@jbrowse/plugin-alignments 2.6.1 → 2.6.2

package/src/CramAdapter/CramSlightlyLazyFeature.ts

@@ -1,185 +0,0 @@
-/* eslint-disable no-underscore-dangle */
-import {
-  Feature,
-  SimpleFeatureSerialized,
-} from '@jbrowse/core/util/simpleFeature'
-import { CramRecord } from '@gmod/cram'
-
-// locals
-import CramAdapter from './CramAdapter'
-import { readFeaturesToCIGAR, readFeaturesToMismatches } from './util'
-
-export default class CramSlightlyLazyFeature implements Feature {
-  // uses parameter properties to automatically create fields on the class
-  // https://www.typescriptlang.org/docs/handbook/classes.html#parameter-properties
-  constructor(private record: CramRecord, private _store: CramAdapter) {}
-
-  _get_name() {
-    return this.record.readName
-  }
-
-  _get_start() {
-    return this.record.alignmentStart - 1
-  }
-
-  _get_end() {
-    return this.record.alignmentStart + (this.record.lengthOnRef ?? 1) - 1
-  }
-
-  _get_cram_read_features() {
-    return this.record.readFeatures
-  }
-
-  _get_type() {
-    return 'match'
-  }
-
-  _get_score() {
-    return this.record.mappingQuality
-  }
-
-  _get_flags() {
-    return this.record.flags
-  }
-
-  _get_strand() {
-    return this.record.isReverseComplemented() ? -1 : 1
-  }
-
-  _read_group_id() {
-    return this._store.samHeader.readGroups?.[this.record.readGroupId]
-  }
-
-  _get_qual() {
-    return (this.record.qualityScores || []).join(' ')
-  }
-
-  qualRaw() {
-    return this.record.qualityScores
-  }
-
-  _get_refName() {
-    return this._store.refIdToName(this.record.sequenceId)
-  }
-
-  _get_is_paired() {
-    return !!this.record.mate
-  }
-
-  _get_pair_orientation() {
-    return this.record.isPaired() ? this.record.getPairOrientation() : undefined
-  }
-
-  _get_template_length() {
-    return this.record.templateLength || this.record.templateSize
-  }
-
-  _get_next_ref() {
-    return this.record.mate
-      ? this._store.refIdToName(this.record.mate.sequenceId)
-      : undefined
-  }
-
-  _get_next_segment_position() {
-    return this.record.mate
-      ? `${this._store.refIdToName(this.record.mate.sequenceId)}:${
-          this.record.mate.alignmentStart
-        }`
-      : undefined
-  }
-
-  _get_next_pos() {
-    return this.record.mate?.alignmentStart
-  }
-
-  _get_tags() {
-    const RG = this._read_group_id()
-    const { tags } = this.record
-    // avoids a tag copy if no RG, but just copy if there is one
-    return RG !== undefined ? { ...tags, RG } : tags
-  }
-
-  _get_seq() {
-    return this.record.getReadBases()
-  }
-
-  // generate a CIGAR, based on code from jkbonfield
-  _get_CIGAR() {
-    return readFeaturesToCIGAR(
-      this.record.readFeatures,
-      this.record.alignmentStart,
-      this.record.readLength,
-      this.record._refRegion,
-    )
-  }
-
-  tags() {
-    return Object.getOwnPropertyNames(CramSlightlyLazyFeature.prototype)
-      .filter(
-        prop =>
-          prop.startsWith('_get_') &&
-          prop !== '_get_mismatches' &&
-          prop !== '_get_cram_read_features',
-      )
-      .map(methodName => methodName.replace('_get_', ''))
-  }
-
-  id() {
-    return `${this._store.id}-${this.record.uniqueId}`
-  }
-
-  get(field: string) {
-    const methodName = `_get_${field}`
-    // @ts-expect-error
-    if (this[methodName]) {
-      // @ts-expect-error
-      return this[methodName]()
-    }
-    return undefined
-  }
-
-  parent() {
-    return undefined
-  }
-
-  children() {
-    return undefined
-  }
-
-  set() {}
-
-  pairedFeature() {
-    return false
-  }
-
-  _get_clipPos() {
-    const mismatches = this.get('mismatches')
-    if (mismatches.length) {
-      const record =
-        this.get('strand') === -1 ? mismatches.at(-1) : mismatches[0]
-      const { type, cliplen } = record
-      if (type === 'softclip' || type === 'hardclip') {
-        return cliplen
-      }
-    }
-    return 0
-  }
-
-  toJSON(): SimpleFeatureSerialized {
-    return {
-      ...Object.fromEntries(
-        this.tags()
-          .map(t => [t, this.get(t)])
-          .filter(elt => elt[1] !== undefined),
-      ),
-      uniqueId: this.id(),
-    }
-  }
-
-  _get_mismatches() {
-    const readFeatures = this.record.readFeatures
-    const qual = this.qualRaw()
-    const start = this.get('start')
-    return readFeaturesToMismatches(readFeatures, start, qual)
-  }
-}

package/src/CramAdapter/CramTestAdapters.ts

@@ -1,98 +0,0 @@
-import { GenericFilehandle } from 'generic-filehandle'
-import { Observable } from 'rxjs'
-import SimpleFeature from '@jbrowse/core/util/simpleFeature'
-import { BaseFeatureDataAdapter } from '@jbrowse/core/data_adapters/BaseAdapter'
-import { ConfigurationSchema } from '@jbrowse/core/configuration'
-
-// setup for Cram Adapter Testing
-export function parseSmallFasta(text: string) {
-  return text
-    .split('>')
-    .filter(t => /\S/.test(t))
-    .map(entryText => {
-      const [defLine, ...seqLines] = entryText.split(/\n|\r\n|\r/)
-      const [id, ...descriptionLines] = defLine.split(' ')
-      const description = descriptionLines.join(' ')
-      const sequence = seqLines.join('').replaceAll(/\s/g, '')
-      return { id, description, sequence }
-    })
-}
-
-type FileHandle = GenericFilehandle
-
-export class FetchableSmallFasta {
-  data: Promise<ReturnType<typeof parseSmallFasta>>
-
-  constructor(filehandle: FileHandle) {
-    this.data = filehandle.readFile().then(buffer => {
-      const text = buffer.toString('utf8')
-      return parseSmallFasta(text)
-    })
-  }
-
-  async fetch(id: number, start: number, end: number) {
-    const data = await this.data
-    const entry = data[id]
-    const length = end - start + 1
-    if (!entry) {
-      throw new Error(`no sequence with id ${id} exists`)
-    }
-    return entry.sequence.slice(start, start + length)
-  }
-
-  async getSequenceList() {
-    const data = await this.data
-    return data.map(entry => entry.id)
-  }
-}
-
-export class SequenceAdapter extends BaseFeatureDataAdapter {
-  fasta: FetchableSmallFasta
-
-  refNames: string[] = []
-
-  constructor(filehandle: FileHandle) {
-    super(ConfigurationSchema('empty', {}).create())
-    this.fasta = new FetchableSmallFasta(filehandle)
-  }
-
-  async getRefNames() {
-    return this.refNames
-  }
-
-  getFeatures({
-    refName,
-    start,
-    end,
-  }: {
-    refName: string
-    start: number
-    end: number
-  }): Observable<SimpleFeature> {
-    return new Observable(observer => {
-      this.fasta
-        .getSequenceList()
-        .then(refNames => {
-          this.refNames = refNames
-        })
-        .then(() =>
-          this.fasta.fetch(this.refNames.indexOf(refName), start, end),
-        )
-        .then(ret => {
-          observer.next(
-            new SimpleFeature({
-              uniqueId: `${refName}-${start}-${end}`,
-              seq: ret,
-              start,
-              end,
-            }),
-          )
-          observer.complete()
-        })
-        .catch(e => observer.error(e))
-      return { unsubscribe: () => {} }
-    })
-  }
-
-  freeResources(/* { region } */): void {}
-}

package/src/CramAdapter/__snapshots__/CramAdapter.test.ts.snap

@@ -1,256 +0,0 @@
-// Jest Snapshot v1, https://goo.gl/fbAQLP
-
-exports[`adapter can fetch features from volvox-sorted.cram 1`] = `
-[
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5540,
-    "flags": 16,
-    "is_paired": false,
-    "name": "ctgA_5060_5540_1:0:0_3:1:0_15a3",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "TACACTGGTTCGGAGACGGTTCGTGACGAGCGCGCTATATGTCGGCATCTGCGCCGCATGAGCGGCCGCTGACCGGCGGCACGACTAATATAGTGCAAGA",
-    "start": 5440,
-    "strand": -1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 4,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1618",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5541,
-    "flags": 16,
-    "is_paired": false,
-    "name": "ctgA_4973_5541_1:0:0_1:0:0_1569",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "ACACTGGTTCGGAGACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCGGCCCCTGTCCGGCGGCACGAATAATATAGTGCAAGAA",
-    "start": 5441,
-    "strand": -1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 1,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1619",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5544,
-    "flags": 0,
-    "is_paired": false,
-    "name": "ctgA_5445_5947_3:1:0_2:0:0_2b9",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "CTGGTTCGGAGACGGTTCATGACGACCGCGCTATATGTCGGCATCTGCGTCGCATGAGCGGCCGCTGTCCGGCGGCTCGAATAATATAGTGCAAGAAAAA",
-    "start": 5444,
-    "strand": 1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 4,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1620",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5553,
-    "flags": 0,
-    "is_paired": false,
-    "name": "ctgA_5454_5906_0:1:0_2:0:0_d8a",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "AGACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCGCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACT",
-    "start": 5453,
-    "strand": 1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 1,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1621",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5554,
-    "flags": 0,
-    "is_paired": false,
-    "name": "ctgA_5455_5964_2:0:0_2:0:0_23e2",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "GACGGTTCATGACGAGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCCGCCGCTGTCCGACGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTA",
-    "start": 5454,
-    "strand": 1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 2,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1622",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5559,
-    "flags": 16,
-    "is_paired": false,
-    "name": "ctgA_5153_5559_3:0:0_1:1:0_11ac",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "TTCATGACGAGCGCGCTATATGACGGCATCTGCGCCGCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTT",
-    "start": 5459,
-    "strand": -1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 2,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1623",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5560,
-    "flags": 0,
-    "is_paired": false,
-    "name": "ctgA_5461_5986_1:1:0_3:0:0_200e",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "TCATGACGAGCGCGCTATATGTCGGCATCTGCGCCGCATCAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTA",
-    "start": 5460,
-    "strand": 1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 2,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1624",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5568,
-    "flags": 0,
-    "is_paired": false,
-    "name": "ctgA_5469_5932_0:0:0_2:0:0_6f8",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "AGCGCGCTATATGTCGGCATCTGCGCCCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTATATATGAT",
-    "start": 5468,
-    "strand": 1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 0,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1625",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5594,
-    "flags": 16,
-    "is_paired": false,
-    "name": "ctgA_5079_5594_1:0:0_2:0:0_d64",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "CCCATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCTAAGACTACGGTTATATATGATGGAACGGCCCTCACAGCATTCTCACA",
-    "start": 5494,
-    "strand": -1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 2,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1626",
-  },
-  {
-    "CIGAR": "100M",
-    "clipPos": 0,
-    "end": 5596,
-    "flags": 0,
-    "is_paired": false,
-    "name": "ctgA_5497_6082_1:0:0_2:0:0_b2",
-    "qual": "17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17",
-    "refName": "ctgA",
-    "score": 37,
-    "seq": "CATGAGCGGCCGCTGTCCGGCGGCACGAATAATATAGTGCAAGAAAAACCGAAGACTACGGTTATATATGATGGAACGGCCCTCACAGCATTGTAACAGG",
-    "start": 5496,
-    "strand": 1,
-    "tags": {
-      "X0": 1,
-      "X1": 0,
-      "XG": 0,
-      "XM": 1,
-      "XO": 0,
-      "XT": "U",
-    },
-    "template_length": 0,
-    "type": "match",
-    "uniqueId": "test-1627",
-  },
-]
-`;

package/src/CramAdapter/__snapshots__/util.test.ts.snap

@@ -1,14 +0,0 @@
-// Jest Snapshot v1, https://goo.gl/fbAQLP
-
-exports[`cram read features mismatches 1`] = `
-[
-  {
-    "base": "1",
-    "length": 0,
-    "start": 24,
-    "type": "insertion",
-  },
-]
-`;
-
-exports[`cram read features to CIGAR 1`] = `"24M1I75M"`;

package/src/CramAdapter/configSchema.ts

@@ -1,57 +0,0 @@
-import { ConfigurationSchema } from '@jbrowse/core/configuration'
-
-/**
- * #config CramAdapter
- * used to configure CRAM adapter
- */
-function x() {} // eslint-disable-line @typescript-eslint/no-unused-vars
-
-const configSchema = ConfigurationSchema(
-  'CramAdapter',
-  {
-    /**
-     * #slot fetchSizeLimit
-     */
-    fetchSizeLimit: {
-      type: 'number',
-      description:
-        'size in bytes over which to display a warning to the user that too much data will be fetched',
-      defaultValue: 3_000_000,
-    },
-
-    /**
-     * #slot cramLocation
-     */
-    cramLocation: {
-      type: 'fileLocation',
-      defaultValue: {
-        uri: '/path/to/my.cram',
-        locationType: 'UriLocation',
-      },
-    },
-
-    /**
-     * #slot craiLocation
-     */
-    craiLocation: {
-      type: 'fileLocation',
-      defaultValue: {
-        uri: '/path/to/my.cram.crai',
-        locationType: 'UriLocation',
-      },
-    },
-
-    /**
-     * #slot sequenceAdapter
-     * generally refers to the reference genome assembly's sequence adapter
-     * currently needs to be manually added
-     */
-    sequenceAdapter: {
-      type: 'frozen',
-      description: 'sequence data adapter',
-      defaultValue: null,
-    },
-  },
-  { explicitlyTyped: true },
-)
-export default configSchema

package/src/CramAdapter/index.ts

@@ -1,16 +0,0 @@
-import PluginManager from '@jbrowse/core/PluginManager'
-import AdapterType from '@jbrowse/core/pluggableElementTypes/AdapterType'
-
-// locals
-import configSchema from './configSchema'
-
-export default (pluginManager: PluginManager) => {
-  pluginManager.addAdapterType(() => {
-    return new AdapterType({
-      name: 'CramAdapter',
-      displayName: 'CRAM adapter',
-      configSchema,
-      getAdapterClass: () => import('./CramAdapter').then(r => r.default),
-    })
-  })
-}

package/src/CramAdapter/util.test.ts

@@ -1,26 +0,0 @@
-import { readFeaturesToCIGAR, readFeaturesToMismatches } from './util'
-
-test('cram read features mismatches', () => {
-  expect(
-    // from ctgA_15140_15565_0:0:1_1:0:0_2e8 in volvox-sorted.cram
-    readFeaturesToMismatches(
-      [{ code: 'i', data: 'C', pos: 25, refPos: 15164 }],
-      15139,
-    ),
-  ).toMatchSnapshot()
-})
-
-test('cram read features to CIGAR', () => {
-  expect(
-    // from ctgA_15140_15565_0:0:1_1:0:0_2e8 in volvox-sorted.cram
-    readFeaturesToCIGAR(
-      [{ code: 'i', data: 'C', pos: 25, refPos: 15164 }],
-      15140,
-      100,
-      {
-        start: 14998,
-        seq: 'agaccacattcagctctcggtaacatgggaggcttgtggttgcaccgtaaaagggggatagcccatccatcctgtaaacctacaatcgcgcgtagcttaatacgctcacattagacattcgatcgagagacctggtttcaagagccttcccttttgctttagtgggccaaatcgcaaccctgctcccctcccttacgccttatacacttcagtgcaaattcatgcgttcagcgaacaactggacttctgttgtacgtagtccacgggggcttattcattatagaaagccccctactgtcaccgttatatggttcacacatgagctgatcacctagagagtcgtcatgcacattcgcctaacaaggacatatgagtaaccg',
-      },
-    ),
-  ).toMatchSnapshot()
-})