
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                  style="width: 96px;"
-                >
-                  length_on_ref
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <div>
-                    100
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                  style="width: 96px;"
-                >
-                  template_length
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <div>
-                    0
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1m8nxnb-field"
-              >
-                <div
-                  class="css-1q83rf3-fieldName"
-                  style="width: 96px;"
-                >
-                  seq_length
-                </div>
-                <div
-                  class="css-1omt041-fieldValue"
-                >
-                  <div>
-                    100
-                  </div>
-                </div>
-              </div>
-              <div
-                class="css-1lttu3w-container"
-              >
-                <button
-                  class="MuiButtonBase-root MuiButton-root MuiButton-contained MuiButton-containedPrimary MuiButton-sizeMedium MuiButton-containedSizeMedium MuiButton-root MuiButton-contained MuiButton-containedPrimary MuiButton-sizeMedium MuiButton-containedSizeMedium css-sghohy-MuiButtonBase-root-MuiButton-root"
-                  tabindex="0"
-                  type="button"
-                >
-                  Show feature sequence
-                  <span
-                    class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                  />
-                </button>
-                <div
-                  class="MuiFormControl-root css-147opmv-MuiFormControl-root-formControl"
-                >
-                  <button
-                    class="MuiButtonBase-root MuiIconButton-root MuiIconButton-sizeMedium css-78trlr-MuiButtonBase-root-MuiIconButton-root"
-                    tabindex="0"
-                    type="button"
-                  >
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="HelpIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M12 2C6.48 2 2 6.48 2 12s4.48 10 10 10 10-4.48 10-10S17.52 2 12 2zm1 17h-2v-2h2v2zm2.07-7.75-.9.92C13.45 12.9 13 13.5 13 15h-2v-.5c0-1.1.45-2.1 1.17-2.83l1.24-1.26c.37-.36.59-.86.59-1.41 0-1.1-.9-2-2-2s-2 .9-2 2H8c0-2.21 1.79-4 4-4s4 1.79 4 4c0 .88-.36 1.68-.93 2.25z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </button>
-                </div>
-              </div>
-            </div>
-          </div>
-        </div>
-      </div>
-    </div>
-  </div>
-</div>
-`;

package/src/AlignmentsFeatureDetail/index.test.tsx

@@ -1,47 +0,0 @@
-import React from 'react'
-import { render } from '@testing-library/react'
-import { types } from 'mobx-state-tree'
-import PluginManager from '@jbrowse/core/PluginManager'
-import { ConfigurationSchema } from '@jbrowse/core/configuration'
-
-// locals
-import { stateModelFactory } from '.'
-import ReactComponent from './AlignmentsFeatureDetail'
-
-test('open up a widget', () => {
-  const pluginManager = new PluginManager([])
-
-  const Session = types.model({
-    rpcManager: types.optional(types.frozen(), {}),
-    configuration: ConfigurationSchema('test', {}),
-    widget: stateModelFactory(pluginManager),
-  })
-  const session = Session.create(
-    {
-      // @ts-expect-error
-      widget: { type: 'AlignmentsFeatureWidget' },
-    },
-    { pluginManager },
-  )
-  session.widget.setFeatureData({
-    seq: 'TTGTTGCGGAGTTGAACAACGGCATTAGGAACACTTCCGTCTCTCACTTTTATACGATTATGATTGGTTCTTTAGCCTTGGTTTAGATTGGTAGTAGTAG',
-    start: 2,
-    end: 102,
-    strand: 1,
-    score: 37,
-    qual: '17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17',
-    MQ: 37,
-    CIGAR: '100M',
-    length_on_ref: 100,
-    template_length: 0,
-    seq_length: 100,
-    name: 'ctgA_3_555_0:0:0_2:0:0_102d',
-    refName: 'ctgA',
-    type: 'match',
-  })
-  const { container, getByText } = render(
-    <ReactComponent model={session.widget} />,
-  )
-  expect(container.firstChild).toMatchSnapshot()
-  expect(getByText('ctgA:3..102 (+)')).toBeTruthy()
-})

package/src/AlignmentsFeatureDetail/index.ts

@@ -1,33 +0,0 @@
-import { lazy } from 'react'
-import PluginManager from '@jbrowse/core/PluginManager'
-import { ConfigurationSchema } from '@jbrowse/core/configuration'
-import { types } from 'mobx-state-tree'
-import WidgetType from '@jbrowse/core/pluggableElementTypes/WidgetType'
-import { stateModelFactory as baseModelFactory } from '@jbrowse/core/BaseFeatureWidget'
-
-const configSchema = ConfigurationSchema('AlignmentsFeatureWidget', {})
-
-export function stateModelFactory(pluginManager: PluginManager) {
-  const baseModel = baseModelFactory(pluginManager)
-  return types.compose(
-    baseModel,
-    types.model('AlignmentsFeatureWidget', {
-      type: types.literal('AlignmentsFeatureWidget'),
-    }),
-  )
-}
-
-export default function register(pluginManager: PluginManager) {
-  pluginManager.addWidgetType(
-    () =>
-      new WidgetType({
-        name: 'AlignmentsFeatureWidget',
-        heading: 'Feature details',
-        configSchema,
-        stateModel: stateModelFactory(pluginManager),
-        ReactComponent: lazy(() => import('./AlignmentsFeatureDetail')),
-      }),
-  )
-}
-
-export { configSchema }

package/src/AlignmentsFeatureDetail/util.ts

@@ -1,27 +0,0 @@
-import { getSession } from '@jbrowse/core/util'
-import { IAnyStateTreeNode } from 'mobx-state-tree'
-
-export function getTag(
-  tag: string,
-  feat: {
-    tags?: { [key: string]: unknown }
-    [key: string]: unknown
-  },
-) {
-  return feat.tags?.[tag] || feat[tag]
-}
-
-export async function navToLoc(locString: string, model: IAnyStateTreeNode) {
-  const session = getSession(model)
-  const { view } = model
-  try {
-    if (view) {
-      await view.navToLocString(locString)
-    } else {
-      throw new Error('No view associated with this view anymore')
-    }
-  } catch (e) {
-    console.error(e)
-    session.notify(`${e}`)
-  }
-}

package/src/AlignmentsTrack/configSchemaF.ts

@@ -1,22 +0,0 @@
-import { ConfigurationSchema } from '@jbrowse/core/configuration'
-import { createBaseTrackConfig } from '@jbrowse/core/pluggableElementTypes'
-import PluginManager from '@jbrowse/core/PluginManager'
-
-/**
- * #config AlignmentsTrack
- * has very little config; most config and state logic is on the display
- */
-function x() {} // eslint-disable-line @typescript-eslint/no-unused-vars
-
-export default function configSchemaFactory(pluginManager: PluginManager) {
-  return ConfigurationSchema(
-    'AlignmentsTrack',
-    {},
-    {
-      /**
-       * #baseConfiguration
-       */
-      baseConfiguration: createBaseTrackConfig(pluginManager),
-    },
-  )
-}

package/src/AlignmentsTrack/index.ts

@@ -1,22 +0,0 @@
-import PluginManager from '@jbrowse/core/PluginManager'
-import TrackType from '@jbrowse/core/pluggableElementTypes/TrackType'
-import { createBaseTrackModel } from '@jbrowse/core/pluggableElementTypes/models'
-import configSchemaF from './configSchemaF'
-
-export default function register(pm: PluginManager) {
-  pm.addTrackType(() => {
-    const configSchema = configSchemaF(pm)
-    const track = new TrackType({
-      name: 'AlignmentsTrack',
-      displayName: 'Alignments track',
-      configSchema,
-      stateModel: createBaseTrackModel(pm, 'AlignmentsTrack', configSchema),
-    })
-    const linearAlignmentsDisplay = pm.getDisplayType('LinearAlignmentsDisplay')
-    // Add LinearAlignmentsDisplay here so that it has priority over the other
-    // linear displays (defaults to order the displays are added, but we have
-    // to add the Pileup and SNPCoverage displays first).
-    track.addDisplayType(linearAlignmentsDisplay)
-    return track
-  })
-}

package/src/BamAdapter/BamAdapter.test.ts

@@ -1,124 +0,0 @@
-import { toArray } from 'rxjs/operators'
-import { firstValueFrom } from 'rxjs'
-import Adapter from './BamAdapter'
-import configSchema from './configSchema'
-
-test('adapter can fetch features from volvox.bam', async () => {
-  const adapter = new Adapter(
-    configSchema.create({
-      bamLocation: {
-        localPath: require.resolve('../../test_data/volvox-sorted.bam'),
-        locationType: 'LocalPathLocation',
-      },
-      index: {
-        location: {
-          localPath: require.resolve('../../test_data/volvox-sorted.bam.bai'),
-          locationType: 'LocalPathLocation',
-        },
-      },
-    }),
-  )
-
-  const features = adapter.getFeatures({
-    assemblyName: 'volvox',
-    refName: 'ctgA',
-    start: 0,
-    end: 20000,
-  })
-
-  const featuresArray = await firstValueFrom(features.pipe(toArray()))
-  expect(featuresArray[0].get('refName')).toBe('ctgA')
-  const featuresJsonArray = featuresArray.map(f => f.toJSON())
-  expect(featuresJsonArray.length).toEqual(3809)
-  expect(featuresJsonArray.slice(1000, 1010)).toMatchSnapshot()
-
-  expect(adapter.refIdToName(0)).toBe('ctgA')
-  expect(adapter.refIdToName(1)).toBe(undefined)
-
-  expect(await adapter.hasDataForRefName('ctgA')).toBe(true)
-
-  const adapterCSI = new Adapter(
-    configSchema.create({
-      bamLocation: {
-        localPath: require.resolve('../../test_data/volvox-sorted.bam'),
-        locationType: 'LocalPathLocation',
-      },
-      index: {
-        indexType: 'CSI',
-        location: {
-          localPath: require.resolve('../../test_data/volvox-sorted.bam.csi'),
-          locationType: 'LocalPathLocation',
-        },
-      },
-    }),
-  )
-
-  const featuresCSI = adapterCSI.getFeatures({
-    assemblyName: 'volvox',
-    refName: 'ctgA',
-    start: 0,
-    end: 20000,
-  })
-  const featuresArrayCSI = await firstValueFrom(featuresCSI.pipe(toArray()))
-  const featuresJsonArrayCSI = featuresArrayCSI.map(f => f.toJSON())
-  expect(featuresJsonArrayCSI).toEqual(featuresJsonArray)
-})
-
-test('test usage of BamSlightlyLazyFeature toJSON (used in the widget)', async () => {
-  const adapter = new Adapter(
-    configSchema.create({
-      bamLocation: {
-        localPath: require.resolve('../../test_data/volvox-sorted.bam'),
-        locationType: 'LocalPathLocation',
-      },
-      index: {
-        location: {
-          localPath: require.resolve('../../test_data/volvox-sorted.bam.bai'),
-          locationType: 'LocalPathLocation',
-        },
-        indexType: 'BAI',
-      },
-    }),
-  )
-
-  const features = adapter.getFeatures({
-    assemblyName: 'volvox',
-    refName: 'ctgA',
-    start: 0,
-    end: 100,
-  })
-  const featuresArray = await firstValueFrom(features.pipe(toArray()))
-  const f = featuresArray[0].toJSON()
-  expect(f.refName).toBe('ctgA')
-  expect(f.start).toBe(2)
-  expect(f.end).toBe(102)
-  expect(f.mismatches).not.toBeTruthy()
-})
-
-test('test usage of BamSlightlyLazyFeature for extended CIGAR', async () => {
-  const adapter = new Adapter(
-    configSchema.create({
-      bamLocation: {
-        localPath: require.resolve('../../test_data/extended_cigar.bam'),
-        locationType: 'LocalPathLocation',
-      },
-      index: {
-        location: {
-          localPath: require.resolve('../../test_data/extended_cigar.bam.bai'),
-          locationType: 'LocalPathLocation',
-        },
-        indexType: 'BAI',
-      },
-    }),
-  )
-
-  const features = adapter.getFeatures({
-    assemblyName: 'hg19',
-    refName: '1',
-    start: 13260,
-    end: 13340,
-  })
-  const featuresArray = await firstValueFrom(features.pipe(toArray()))
-  const f = featuresArray[0]
-  expect(f.get('mismatches')).toMatchSnapshot()
-})