@jbrowse/plugin-alignments 2.2.0 → 2.2.2

package/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@jbrowse/plugin-alignments",
-  "version": "2.2.0",
+  "version": "2.2.2",
   "description": "JBrowse 2 alignments adapters, tracks, etc.",
   "keywords": [
     "jbrowse",
@@ -27,7 +27,7 @@
     "build": "npm-run-all build:*",
     "test": "cd ../..; jest plugins/alignments",
     "prepublishOnly": "yarn test",
-    "prepack": "yarn build; yarn useDist",
+    "prepack": "yarn build && yarn useDist",
     "postpack": "yarn useSrc",
     "useDist": "node ../../scripts/useDist.js",
     "useSrc": "node ../../scripts/useSrc.js",
@@ -40,6 +40,7 @@
     "@gmod/bam": "^1.1.15",
     "@gmod/cram": "^1.7.1",
     "@mui/icons-material": "^5.0.1",
+    "clone": "^2.1.2",
     "color": "^3.1.2",
     "copy-to-clipboard": "^3.3.1",
     "fast-deep-equal": "^3.1.3",
@@ -64,5 +65,5 @@
   "distModule": "esm/index.js",
   "srcModule": "src/index.ts",
   "module": "esm/index.js",
-  "gitHead": "cf31db8d833117f8822510340664fb3f045975cb"
+  "gitHead": "abbc00e8feedbc58de84a7a3e735ec0224909b29"
 }

package/src/AlignmentsFeatureDetail/AlignmentsFeatureDetail.tsx

@@ -11,6 +11,7 @@ import { makeStyles } from 'tss-react/mui'
 import { observer } from 'mobx-react'
 import { getSession } from '@jbrowse/core/util'
 import copy from 'copy-to-clipboard'
+import clone from 'clone'
 import {
   FeatureDetails,
   BaseCard,
@@ -18,13 +19,13 @@ import {
 } from '@jbrowse/core/BaseFeatureWidget/BaseFeatureDetail'
 import { parseCigar } from '../BamAdapter/MismatchParser'
 
-const useStyles = makeStyles()(() => ({
+const useStyles = makeStyles()({
   compact: {
     paddingRight: 0,
     paddingTop: 0,
     paddingBottom: 0,
   },
-}))
+})
 
 const omit = ['clipPos', 'flags']
 
@@ -144,12 +145,12 @@ function SupplementaryAlignments(props: { tag: string; model: any }) {
             return (
               <li key={`${locString}-${index}`}>
                 <Link
-                  onClick={event => {
+                  onClick={async event => {
                     event.preventDefault()
                     const { view } = model
                     try {
                       if (view) {
-                        view.navToLocString(locString)
+                        await view.navToLocString(locString)
                       } else {
                         throw new Error(
                           'No view associated with this view anymore',
@@ -177,17 +178,15 @@ function PairLink({ locString, model }: { locString: string; model: any }) {
   const session = getSession(model)
   return (
     <Link
-      onClick={() => {
+      onClick={async () => {
         const { view } = model
+        if (!view) {
+          throw new Error(
+            'No view associated with this feature detail panel anymore',
+          )
+        }
         try {
-          if (view) {
-            view.navToLocString(locString)
-          } else {
-            session.notify(
-              'No view associated with this feature detail panel anymore',
-              'warning',
-            )
-          }
+          await view.navToLocString(locString)
         } catch (e) {
           console.error(e)
           session.notify(`${e}`)
@@ -203,7 +202,7 @@ function PairLink({ locString, model }: { locString: string; model: any }) {
 // eslint-disable-next-line @typescript-eslint/no-explicit-any
 function AlignmentFeatureDetails(props: { model: any }) {
   const { model } = props
-  const feat = JSON.parse(JSON.stringify(model.featureData))
+  const feat = clone(model.featureData)
   const SA = (feat.tags && feat.tags.SA) || feat.SA
   return (
     <Paper data-testid="alignment-side-drawer">
@@ -211,7 +210,7 @@ function AlignmentFeatureDetails(props: { model: any }) {
         {...props}
         omit={omit}
         feature={feat}
-        formatter={(value: unknown, key: string) => {
+        formatter={(value, key) => {
           return key === 'next_segment_position' ? (
             <PairLink model={model} locString={value as string} />
           ) : (
@@ -220,7 +219,9 @@ function AlignmentFeatureDetails(props: { model: any }) {
         }}
       />
       {SA ? <SupplementaryAlignments model={model} tag={SA} /> : null}
-      <AlignmentFlags feature={feat} {...props} />
+      {feat.flags !== undefined ? (
+        <AlignmentFlags feature={feat} {...props} />
+      ) : null}
     </Paper>
   )
 }

package/src/AlignmentsFeatureDetail/__snapshots__/index.test.js.snap

@@ -73,9 +73,7 @@ exports[`open up a widget 1`] = `
                 <div
                   class="css-1omt041-fieldValue"
                 >
-                  <div>
-                    ctgA:3..102 (+)
-                  </div>
+                  ctgA:3..102 (+)
                 </div>
               </div>
               <div
@@ -325,475 +323,5 @@ exports[`open up a widget 1`] = `
       </div>
     </div>
   </div>
-  <div
-    class="MuiPaper-root MuiPaper-elevation MuiPaper-rounded MuiPaper-elevation1 MuiAccordion-root MuiAccordion-rounded Mui-expanded MuiAccordion-gutters css-1elwnq4-MuiPaper-root-MuiAccordion-root"
-  >
-    <div
-      aria-expanded="true"
-      class="MuiButtonBase-root MuiAccordionSummary-root Mui-expanded MuiAccordionSummary-gutters css-sh22l5-MuiButtonBase-root-MuiAccordionSummary-root"
-      role="button"
-      tabindex="0"
-    >
-      <div
-        class="MuiAccordionSummary-content Mui-expanded MuiAccordionSummary-contentGutters css-o4b71y-MuiAccordionSummary-content"
-      >
-        <span
-          class="MuiTypography-root MuiTypography-button css-1f0on15-MuiTypography-root"
-        >
-           
-          Flags
-        </span>
-      </div>
-      <div
-        class="MuiAccordionSummary-expandIconWrapper Mui-expanded css-yw020d-MuiAccordionSummary-expandIconWrapper"
-      >
-        <svg
-          aria-hidden="true"
-          class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-125qixp-MuiSvgIcon-root-expandIcon"
-          data-testid="ExpandMoreIcon"
-          focusable="false"
-          viewBox="0 0 24 24"
-        >
-          <path
-            d="M16.59 8.59 12 13.17 7.41 8.59 6 10l6 6 6-6z"
-          />
-        </svg>
-      </div>
-    </div>
-    <div
-      class="MuiCollapse-root MuiCollapse-vertical MuiCollapse-entered css-pwcg7p-MuiCollapse-root"
-      style="min-height: 0px;"
-    >
-      <div
-        class="MuiCollapse-wrapper MuiCollapse-vertical css-smkl36-MuiCollapse-wrapper"
-      >
-        <div
-          class="MuiCollapse-wrapperInner MuiCollapse-vertical css-9l5vo-MuiCollapse-wrapperInner"
-        >
-          <div
-            class="MuiAccordion-region"
-            role="region"
-          >
-            <div
-              class="MuiAccordionDetails-root css-rqrb7m-MuiAccordionDetails-root-expansionPanelDetails"
-            >
-              <div
-                class="MuiFormGroup-root css-dmmspl-MuiFormGroup-root"
-              >
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="read paired"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    read paired
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="read mapped in proper pair"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    read mapped in proper pair
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="read unmapped"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    read unmapped
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="mate unmapped"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    mate unmapped
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="read reverse strand"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    read reverse strand
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="mate reverse strand"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    mate reverse strand
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="first in pair"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    first in pair
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="second in pair"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    second in pair
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="not primary alignment"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    not primary alignment
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="read fails platform/vendor quality checks"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    read fails platform/vendor quality checks
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="read is PCR or optical duplicate"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    read is PCR or optical duplicate
-                  </span>
-                </label>
-                <label
-                  class="MuiFormControlLabel-root MuiFormControlLabel-labelPlacementEnd css-j204z7-MuiFormControlLabel-root"
-                >
-                  <span
-                    class="MuiButtonBase-root MuiCheckbox-root MuiCheckbox-colorPrimary PrivateSwitchBase-root MuiCheckbox-root MuiCheckbox-colorPrimary MuiCheckbox-root MuiCheckbox-colorPrimary css-1r7hq7f-MuiButtonBase-root-MuiCheckbox-root-compact"
-                  >
-                    <input
-                      class="PrivateSwitchBase-input css-1m9pwf3"
-                      data-indeterminate="false"
-                      name="supplementary alignment"
-                      readonly=""
-                      type="checkbox"
-                    />
-                    <svg
-                      aria-hidden="true"
-                      class="MuiSvgIcon-root MuiSvgIcon-fontSizeMedium css-i4bv87-MuiSvgIcon-root"
-                      data-testid="CheckBoxOutlineBlankIcon"
-                      focusable="false"
-                      viewBox="0 0 24 24"
-                    >
-                      <path
-                        d="M19 5v14H5V5h14m0-2H5c-1.1 0-2 .9-2 2v14c0 1.1.9 2 2 2h14c1.1 0 2-.9 2-2V5c0-1.1-.9-2-2-2z"
-                      />
-                    </svg>
-                    <span
-                      class="MuiTouchRipple-root css-8je8zh-MuiTouchRipple-root"
-                    />
-                  </span>
-                  <span
-                    class="MuiTypography-root MuiTypography-body1 MuiFormControlLabel-label css-ahj2mt-MuiTypography-root"
-                  >
-                    supplementary alignment
-                  </span>
-                </label>
-              </div>
-            </div>
-          </div>
-        </div>
-      </div>
-    </div>
-  </div>
 </div>
 `;

package/src/AlignmentsFeatureDetail/index.test.js

@@ -11,14 +11,16 @@ test('open up a widget', () => {
   const pluginManager = new PluginManager([])
 
   const Session = types.model({
-    pluginManager: types.optional(types.frozen(), {}),
     rpcManager: types.optional(types.frozen(), {}),
     configuration: ConfigurationSchema('test', {}),
     widget: stateModelFactory(pluginManager),
   })
-  const session = Session.create({
-    widget: { type: 'AlignmentsFeatureWidget' },
-  })
+  const session = Session.create(
+    {
+      widget: { type: 'AlignmentsFeatureWidget' },
+    },
+    { pluginManager },
+  )
   session.widget.setFeatureData({
     seq: 'TTGTTGCGGAGTTGAACAACGGCATTAGGAACACTTCCGTCTCTCACTTTTATACGATTATGATTGGTTCTTTAGCCTTGGTTTAGATTGGTAGTAGTAG',
     start: 2,

package/src/BamAdapter/BamAdapter.ts

@@ -4,11 +4,12 @@ import {
   BaseOptions,
 } from '@jbrowse/core/data_adapters/BaseAdapter'
 import { Region } from '@jbrowse/core/util/types'
-import { bytesForRegions, updateStatus } from '@jbrowse/core/util'
+import { bytesForRegions, updateStatus, Feature } from '@jbrowse/core/util'
 import { openLocation } from '@jbrowse/core/util/io'
 import { ObservableCreate } from '@jbrowse/core/util/rxjs'
-import { Feature } from '@jbrowse/core/util/simpleFeature'
 import { toArray } from 'rxjs/operators'
+
+// locals
 import BamSlightlyLazyFeature from './BamSlightlyLazyFeature'
 
 interface Header {

package/src/BamAdapter/BamSlightlyLazyFeature.ts

@@ -4,8 +4,9 @@ import {
   SimpleFeatureSerialized,
 } from '@jbrowse/core/util/simpleFeature'
 import { BamRecord } from '@gmod/bam'
-import { getMismatches } from './MismatchParser'
 
+// locals
+import { getMismatches } from './MismatchParser'
 import BamAdapter from './BamAdapter'
 
 export default class BamSlightlyLazyFeature implements Feature {