@datagrok/sequence-translator 0.0.9 → 1.0.1

package/package.json

@@ -1,14 +1,19 @@
 {
   "name": "@datagrok/sequence-translator",
   "friendlyName": "Sequence Translator",
-  "version": "0.0.9",
-  "description": "",
+  "version": "1.0.1",
+  "description": "SequenceTranslator is a [package](https://datagrok.ai/help/develop/develop#packages) for the [Datagrok](https://datagrok.ai) platform, used to translate [oligonucleotide](https://en.wikipedia.org/wiki/Oligonucleotide) sequences between [different representations](https://github.com/datagrok-ai/public/tree/master/packages/SequenceTranslator#sequence-representations).",
+  "repository": {
+    "type": "git",
+    "url": "https://github.com/datagrok-ai/public.git",
+    "directory": "packages/SequenceTranslator"
+  },
   "dependencies": {
     "@datagrok-libraries/utils": "^0.1.0",
     "@types/react": "latest",
-    "datagrok-api": ">0.94.10",
+    "datagrok-api": "^1.1.7",
     "datagrok-tools": "^4.1.2",
-    "npm": "^7.11.2",
+    "npm": "^8.11.0",
     "save-svg-as-png": "^1.4.17",
     "ts-loader": "latest",
     "typescript": "latest",
@@ -28,6 +33,9 @@
     "test-dev": "set HOST=dev && jest",
     "test-local": "set HOST=localhost && jest"
   },
+  "sources": [
+    "css/style.css"
+  ],
   "devDependencies": {
     "@typescript-eslint/eslint-plugin": "^4.29.1",
     "@typescript-eslint/parser": "^4.29.1",
@@ -36,10 +44,11 @@
     "eslint-config-google": "^0.14.0",
     "webpack": "^5.31.0",
     "webpack-cli": "^4.6.0",
-    "@types/jest": "latest",
-    "jest": "latest",
-    "jest-html-reporter": "latest",
-    "puppeteer": "^13.1.2",
-    "ts-jest": "^27.1.2"
-  }
+    "jest-html-reporter": "^3.5.0",
+    "jest": "^27.0.0",
+    "@types/jest": "^27.0.0",
+    "ts-jest": "^27.0.0",
+    "puppeteer": "^13.7.0"
+  },
+  "category": "Bioinformatics"
 }

package/src/defineAxolabsPattern.ts

@@ -114,7 +114,7 @@ export function defineAxolabsPattern() {
     asPtoLinkages = asPtoLinkages.concat(Array(maximalAsLength - asBases.length).fill(fullyPto));
     asBases = asBases.concat(Array(maximalAsLength - asBases.length).fill(sequenceBase));
     let nucleotideCounter = 0;
-    for (let i = 0; i < asLength.value; i++) {
+    for (let i = 0; i < asLength.value!; i++) {
       asPtoLinkages[i] = ui.boolInput('', asPtoLinkages[i].value, () => {
         updateSvgScheme();
         updateOutputExamples();
@@ -157,7 +157,7 @@ export function defineAxolabsPattern() {
     ssPtoLinkages = ssPtoLinkages.concat(Array(maximalSsLength - ssBases.length).fill(fullyPto));
     ssBases = ssBases.concat(Array(maximalSsLength - ssBases.length).fill(sequenceBase));
     let nucleotideCounter = 0;
-    for (let i = 0; i < ssLength.value; i++) {
+    for (let i = 0; i < ssLength.value!; i++) {
       ssPtoLinkages[i] = ui.boolInput('', ssPtoLinkages[i].value, () => {
         updateSvgScheme();
         updateOutputExamples();
@@ -196,11 +196,11 @@ export function defineAxolabsPattern() {
   }
 
   function updateUiForNewSequenceLength() {
-    if (ssLength.value < maximalValidSequenceLength && asLength.value < maximalValidSequenceLength) {
-      if (ssLength.value > maximalSsLength)
-        maximalSsLength = ssLength.value;
-      if (asLength.value > maximalAsLength)
-        maximalAsLength = asLength.value;
+    if (ssLength.value! < maximalValidSequenceLength && asLength.value! < maximalValidSequenceLength) {
+      if (ssLength.value! > maximalSsLength)
+        maximalSsLength = ssLength.value!;
+      if (asLength.value! > maximalAsLength)
+        maximalAsLength = asLength.value!;
       updateSsModification();
       updateAsModification();
       updateSvgScheme();
@@ -236,17 +236,17 @@ export function defineAxolabsPattern() {
   }
 
   function updateInputExamples() {
-    ssInputExample.value = generateExample(ssLength.value, sequenceBase.value);
+    ssInputExample.value = generateExample(ssLength.value!, sequenceBase.value!);
     if (createAsStrand.value)
-      asInputExample.value = generateExample(asLength.value, sequenceBase.value);
+      asInputExample.value = generateExample(asLength.value!, sequenceBase.value!);
   }
 
   function updateOutputExamples() {
     ssOutputExample.value = translateSequence(
-      ssInputExample.value, ssBases, ssPtoLinkages, ssFiveModification, ssThreeModification, firstSsPto.value);
+      ssInputExample.value, ssBases, ssPtoLinkages, ssFiveModification, ssThreeModification, firstSsPto.value!);
     if (createAsStrand.value) {
       asOutputExample.value = translateSequence(
-        asInputExample.value, asBases, asPtoLinkages, asFiveModification, asThreeModification, firstAsPto.value);
+        asInputExample.value, asBases, asPtoLinkages, asFiveModification, asThreeModification, firstAsPto.value!);
     }
   }
 
@@ -256,11 +256,11 @@ export function defineAxolabsPattern() {
       ui.span([
         drawAxolabsPattern(
           getShortName(saveAs.value),
-          createAsStrand.value,
-          ssBases.slice(0, ssLength.value).map((e) => e.value),
-          asBases.slice(0, asLength.value).map((e) => e.value),
-          [firstSsPto.value].concat(ssPtoLinkages.slice(0, ssLength.value).map((e) => e.value)),
-          [firstAsPto.value].concat(asPtoLinkages.slice(0, asLength.value).map((e) => e.value)),
+          createAsStrand.value!,
+          ssBases.slice(0, ssLength.value!).map((e) => e.value),
+          asBases.slice(0, asLength.value!).map((e) => e.value),
+          [firstSsPto.value!].concat(ssPtoLinkages.slice(0, ssLength.value!).map((e) => e.value)),
+          [firstAsPto.value!].concat(asPtoLinkages.slice(0, asLength.value!).map((e) => e.value)),
           ssThreeModification.value,
           ssFiveModification.value,
           asThreeModification.value,
@@ -329,7 +329,7 @@ export function defineAxolabsPattern() {
   }
 
   function checkWhetherAllValuesInColumnHaveTheSameLength(colName: string): boolean {
-    const col = tables.value.columns.byName(colName);
+    const col = tables.value!.columns.byName(colName);
     let allLengthsAreTheSame = true;
     for (let i = 1; i < col.length; i++) {
       if (col.get(i - 1).length != col.get(i).length) {
@@ -344,10 +344,10 @@ export function defineAxolabsPattern() {
         .add(ui.divText('The sequence length should match the number of Raw sequences in the input file'))
         .add(ui.divText('\'ADD COLUMN\' to see sequences lengths'))
         .addButton('ADD COLUMN', () => {
-          tables.value.columns.addNewInt('Sequences lengths in ' + colName).init((j: number) => col.get(j).length);
-          grok.shell.info('Column with lengths added to \'' + tables.value.name + '\'');
+          tables.value!.columns.addNewInt('Sequences lengths in ' + colName).init((j: number) => col.get(j).length);
+          grok.shell.info('Column with lengths added to \'' + tables.value!.name + '\'');
           dialog.close();
-          grok.shell.v = grok.shell.getTableView(tables.value.name);
+          grok.shell.v = grok.shell.getTableView(tables.value!.name);
         })
         .show();
     }
@@ -368,10 +368,10 @@ export function defineAxolabsPattern() {
       userStorageKey,
       saveAs.stringValue,
       JSON.stringify({
-        'ssBases': ssBases.slice(0, ssLength.value).map((e) => e.value),
-        'asBases': asBases.slice(0, asLength.value).map((e) => e.value),
-        'ssPtoLinkages': [firstSsPto.value].concat(ssPtoLinkages.slice(0, ssLength.value).map((e) => e.value)),
-        'asPtoLinkages': [firstAsPto.value].concat(asPtoLinkages.slice(0, asLength.value).map((e) => e.value)),
+        'ssBases': ssBases.slice(0, ssLength.value!).map((e) => e.value),
+        'asBases': asBases.slice(0, asLength.value!).map((e) => e.value),
+        'ssPtoLinkages': [firstSsPto.value].concat(ssPtoLinkages.slice(0, ssLength.value!).map((e) => e.value)),
+        'asPtoLinkages': [firstAsPto.value].concat(asPtoLinkages.slice(0, asLength.value!).map((e) => e.value)),
         'ssThreeModification': ssThreeModification.value,
         'ssFiveModification': ssFiveModification.value,
         'asThreeModification': asThreeModification.value,
@@ -506,24 +506,24 @@ export function defineAxolabsPattern() {
 
   function validateSsColumn(colName: string) {
     const allLengthsAreTheSame: boolean = checkWhetherAllValuesInColumnHaveTheSameLength(colName);
-    const firstSequence = tables.value.columns.byName(colName).get(0);
+    const firstSequence = tables.value!.columns.byName(colName).get(0);
     if (allLengthsAreTheSame && firstSequence.length != ssLength.value)
-      ssLength.value = tables.value.columns.byName(colName).get(0).length;
+      ssLength.value = tables.value!.columns.byName(colName).get(0).length;
     ssInputExample.value = firstSequence;
   }
 
   function validateAsColumn(colName: string) {
     const allLengthsAreTheSame: boolean = checkWhetherAllValuesInColumnHaveTheSameLength(colName);
-    const firstSequence = tables.value.columns.byName(colName).get(0);
+    const firstSequence = tables.value!.columns.byName(colName).get(0);
     if (allLengthsAreTheSame && firstSequence.length != asLength.value)
-      asLength.value = tables.value.columns.byName(colName).get(0).length;
+      asLength.value = tables.value!.columns.byName(colName).get(0).length;
     asLengthDiv.innerHTML = '';
     asLengthDiv.append(asLength.root);
     asInputExample.value = firstSequence;
   }
 
   function validateIdsColumn(colName: string) {
-    const col = tables.value.columns.byName(colName);
+    const col = tables.value!.columns.byName(colName);
     if (col.type != DG.TYPE.INT)
       grok.shell.error('Column should contain integers only');
     else if (col.categories.length < col.length) {
@@ -531,32 +531,35 @@ export function defineAxolabsPattern() {
       ui.dialog('Non-unique IDs')
         .add(ui.divText('Press \'OK\' to select rows with non-unique values'))
         .onOK(() => {
-          const selection = tables.value.selection;
+          const selection = tables.value!.selection;
           selection.init((i: number) => duplicates.indexOf(col.get(i)) > -1);
-          grok.shell.v = grok.shell.getTableView(tables.value.name);
-          grok.shell.info('Rows are selected in table \'' + tables.value.name + '\'');
+          grok.shell.v = grok.shell.getTableView(tables.value!.name);
+          grok.shell.info('Rows are selected in table \'' + tables.value!.name + '\'');
         })
         .show();
     }
   }
 
   const tables = ui.tableInput('Tables', grok.shell.tables[0], grok.shell.tables, (t: DG.DataFrame) => {
-    inputSsColumn = ui.choiceInput('SS Column', '', t.columns.names(), (colName: string) => validateSsColumn(colName));
+    const inputSsColumn =
+      ui.choiceInput('SS Column', '', t.columns.names(), (colName: string) => validateSsColumn(colName));
     inputSsColumnDiv.innerHTML = '';
     inputSsColumnDiv.append(inputSsColumn.root);
-    inputAsColumn = ui.choiceInput('AS Column', '', t.columns.names(), (colName: string) => validateAsColumn(colName));
+    const inputAsColumn =
+      ui.choiceInput('AS Column', '', t.columns.names(), (colName: string) => validateAsColumn(colName));
     inputAsColumnDiv.innerHTML = '';
     inputAsColumnDiv.append(inputAsColumn.root);
-    inputIdColumn = ui.choiceInput('ID Column', '', t.columns.names(), (colName: string) => validateIdsColumn(colName));
+    const inputIdColumn =
+      ui.choiceInput('ID Column', '', t.columns.names(), (colName: string) => validateIdsColumn(colName));
     inputIdColumnDiv.innerHTML = '';
     inputIdColumnDiv.append(inputIdColumn.root);
   });
 
-  let inputSsColumn = ui.choiceInput('SS Column', '', []);
+  const inputSsColumn = ui.choiceInput('SS Column', '', []);
   inputSsColumnDiv.append(inputSsColumn.root);
-  let inputAsColumn = ui.choiceInput('AS Column', '', []);
+  const inputAsColumn = ui.choiceInput('AS Column', '', []);
   inputAsColumnDiv.append(inputAsColumn.root);
-  let inputIdColumn = ui.choiceInput('ID Column', '', []);
+  const inputIdColumn = ui.choiceInput('ID Column', '', []);
   inputIdColumnDiv.append(inputIdColumn.root);
 
   updatePatternsList();
@@ -573,8 +576,8 @@ export function defineAxolabsPattern() {
     updateOutputExamples();
   });
 
-  const firstSsPto = ui.boolInput('First SS PTO', fullyPto.value, () => updateSvgScheme());
-  const firstAsPto = ui.boolInput('First AS PTO', fullyPto.value, () => updateSvgScheme());
+  const firstSsPto = ui.boolInput('First SS PTO', fullyPto.value!, () => updateSvgScheme());
+  const firstAsPto = ui.boolInput('First AS PTO', fullyPto.value!, () => updateSvgScheme());
   firstAsPtoDiv.append(firstAsPto.root);
 
   const createAsStrand = ui.boolInput('Create AS Strand', true, (v: boolean) => {
@@ -643,34 +646,34 @@ export function defineAxolabsPattern() {
       dialog
         .add(ui.divText('Length of sequences in columns doesn\'t match entered length. Update length value?'))
         .addButton('YES', () => {
-          ssLength.value = tables.value.columns.byName(inputSsColumn.value).getString(0).length;
-          asLength.value = tables.value.columns.byName(inputAsColumn.value).getString(0).length;
+          ssLength.value = tables.value!.columns.byName(inputSsColumn.value!).getString(0).length;
+          asLength.value = tables.value!.columns.byName(inputAsColumn.value!).getString(0).length;
           dialog.close();
         })
         .show();
     } else {
       if (inputIdColumn.value != null)
-        addColumnWithIds(tables.value.name, inputIdColumn.value, getShortName(saveAs.value));
+        addColumnWithIds(tables.value!.name, inputIdColumn.value, getShortName(saveAs.value));
       addColumnWithTranslatedSequences(
-        tables.value.name, inputSsColumn.value, ssBases, ssPtoLinkages,
-        ssFiveModification, ssThreeModification, firstSsPto.value);
+        tables.value!.name, inputSsColumn.value, ssBases, ssPtoLinkages,
+        ssFiveModification, ssThreeModification, firstSsPto.value!);
       if (createAsStrand.value) {
         addColumnWithTranslatedSequences(
-          tables.value.name, inputAsColumn.value, asBases, asPtoLinkages,
-          asFiveModification, asThreeModification, firstAsPto.value);
+          tables.value!.name, inputAsColumn.value!, asBases, asPtoLinkages,
+          asFiveModification, asThreeModification, firstAsPto.value!);
       }
-      grok.shell.v = grok.shell.getTableView(tables.value.name);
+      grok.shell.v = grok.shell.getTableView(tables.value!.name);
       grok.shell.info(((createAsStrand.value) ? 'Columns were' : 'Column was') +
-      ' added to table \'' + tables.value.name + '\'');
+      ' added to table \'' + tables.value!.name + '\'');
     }
   });
 
-  const ssInputExample = ui.textInput('Sense Strand', generateExample(ssLength.value, sequenceBase.value), () => {
+  const ssInputExample = ui.textInput('Sense Strand', generateExample(ssLength.value!, sequenceBase.value!), () => {
     ssOutputExample.value = translateSequence(ssInputExample.value, ssBases, ssPtoLinkages,
-      ssFiveModification, ssThreeModification, firstSsPto.value);
+      ssFiveModification, ssThreeModification, firstSsPto.value!);
   });
   const ssOutputExample = ui.textInput(' ', translateSequence(
-    ssInputExample.value, ssBases, ssPtoLinkages, ssThreeModification, ssFiveModification, firstSsPto.value));
+    ssInputExample.value, ssBases, ssPtoLinkages, ssThreeModification, ssFiveModification, firstSsPto.value!));
   (ssInputExample.input as HTMLElement).style.resize = 'none';
   (ssInputExample.input as HTMLElement).style.minWidth = exampleMinWidth;
   (ssOutputExample.input as HTMLElement).style.resize = 'none';
@@ -686,12 +689,12 @@ export function defineAxolabsPattern() {
     ], 'ui-input-options'),
   );
 
-  const asInputExample = ui.textInput('Antisense Strand', generateExample(asLength.value, sequenceBase.value), () => {
+  const asInputExample = ui.textInput('Antisense Strand', generateExample(asLength.value!, sequenceBase.value!), () => {
     asOutputExample.value = translateSequence(
-      asInputExample.value, asBases, asPtoLinkages, asFiveModification, asThreeModification, firstSsPto.value);
+      asInputExample.value, asBases, asPtoLinkages, asFiveModification, asThreeModification, firstSsPto.value!);
   });
   const asOutputExample = ui.textInput(' ', translateSequence(
-    asInputExample.value, asBases, asPtoLinkages, asFiveModification, asThreeModification, firstSsPto.value));
+    asInputExample.value, asBases, asPtoLinkages, asFiveModification, asThreeModification, firstSsPto.value!));
   (asInputExample.input as HTMLElement).style.resize = 'none';
   (asInputExample.input as HTMLElement).style.minWidth = exampleMinWidth;
   (asOutputExample.input as HTMLElement).style.resize = 'none';

package/src/package-test.ts

@@ -3,7 +3,7 @@ import {runTests, tests} from '@datagrok-libraries/utils/src/test';
 import './tests/smiles-tests';
 
 export const _package = new DG.Package();
-export {tests}
+export {tests};
 
 //name: test
 //output: dataframe result

package/src/package.ts

@@ -7,7 +7,8 @@ import $ from 'cash-dom';
 import {defineAxolabsPattern} from './defineAxolabsPattern';
 import {saveSenseAntiSense} from './structures-works/save-sense-antisense';
 import {sequenceToSmiles, sequenceToMolV3000} from './structures-works/from-monomers';
-import {convertSequence, undefinedInputSequence} from './structures-works/sequence-codes-tools';
+import {convertSequence, undefinedInputSequence, isValidSequence, getFormat} from
+  './structures-works/sequence-codes-tools';
 import {map, COL_NAMES, MODIFICATIONS} from './structures-works/map';
 import {SALTS_CSV} from './salts';
 import {USERS_CSV} from './users';
@@ -17,7 +18,7 @@ import {IDPS} from './IDPs';
 
 export const _package = new DG.Package();
 
-const defaultInput = 'AGGTCCTCTTGACTTAGGCC';
+const defaultInput = 'fAmCmGmAmCpsmU';
 const sequenceWasCopied = 'Copied';
 const tooltipSequence = 'Copy sequence';
 
@@ -29,35 +30,40 @@ export function sequenceTranslator(): void {
   windows.showToolbox = false;
   windows.showHelp = false;
 
-  function updateTableAndMolecule(sequence: string): void {
+  function updateTableAndMolecule(sequence: string, inputFormat: string, isSet: boolean): void {
     moleculeSvgDiv.innerHTML = '';
     outputTableDiv.innerHTML = '';
     const pi = DG.TaskBarProgressIndicator.create('Rendering table and molecule...');
     let errorsExist = false;
     try {
-      const outputSequenceObj = convertSequence(sequence);
+      sequence = sequence.replace(/\s/g, '');
+      const output = isValidSequence(sequence, null);
+      if (isSet)
+        output.synthesizer = [inputFormat];
+      inputFormatChoiceInput.value = output.synthesizer![0];
+      const outputSequenceObj = convertSequence(sequence, output);
       const tableRows = [];
 
       for (const key of Object.keys(outputSequenceObj).slice(1)) {
-        const indexOfFirstNotValidCharacter = ('indexOfFirstNotValidCharacter' in outputSequenceObj) ?
-          JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).indexOfFirstNotValidCharacter :
+        const indexOfFirstNotValidChar = ('indexOfFirstNotValidChar' in outputSequenceObj) ?
+          JSON.parse(outputSequenceObj.indexOfFirstNotValidChar!).indexOfFirstNotValidChar :
           -1;
-        if ('indexOfFirstNotValidCharacter' in outputSequenceObj) {
-          const indexOfFirstNotValidCharacter = ('indexOfFirstNotValidCharacter' in outputSequenceObj) ?
-            JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).indexOfFirstNotValidCharacter :
+        if ('indexOfFirstNotValidChar' in outputSequenceObj) {
+          const indexOfFirstNotValidChar = ('indexOfFirstNotValidChar' in outputSequenceObj) ?
+            JSON.parse(outputSequenceObj.indexOfFirstNotValidChar!).indexOfFirstNotValidChar :
             -1;
-          if (indexOfFirstNotValidCharacter != -1)
+          if (indexOfFirstNotValidChar != -1)
             errorsExist = true;
         }
 
         tableRows.push({
           'key': key,
-          'value': ('indexOfFirstNotValidCharacter' in outputSequenceObj) ?
+          'value': ('indexOfFirstNotValidChar' in outputSequenceObj) ?
             ui.divH([
-              ui.divText(sequence.slice(0, indexOfFirstNotValidCharacter), {style: {color: 'grey'}}),
+              ui.divText(sequence.slice(0, indexOfFirstNotValidChar), {style: {color: 'grey'}}),
               ui.tooltip.bind(
-                ui.divText(sequence.slice(indexOfFirstNotValidCharacter), {style: {color: 'red'}}),
-                'Expected format: ' + JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).expectedSynthesizer +
+                ui.divText(sequence.slice(indexOfFirstNotValidChar), {style: {color: 'red'}}),
+                'Expected format: ' + JSON.parse(outputSequenceObj.indexOfFirstNotValidChar!).synthesizer +
                 '. See tables with valid codes on the right',
               ),
             ]) : //@ts-ignore
@@ -67,13 +73,12 @@ export function sequenceTranslator(): void {
       }
 
       if (errorsExist) {
-        const expectedSynthesizer = JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!)
-          .expectedSynthesizer.slice(0, -6);
+        const synthesizer = JSON.parse(outputSequenceObj.indexOfFirstNotValidChar!).synthesizer.slice(0, -6);
         asoGapmersGrid.onCellPrepare(function(gc) {
-          gc.style.backColor = (gc.gridColumn.name == expectedSynthesizer) ? 0xFFF00000 : 0xFFFFFFFF;
+          gc.style.backColor = (gc.gridColumn.name == synthesizer) ? 0xFFF00000 : 0xFFFFFFFF;
         });
         omeAndFluoroGrid.onCellPrepare(function(gc) {
-          gc.style.backColor = (gc.gridColumn.name == expectedSynthesizer) ? 0xFFF00000 : 0xFFFFFFFF;
+          gc.style.backColor = (gc.gridColumn.name == synthesizer) ? 0xFFF00000 : 0xFFFFFFFF;
         });
         switchInput.enabled = true;
       } else {
@@ -85,15 +90,15 @@ export function sequenceTranslator(): void {
         ui.div([
           DG.HtmlTable.create(tableRows, (item: { key: string; value: string; }) =>
             [item.key, item.value], ['Code', 'Sequence']).root,
-        ], 'table'),
+        ]),
       );
-      semTypeOfInputSequence.textContent = 'Detected input type: ' + outputSequenceObj.type;
 
       if (outputSequenceObj.type != undefinedInputSequence && outputSequenceObj.Error != undefinedInputSequence) {
         const canvas = ui.canvas(300, 170);
         canvas.addEventListener('click', () => {
           const canv = ui.canvas($(window).width(), $(window).height());
-          const mol = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''), false, true);
+          const mol = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''), false, true,
+          output.synthesizer![0]);
           // @ts-ignore
           OCL.StructureView.drawMolecule(canv, OCL.Molecule.fromMolfile(mol), {suppressChiralText: true});
           ui.dialog('Molecule: ' + inputSequenceField.value)
@@ -102,7 +107,8 @@ export function sequenceTranslator(): void {
         });
         $(canvas).on('mouseover', () => $(canvas).css('cursor', 'zoom-in'));
         $(canvas).on('mouseout', () => $(canvas).css('cursor', 'default'));
-        const mol = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''), false, true);
+        const mol = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''), false, true,
+        output.synthesizer![0]);
         // @ts-ignore
         OCL.StructureView.drawMolecule(canvas, OCL.Molecule.fromMolfile(mol), {suppressChiralText: true});
         moleculeSvgDiv.append(canvas);
@@ -113,10 +119,14 @@ export function sequenceTranslator(): void {
     }
   }
 
-  const semTypeOfInputSequence = ui.divText('');
+  const inputFormatChoiceInput = ui.choiceInput(
+    'Input format: ', 'Janssen GCRS Codes', Object.keys(map), (format: string) => {
+      updateTableAndMolecule(inputSequenceField.value.replace(/\s/g, ''), format, true);
+    });
   const moleculeSvgDiv = ui.block([]);
-  const outputTableDiv = ui.div([], 'table');
-  const inputSequenceField = ui.textInput('', defaultInput, (sequence: string) => updateTableAndMolecule(sequence));
+  const outputTableDiv = ui.div([]);
+  const inputSequenceField = ui.textInput('', defaultInput, (sequence: string) => updateTableAndMolecule(sequence,
+    inputFormatChoiceInput.value!, false));
 
   const asoDf = DG.DataFrame.fromObjects([
     {'Name': '2\'MOE-5Me-rU', 'BioSpring': '5', 'Janssen GCRS': 'moeT'},
@@ -155,12 +165,11 @@ export function sequenceTranslator(): void {
   );
 
   const overhangModificationsGrid = DG.Viewer.grid(
-    DG.DataFrame.fromObjects([
-      {'Name': '(invabasic)'},
-      {'Name': '(GalNAc-2-JNJ)'},
+    DG.DataFrame.fromColumns([
+      DG.Column.fromStrings('Name', Object.keys(MODIFICATIONS)),
     ])!, {showRowHeader: false, showCellTooltip: false},
   );
-  updateTableAndMolecule(defaultInput);
+  updateTableAndMolecule(defaultInput, inputFormatChoiceInput.value!, true);
 
   const appMainDescription = ui.info([
     ui.divText('How to convert one sequence:', {style: {'font-weight': 'bolder'}}),
@@ -191,8 +200,8 @@ export function sequenceTranslator(): void {
               ui.div([
                 inputSequenceField.root,
               ], 'input-base'),
-            ], 'sequenceInput'),
-            semTypeOfInputSequence,
+            ], 'inputSequence'),
+            ui.div([inputFormatChoiceInput], {style: {padding: '5px 0'}}),
             ui.block([
               ui.h1('Output'),
               outputTableDiv,
@@ -217,14 +226,16 @@ export function sequenceTranslator(): void {
 
   const topPanel = [
     ui.iconFA('download', () => {
-      const result = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''));
+      const result = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''), false, false,
+        inputFormatChoiceInput.value!);
       const element = document.createElement('a');
       element.setAttribute('href', 'data:text/plain;charset=utf-8,' + encodeURIComponent(result));
       element.setAttribute('download', inputSequenceField.value.replace(/\s/g, '') + '.mol');
       element.click();
     }, 'Save .mol file'),
     ui.iconFA('copy', () => {
-      navigator.clipboard.writeText(sequenceToSmiles(inputSequenceField.value.replace(/\s/g, '')))
+      navigator.clipboard.writeText(
+        sequenceToSmiles(inputSequenceField.value.replace(/\s/g, ''), false, inputFormatChoiceInput.value!))
         .then(() => grok.shell.info(sequenceWasCopied));
     }, 'Copy SMILES'),
     switchInput.root,
@@ -233,18 +244,6 @@ export function sequenceTranslator(): void {
   tabControl.onTabChanged.subscribe((_) =>
     v.setRibbonPanels([(tabControl.currentPane.name == 'MAIN') ? topPanel : []]));
   v.setRibbonPanels([topPanel]);
-
-  $('.sequence')
-    .children().css('padding', '5px 0');
-  $('.sequenceInput .input-base')
-    .css('margin', '0');
-  $('.sequenceInput textarea')
-    .css('resize', 'none')
-    .css('min-height', '50px')
-    .css('width', '100%')
-    .attr('spellcheck', 'false');
-  $('.sequenceInput select')
-    .css('width', '100%');
 }
 
 async function saveTableAsSdFile(table: DG.DataFrame) {
@@ -259,9 +258,10 @@ async function saveTableAsSdFile(table: DG.DataFrame) {
   const typeColumn = table.col(COL_NAMES.TYPE)!;
   let result = '';
   for (let i = 0; i < table.rowCount; i++) {
+    const format = getFormat(structureColumn.get(i));
     result += (typeColumn.get(i) == 'SS') ?
-      sequenceToMolV3000(structureColumn.get(i), false, true) + '\n' + `>  <Sequence>\nSense Strand\n\n` :
-      sequenceToMolV3000(structureColumn.get(i), true, true) + '\n' + `>  <Sequence>\nAnti Sense\n\n`;
+      sequenceToMolV3000(structureColumn.get(i), false, true, format!) + '\n' + `>  <Sequence>\nSense Strand\n\n` :
+      sequenceToMolV3000(structureColumn.get(i), true, true, format!) + '\n' + `>  <Sequence>\nAnti Sense\n\n`;
     for (const col of table.columns) {
       if (col.name != COL_NAMES.SEQUENCE)
         result += `>  <${col.name}>\n${col.get(i)}\n\n`;
@@ -324,6 +324,7 @@ export function oligoSdFile(table: DG.DataFrame) {
       return grok.shell.error('Columns already exist!');
 
     const sequence = t.col(COL_NAMES.SEQUENCE)!;
+    const salt = t.col(COL_NAMES.SALT)!;
     const equivalents = t.col(COL_NAMES.EQUIVALENTS)!;
 
     t.columns.addNewString(COL_NAMES.COMPOUND_NAME).init((i: number) => sequence.get(i));
@@ -331,11 +332,13 @@ export function oligoSdFile(table: DG.DataFrame) {
       sequence.getString(i) + '; duplex of SS: ' + sequence.getString(i - 2) + ' and AS: ' + sequence.getString(i - 1) :
       sequence.getString(i),
     );
+    const molWeightCol = saltsDf.col('MOLWEIGHT')!;
+    const saltNamesList = saltsDf.col('DISPLAY')!.toList();
     t.columns.addNewFloat(COL_NAMES.CPD_MW)
       .init((i: number) => molecularWeight(sequence.get(i), weightsObj));
-    const mwCol = t.col(COL_NAMES.CPD_MW)!;
     t.columns.addNewFloat(COL_NAMES.SALT_MASS).init((i: number) => {
-      const mw = mwCol.get(i);
+      const saltRowIndex = saltNamesList.indexOf(salt.get(i));
+      const mw = molWeightCol.get(saltRowIndex);
       return mw * equivalents.get(i);
     });
     t.columns.addNewCalculated(COL_NAMES.BATCH_MW,
@@ -367,7 +370,7 @@ export function oligoSdFile(table: DG.DataFrame) {
 
       view.table!.col(COL_NAMES.TYPE)!.setTag(DG.TAGS.CHOICES, '["AS", "SS", "Duplex"]');
       view.table!.col(COL_NAMES.OWNER)!.setTag(DG.TAGS.CHOICES, stringifyItems(usersDf.columns.byIndex(0).toList()));
-      view.table!.col(COL_NAMES.SALT)!.setTag(DG.TAGS.CHOICES, stringifyItems(saltsDf.columns.byIndex(1).toList()));
+      view.table!.col(COL_NAMES.SALT)!.setTag(DG.TAGS.CHOICES, stringifyItems(saltsDf.columns.byIndex(0).toList()));
       view.table!.col(COL_NAMES.SOURCE)!.setTag(DG.TAGS.CHOICES, stringifyItems(sourcesDf.columns.byIndex(0).toList()));
       view.table!.col(COL_NAMES.ICD)!.setTag(DG.TAGS.CHOICES, stringifyItems(icdsDf.columns.byIndex(0).toList()));
       view.table!.col(COL_NAMES.IDP)!.setTag(DG.TAGS.CHOICES, stringifyItems(idpsDf.columns.byIndex(0).toList()));

package/src/salts.ts

@@ -1,2 +1,2 @@
-export const SALTS_CSV = `CHARGE,DISPLAY,MOLWEIGHT
-  ,no Data Added,100`;
+export const SALTS_CSV = `DISPLAY,MOLWEIGHT
+no Data Added,100`;

package/src/structures-works/from-monomers.ts

@@ -2,8 +2,9 @@ import {map, stadardPhosphateLinkSmiles, SYNTHESIZERS, TECHNOLOGIES, MODIFICATIO
 import {isValidSequence} from './sequence-codes-tools';
 import {getNucleotidesMol} from './mol-transformations';
 
-export function sequenceToMolV3000(sequence: string, inverted: boolean = false, oclRender: boolean = false): string {
-  const obj = getObjectWithCodesAndSmiles(sequence);
+export function sequenceToMolV3000(sequence: string, inverted: boolean = false, oclRender: boolean = false,
+  format: string): string {
+  const obj = getObjectWithCodesAndSmiles(sequence, format);
   let codes = sortByStringLengthInDescendingOrder(Object.keys(obj));
   let i = 0;
   const smilesCodes:string[] = [];
@@ -38,8 +39,8 @@ export function sequenceToMolV3000(sequence: string, inverted: boolean = false,
   return getNucleotidesMol(smilesCodes, oclRender);
 }
 
-export function sequenceToSmiles(sequence: string, inverted: boolean = false): string {
-  const obj = getObjectWithCodesAndSmiles(sequence);
+export function sequenceToSmiles(sequence: string, inverted: boolean = false, format: string): string {
+  const obj = getObjectWithCodesAndSmiles(sequence, format);
   let codes = sortByStringLengthInDescendingOrder(Object.keys(obj));
   let i = 0;
   let smiles = '';
@@ -82,19 +83,26 @@ export function sequenceToSmiles(sequence: string, inverted: boolean = false): s
     smiles.slice(0, smiles.length - stadardPhosphateLinkSmiles.length + 1);
 }
 
-function getObjectWithCodesAndSmiles(sequence: string) {
+function getObjectWithCodesAndSmiles(sequence: string, format: string) {
   const obj: { [code: string]: string } = {};
-  for (const synthesizer of Object.keys(map)) {
-    for (const technology of Object.keys(map[synthesizer])) {
-      for (const code of Object.keys(map[synthesizer][technology]))
-        obj[code] = map[synthesizer][technology][code].SMILES;
+  if (format == null) {
+    for (const synthesizer of Object.keys(map)) {
+      for (const technology of Object.keys(map[synthesizer])) {
+        for (const code of Object.keys(map[synthesizer][technology]))
+          obj[code] = map[synthesizer][technology][code].SMILES;
+      }
+    }
+  } else {
+    for (const technology of Object.keys(map[format])) {
+      for (const code of Object.keys(map[format][technology]))
+        obj[code] = map[format][technology][code].SMILES;
     }
   }
   // TODO: create object based from synthesizer type to avoid key(codes) duplicates
-  const output = isValidSequence(sequence);
-  if (output.expectedSynthesizer == SYNTHESIZERS.MERMADE_12)
+  const output = isValidSequence(sequence, format);
+  if (output.synthesizer!.includes(SYNTHESIZERS.MERMADE_12))
     obj['g'] = map[SYNTHESIZERS.MERMADE_12][TECHNOLOGIES.SI_RNA]['g'].SMILES;
-  else if (output.expectedSynthesizer == SYNTHESIZERS.AXOLABS)
+  else if (output.synthesizer!.includes(SYNTHESIZERS.AXOLABS))
     obj['g'] = map[SYNTHESIZERS.AXOLABS][TECHNOLOGIES.SI_RNA]['g'].SMILES;
   return obj;
 }