trackler 2.2.1.0 → 2.2.1.1

data/tracks/go/config.json

@@ -1,7 +1,5 @@
 {
-  "slug": "go",
   "language": "Go",
-  "repository": "https://github.com/exercism/go",
   "active": true,
   "ignore_pattern": "example(?!.*test)",
   "foregone": [

data/tracks/groovy/config.json

@@ -4,98 +4,136 @@
   "repository": "https://github.com/exercism/groovy",
   "checklist_issue": 9,
   "active": false,
-  "deprecated": [
-
-  ],
   "foregone": [
 
   ],
   "exercises": [
     {
-      "difficulty": 1,
+      "uuid": "30dff5e7-f2a4-4d7b-be1e-765091958a92",
       "slug": "hello-world",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 1,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 2,
+      "uuid": "02bb7e44-2de1-4a14-a755-696b7cba5f4e",
       "slug": "hamming",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 2,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 4,
+      "uuid": "9dc8a916-f7a5-4ef0-9341-c0db11553323",
       "slug": "gigasecond",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 4,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 3,
+      "uuid": "9beb0df7-d55c-47af-8fef-791439c9ab38",
       "slug": "raindrops",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 3,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 2,
+      "uuid": "d7bc4ce7-c2fe-4564-b925-b0d67f7b748f",
       "slug": "rna-transcription",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 2,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 2,
+      "uuid": "16d2cb93-b903-4c37-9cd0-40096f0fb51c",
       "slug": "difference-of-squares",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 2,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 1,
+      "uuid": "7427df2a-74bb-4593-8ca7-7d0287a6792e",
       "slug": "leap",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 1,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 4,
+      "uuid": "307f0a89-f185-41de-9ab7-f8d7ebfa3a2b",
       "slug": "nth-prime",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 4,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 3,
+      "uuid": "ccfb87a5-51e3-4e7e-8e60-089a9d9b25d7",
       "slug": "robot-name",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 3,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 4,
+      "uuid": "915c4792-6949-4aef-826a-8fe5dbe2f59c",
       "slug": "roman-numerals",
-      "topics": [ "metaprogramming" ]
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 4,
+      "topics": [
+        "metaprogramming"
+      ]
     },
     {
-      "difficulty": 2,
+      "uuid": "4dded3ef-b07b-4d3d-b8c4-29d35d5845a3",
       "slug": "grains",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 2,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 3,
+      "uuid": "70405bb0-e229-49c8-ad60-6b1722b3c21d",
       "slug": "word-count",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 3,
       "topics": [
 
       ]
     },
     {
-      "difficulty": 3,
+      "uuid": "5f929d26-1a63-47eb-8698-c5374da70b62",
       "slug": "phone-number",
+      "core": false,
+      "unlocked_by": null,
+      "difficulty": 3,
       "topics": [
 
       ]

data/tracks/idris/config.json

@@ -1,7 +1,5 @@
 {
-  "slug": "idris",
   "language": "Idris",
-  "repository": "https://github.com/exercism/idris",
   "active": false,
   "deprecated": [
 

data/tracks/java/POLICIES.md

@@ -17,7 +17,7 @@ Our policies are not set-in-stone. They represent directions chosen at a point i
 
 | Track Event | Policies to review |
 |:------------|:-----------------|
-| Exercise added/updated | [Prefer instance methods](#prefer-instance-methods); [Avoid using final](#avoid-using-final); [Adhere to best practices](#adhere-to-best-practices); [Starter implementations](#starter-implementations); [Ignore noninitial tests](#ignore-noninitial-tests); [Multiple file submissions](#multiple-file-submissions) |
+| Exercise added/updated | [Prefer instance methods](#prefer-instance-methods); [Avoid using final](#avoid-using-final); [Adhere to best practices](#adhere-to-best-practices); [Starter implementations](#starter-implementations); [Ignore noninitial tests](#ignore-noninitial-tests); [Multiple file submissions](#multiple-file-submissions); [Name test class after class under test](#name-test-class-after-class-under-test)
 | Track rearranged | [Starter implementations](#starter-implementations); [Multiple file submissions](#multiple-file-submissions) |
 | New issue observed in track | [Good first patches](#good-first-patches) |
 | "Good first patch" issue completed | [Good first patches](#good-first-patches) |
@@ -71,3 +71,11 @@ References: [[1](https://github.com/exercism/java/issues/220#issue-196447088)]
 > The Installing Java instructions should seek to minimize the number of steps and the number of concepts a new-to-the-track practitioner needs to learn to get to coding.
 
 References: [[1](https://github.com/exercism/java/issues/395#issue-215734887)]
+
+### Name test class after class under test
+
+> If you're testing a class called `SomeClassName` then your test class should be called `SomeClassNameTest`. 
+
+> The exception to this is if the tests are split into several test classes where each test class tests different functionality. In that case each class should be named `SomeClassNameFunctionalityTest` where `Functionality` is the name of the functionality to be tested in that class. See the [clock exercise](https://github.com/exercism/java/tree/master/exercises/clock) as an example.
+
+References: [[1](https://github.com/exercism/java/issues/697)]

data/tracks/java/exercises/nucleotide-count/src/example/java/{DNA.java → NucleotideCounter.java}

@@ -1,14 +1,14 @@
 import java.util.HashMap;
 import java.util.Map;
 
-public final class DNA {
+final class NucleotideCounter {
   private final String sequence;
 
-  public DNA(String sequence) {
+  NucleotideCounter(String sequence) {
     this.sequence = sequence;
   }
 
-  public int count(char base) {
+  int count(char base) {
     if (isCountable(base))
       throw new IllegalArgumentException(base + " is not a nucleotide");
 
@@ -24,7 +24,7 @@ public final class DNA {
     return COUNTABLE_NUCLEOTIDES.indexOf(base) == -1;
   }
 
-  public Map<Character, Integer> nucleotideCounts() {
+  Map<Character, Integer> nucleotideCounts() {
     Map<Character, Integer> counts = emptyCounts();
     for (char c : sequence.toCharArray()) {
       counts.put(c, counts.get(c) + 1);

data/tracks/java/exercises/nucleotide-count/src/test/java/{NucleotideTest.java → NucleotideCounterTest.java}

@@ -8,22 +8,22 @@ import java.util.Map;
 import static org.hamcrest.Matchers.*;
 import static org.junit.Assert.*;
 
-public class NucleotideTest {
+public class NucleotideCounterTest {
 
     @Rule
     public ExpectedException expectedException = ExpectedException.none();
 
     @Test
     public void testEmptyDnaStringHasNoAdenine() {
-        DNA dna = new DNA("");
-        assertThat(dna.count('A'), is(0));
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("");
+        assertThat(nucleotideCounter.count('A'), is(0));
     }
 
     @Ignore("Remove to run test")
     @Test
     public void testEmptyDnaStringHasNoNucleotides() {
-        DNA dna = new DNA("");
-        Map<Character, Integer> counts = dna.nucleotideCounts();
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("");
+        Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
         assertThat(counts.size(), is(4));
         assertThat(counts, allOf(
                 hasEntry('A', 0),
@@ -36,15 +36,15 @@ public class NucleotideTest {
     @Ignore("Remove to run test")
     @Test
     public void testRepetitiveCytosineGetsCounted() {
-        DNA dna = new DNA("CCCCC");
-        assertThat(dna.count('C'), is(5));
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("CCCCC");
+        assertThat(nucleotideCounter.count('C'), is(5));
     }
 
     @Ignore("Remove to run test")
     @Test
     public void testRepetitiveSequenceWithOnlyGuanine() {
-        DNA dna = new DNA("GGGGGGGG");
-        Map<Character, Integer> counts = dna.nucleotideCounts();
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("GGGGGGGG");
+        Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
         assertThat(counts.size(), is(4));
         assertThat(counts, allOf(
                 hasEntry('A', 0),
@@ -57,24 +57,24 @@ public class NucleotideTest {
     @Ignore("Remove to run test")
     @Test
     public void testCountsOnlyThymine() {
-        DNA dna = new DNA("GGGGGTAACCCGG");
-        assertThat(dna.count('T'), is(1));
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("GGGGGTAACCCGG");
+        assertThat(nucleotideCounter.count('T'), is(1));
     }
 
     @Ignore("Remove to run test")
     @Test
     public void testCountsANucleotideOnlyOnce() {
-        DNA dna = new DNA("CGATTGGG");
-        dna.count('T');
-        assertThat(dna.count('T'), is(2));
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("CGATTGGG");
+        nucleotideCounter.count('T');
+        assertThat(nucleotideCounter.count('T'), is(2));
     }
 
     @Ignore("Remove to run test")
     @Test
     public void testDnaCountsDoNotChangeAfterCountingAdenine() {
-        DNA dna = new DNA("GATTACA");
-        dna.count('A');
-        Map<Character, Integer> counts = dna.nucleotideCounts();
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("GATTACA");
+        nucleotideCounter.count('A');
+        Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
         assertThat(counts.size(), is(4));
         assertThat(counts, allOf(
                 hasEntry('A', 3),
@@ -88,16 +88,16 @@ public class NucleotideTest {
     @Test
     public void testValidatesNucleotides() {
         expectedException.expect(IllegalArgumentException.class);
-        DNA dna = new DNA("GACT");
-        dna.count('X');
+        NucleotideCounter nucleotideCounter = new NucleotideCounter("GACT");
+        nucleotideCounter.count('X');
     }
 
     @Ignore("Remove to run test")
     @Test
     public void testCountsAllNucleotides() {
         String s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
-        DNA dna = new DNA(s);
-        Map<Character, Integer> counts = dna.nucleotideCounts();
+        NucleotideCounter nucleotideCounter = new NucleotideCounter(s);
+        Map<Character, Integer> counts = nucleotideCounter.nucleotideCounts();
         assertThat(counts.size(), is(4));
         assertThat(counts, allOf(
                 hasEntry('A', 20),

data/tracks/kotlin/exercises/rotational-cipher/README.md

@@ -0,0 +1,39 @@
+# Rotational Cipher
+
+Create an implementation of the rotational cipher, also sometimes called the Caesar cipher.
+
+The Caesar cipher is a simple shift cipher that relies on
+transposing all the letters in the alphabet using an integer key
+between `0` and `26`. Using a key of `0` or `26` will always yield
+the same output due to modular arithmetic. The letter is shifted
+for as many values as the value of the key.
+
+The general notation for rotational ciphers is `ROT + <key>`.
+The most commonly used rotational cipher is `ROT13`.
+
+A `ROT13` on the Latin alphabet would be as follows:
+
+```plain
+Plain:  abcdefghijklmnopqrstuvwxyz
+Cipher: nopqrstuvwxyzabcdefghijklm
+```
+
+It is stronger than the Atbash cipher because it has 27 possible keys, and 25 usable keys.
+
+Ciphertext is written out in the same formatting as the input including spaces and punctuation.
+
+## Examples
+- ROT5  `omg` gives `trl`
+- ROT0  `c` gives `c`
+- ROT26 `Cool` gives `Cool`
+- ROT13 `The quick brown fox jumps over the lazy dog.` gives `Gur dhvpx oebja sbk whzcf bire gur ynml qbt.`
+- ROT13 `Gur dhvpx oebja sbk whzcf bire gur ynml qbt.` gives `The quick brown fox jumps over the lazy dog.`
+
+
+
+## Source
+
+Wikipedia [https://en.wikipedia.org/wiki/Caesar_cipher](https://en.wikipedia.org/wiki/Caesar_cipher)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.

data/tracks/lfe/config.json

@@ -1,7 +1,5 @@
 {
-  "slug": "lfe",
   "language": "Lisp Flavoured Erlang (LFE)",
-  "repository": "https://github.com/exercism/lfe",
   "active": true,
   "deprecated": [
     "accumulate"

data/tracks/lisp/config.json

@@ -1,7 +1,5 @@
 {
-  "slug": "common-lisp",
   "language": "Common Lisp",
-  "repository": "https://github.com/exercism/common-lisp",
   "active": true,
   "exercises": [
     {
@@ -383,10 +381,10 @@
       "slug": "pascals-triangle",
       "difficulty": 1,
       "topics": [
-          "Control-flow (loops)",
-          "Mathematics",
-          "Integers",
-          "Sequences"
+        "Control-flow (loops)",
+        "Mathematics",
+        "Integers",
+        "Sequences"
       ]
     }
   ],

data/tracks/lisp/config/exercise_readme.go.tmpl

@@ -0,0 +1,16 @@
+# {{ .Spec.Name }}
+
+{{ .Spec.Description -}}
+{{- with .Hints }}
+{{ . }}
+{{ end }}
+{{- with .TrackInsert }}
+{{ . }}
+{{ end }}
+{{- with .Spec.Credits -}}
+## Source
+
+{{ . }}
+{{ end }}
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.

data/tracks/lisp/exercises/allergies/README.md

@@ -0,0 +1,84 @@
+# Allergies
+
+Given a person's allergy score, determine whether or not they're allergic to a given item, and their full list of allergies.
+
+An allergy test produces a single numeric score which contains the
+information about all the allergies the person has (that they were
+tested for).
+
+The list of items (and their value) that were tested are:
+
+* eggs (1)
+* peanuts (2)
+* shellfish (4)
+* strawberries (8)
+* tomatoes (16)
+* chocolate (32)
+* pollen (64)
+* cats (128)
+
+So if Tom is allergic to peanuts and chocolate, he gets a score of 34.
+
+Now, given just that score of 34, your program should be able to say:
+
+- Whether Tom is allergic to any one of those allergens listed above.
+- All the allergens Tom is allergic to.
+
+Note: a given score may include allergens **not** listed above (i.e.
+allergens that score 256, 512, 1024, etc.).  Your program should
+ignore those components of the score.  For example, if the allergy
+score is 257, your program should only report the eggs (1) allergy.
+
+
+## Setup
+
+Check out [Exercism Help](http://exercism.io/languages/lisp) for instructions to
+get started writing Common Lisp. That page will explain how to install and setup
+a Lisp implementation and how to run the tests.
+
+## Formatting
+
+While Common Lisp doesn't care about indentation and layout of code,
+nor whether you use spaces or tabs, this is an important consideration
+for submissions to exercism.io. Excercism.io's code widget cannot
+handle mixing of tab and space characters well so using only spaces is recommended to make
+the code more readable to the human reviewers. Please review your
+editors settings on how to accomplish this. Below are instructions for
+popular editors for Common Lisp.
+
+### VIM
+
+Use the following commands to ensure VIM uses only spaces for
+indentation:
+
+```vimscript
+:set tabstop=2
+:set shiftwidth=2
+:set expandtab
+```
+
+(or as a oneliner `:set tabstop=2 shiftwidth=2 expandtab`). This can
+be added to your `~/.vimrc` file to use it all the time.
+
+### Emacs
+
+Emacs is very well suited for editing Common Lisp and has many
+powerful add-on packages available. The only thing that one needs to
+do with a stock emacs to make it work well with exercism.io is to
+evaluate the following code:
+
+`(setq indent-tab-mode nil)`
+
+This can be placed in your `~/.emacs` (or `~/.emacs.d/init.el`) in
+order to have it set whenever Emacs is launched.
+
+One suggested add-on for Emacs and Common Lisp is
+[SLIME](https://github.com/slime/slime) which offers tight integration
+with the REPL; making iterative coding and testing very easy.
+
+## Source
+
+Jumpstart Lab Warm-up [http://jumpstartlab.com](http://jumpstartlab.com)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.