sequenceserver 1.0.0.pre.5 → 1.0.0

data/spec/blast_spec.rb

@@ -0,0 +1,297 @@
+require 'spec_helper'
+
+# Test BLAST module.
+module SequenceServer
+  sample_reports = File.join(SequenceServer.root, 'spec', 'sample_reports')
+
+  with_hits      = File.join(sample_reports, 'with_hits_sample.asn')
+  no_hits        = File.join(sample_reports, 'no_hits_sample.asn')
+
+  describe 'Report' do
+    hits_report = BLAST::Report.new(with_hits)
+    no_hits_report = BLAST::Report.new(no_hits)
+
+    it 'will return an Array of queries' do
+      hits_report.queries.should be_a Array
+      no_hits_report.queries.should be_a Array
+    end
+
+    it 'will return a Hash of stats' do
+      hits_report.stats.should be_a Hash
+      no_hits_report.stats.should be_a Hash
+    end
+
+    it 'contains all the necessary stats' do
+      hits_report.stats.length.should eql(7)
+      no_hits_report.stats.length.should eql(7)
+    end
+  end
+
+  describe 'Query' do
+    hits_report = BLAST::Report.new(with_hits)
+    no_hits_report = BLAST::Report.new(no_hits)
+
+    it 'will return queries with valid length' do
+      hits_report.queries.first.length.should be_a Fixnum
+      hits_report.queries.first.length.should satisfy { |n| n > 0 }
+      no_hits_report.queries.first.length.should be_a Fixnum
+      no_hits_report.queries.first.length.should satisfy { |n| n > 0 }
+    end
+
+    it 'will return an Array of hits' do
+      hits_report.queries.first.hits.should be_a Array
+      no_hits_report.queries.first.hits.should be_a Array
+    end
+  end
+
+  describe 'Hits' do
+    hits_report = BLAST::Report.new(with_hits)
+    no_hits_report = BLAST::Report.new(no_hits)
+
+    it 'will have non zero length' do
+      hits_report.queries.last.hits.first.length.should satisfy { |n| n > 0 }
+    end
+
+    it 'will return an Array of HSPs' do
+      hits_report.queries.first.hits.first.hsps.should be_a Array
+    end
+
+    it 'will return an Array with atleast one HSP' do
+      hits_report.queries.first.hits.first.hsps.length.should be >= 1
+    end
+
+    it 'will contain no element if no hits were obtained' do
+      no_hits_report.queries.first.hits.length.should eql(0)
+    end
+  end
+
+  # Test general features of HSPs. Algorithm specific customizations are
+  # tested separetly.
+  describe 'HSPs' do
+    hits_report = BLAST::Report.new(with_hits)
+
+    # Currently using all 17 HSP parameters in BLAST Report + 1 to refer to the
+    # hit object it belongs to.
+    it 'have all the necessary values' do
+      hits_report.queries.last.hits.first.hsps.last.count.should eql(18)
+    end
+
+    # Test Random HSPs to ensure that all the values from HSP struct are valid.
+    it 'have correct alignment values' do
+      hits_report.queries.last.hits.first.hsps.last.bit_score.should be_a Float
+      hits_report.queries.last.hits.first.hsps.last.score.should be_a Fixnum
+
+      hits_report.queries.first.hits.first.hsps.first.evalue.should be_a Float
+      hits_report.queries.first.hits.first.hsps.first.evalue
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.first.hits.last.hsps.first.qstart.should be_a Fixnum
+      hits_report.queries.first.hits.last.hsps.first.qstart
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.first.hits.last.hsps.first.qend.should be_a Fixnum
+      hits_report.queries.first.hits.last.hsps.first.qend
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.last.hits.last.hsps.last.sstart.should be_a Fixnum
+      hits_report.queries.last.hits.last.hsps.last.sstart
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.first.hits.first.hsps.last.send.should be_a Fixnum
+      hits_report.queries.first.hits.first.hsps.last.send
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.first.hits.first.hsps.last.qframe.should be_a Fixnum
+      hits_report.queries.first.hits.first.hsps.last.sframe.should be_a Fixnum
+
+      hits_report.queries.first.hits.first.hsps.last.identity.should be_a Fixnum
+      hits_report.queries.first.hits.first.hsps.last.identity
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.first.hits.first.hsps.last.gaps.should be_a Fixnum
+      hits_report.queries.first.hits.first.hsps.last.gaps
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.first.hits.first.hsps.last.positives
+        .should be_a Fixnum
+      hits_report.queries.first.hits.first.hsps.last.positives
+        .should_not satisfy { |n| n < 0 }
+
+      hits_report.queries.first.hits.first.hsps.last.length.should be_a Fixnum
+      hits_report.queries.first.hits.first.hsps.last.length
+        .should satisfy { |n| n > 0 }
+
+      hits_report.queries.last.hits.last.hsps.first.qseq.should be_a String
+      hits_report.queries.last.hits.last.hsps.first.sseq.should be_a String
+      hits_report.queries.last.hits.last.hsps.first.midline.should be_a String
+    end
+
+    it 'have correctly matched query, hit and midline alignments' do
+      hsp = hits_report.queries.last.hits.last.hsps.first
+      hsp.qseq.length.should eql(hsp.sseq.length)
+      hsp.sseq.length.should eql(hsp.midline.length)
+      hsp.midline.length.should eql(hsp.qseq.length)
+    end
+
+    it 'have correct pretty printing' do
+      hsp = hits_report.queries.last.hits.last.hsps.first
+      pp  = hsp.pp
+
+      pp.should_not be_empty
+      pp.should be_a_kind_of(String)
+      (pp.lines.count % 3).should eql(0)
+
+      pp.should match(/^Query/)
+      pp.should match(/Subject/)
+    end
+
+    it 'have relevant stats' do
+      hsp   = hits_report.queries.last.hits.last.hsps.last
+      stats = hsp.stats
+
+      stats.size.should be >= 4
+      stats.should include('Score', 'E value', 'Identities', 'Gaps')
+
+      stats['Score'].should be_a Array
+      stats['Identities'].should be_a Array
+      stats['Gaps'].should be_a Array
+    end
+  end
+
+  # Individually test different BLAST+ algorithms
+  #
+  describe 'BLASTN' do
+    let 'hsp' do
+      report = BLAST::Report.new(File.join(sample_reports,
+                                           'blastn_sample.asn'))
+      report.queries.first.hits.last.hsps.first
+    end
+
+    it 'have correct query and subject frame' do
+      [1, -1].should include(hsp.qframe)
+      [1, -1].should include(hsp.sframe)
+
+      hsp.qframe_unit.should eq(1)
+      hsp.sframe_unit.should eq(1)
+    end
+
+    it 'have correct qstart, qend, sstart, send' do
+      if hsp.sframe > 0
+        hsp.sstart.should be <= hsp.send
+      else
+        hsp.sstart.should be >= hsp.send
+      end
+    end
+
+    it 'have relevant stats' do
+      hsp.stats.size.should eq(5)
+      hsp.stats.should include('Strand')
+    end
+  end
+
+  describe 'BLASTP' do
+    let 'hsp' do
+      report = BLAST::Report.new(File.join(sample_reports,
+                                           'blastp_sample.asn'))
+      report.queries.first.hits.last.hsps.first
+    end
+
+    it 'have correct query and subject frame' do
+      hsp.qframe.should eql(0)
+      hsp.sframe.should eql(0)
+
+      hsp.qframe_unit.should eq(1)
+      hsp.sframe_unit.should eq(1)
+    end
+
+    it 'have correct qstart, qend, sstart, send values' do
+      hsp.qstart.should be <= hsp.qend
+      hsp.sstart.should be <= hsp.send
+    end
+
+    it 'have relevant stats' do
+      hsp.stats.size.should eq(5)
+      hsp.stats.should include('Positives')
+    end
+  end
+
+  describe 'BLASTX' do
+    let 'hsp' do
+      report = BLAST::Report.new(File.join(sample_reports,
+                                           'blastx_sample.asn'))
+
+      report.queries.first.hits.last.hsps.first
+    end
+
+    it 'have correct query and subject frame' do
+      hsp.qframe.should_not eql(0)
+      hsp.sframe.should eql(0)
+
+      hsp.qframe_unit.should eq(3)
+      hsp.sframe_unit.should eq(1)
+    end
+
+    it 'have correct qstart, qend, sstart, send' do
+      hsp.qstart.should be <= hsp.qend
+      hsp.sstart.should be <= hsp.send
+    end
+
+    it 'have relevant stats' do
+      hsp.stats.size.should eq(5)
+      hsp.stats.should include('Query frame')
+    end
+  end
+
+  describe 'TBLASTX' do
+    let 'hsp' do
+      report = BLAST::Report.new(File.join(sample_reports,
+                                           'tblastx_sample.asn'))
+      report.queries.first.hits.last.hsps.first
+    end
+
+    it 'have correct query and subject frame' do
+      hsp.qframe.should_not eql(0)
+      hsp.sframe.should_not eql(0)
+
+      hsp.qframe_unit.should eq(3)
+      hsp.sframe_unit.should eq(3)
+    end
+
+    it 'have correct qstart, qend, sstart, send' do
+      hsp.qstart.should be <= hsp.qend
+      hsp.sstart.should be <= hsp.send
+    end
+
+    it 'have relevant stats' do
+      hsp.stats.size.should eq(6)
+      hsp.stats.should include('Frame')
+      hsp.stats.should include('Positives')
+    end
+  end
+
+  describe 'TBLASTN' do
+    let 'hsp' do
+      report = BLAST::Report.new(File.join(sample_reports,
+                                           'tblastn_sample.asn'))
+      report.queries.first.hits.last.hsps.first
+    end
+
+    it 'have correct query and subject frame' do
+      hsp.qframe.should eql(0)
+      hsp.sframe.should_not eql(0)
+
+      hsp.qframe_unit.should eq(1)
+      hsp.sframe_unit.should eq(3)
+    end
+
+    it 'have correct qstart, qend, sstart, send' do
+      hsp.qstart.should be <= hsp.qend
+      hsp.sstart.should be <= hsp.send
+    end
+
+    it 'have relevant stats' do
+      hsp.stats.size.should eq(5)
+      hsp.stats.should include('Hit frame')
+    end
+  end
+end

data/spec/capybara_spec.rb

@@ -0,0 +1,51 @@
+require 'spec_helper'
+require 'capybara/rspec'
+require 'capybara-webkit'
+
+describe 'a browser', :js => true do
+  sequence = 'ATCGATCAGCTACGATCAGCATCGACTAGCATCGACTACGA'
+  sample_nucl_db = 'Sinvicta2-2-3.cdna.subset.fasta'
+  # sample_prot_db = 'Sinvicta2-2-3.prot'
+
+  before(:all) do
+    Capybara.javascript_driver = :webkit
+    Capybara.default_wait_time = 5
+
+    options = { :database_dir => SequenceServer.root }
+    Capybara.app = SequenceServer.init(options)
+  end
+
+  it 'runs a simple blastn search' do
+    visit '/'
+    fill_in('sequence', :with => sequence)
+    check(sample_nucl_db)
+    click_button('method')
+    page.should have_content('Query')
+  end
+
+  it 'properly controls blast button' do
+    visit '/'
+
+    fill_in('sequence', :with => sequence)
+    page.evaluate_script("$('#method').is(':disabled')").should eq(true)
+
+    check(sample_nucl_db)
+    page.evaluate_script("$('#method').is(':disabled')").should eq(false)
+  end
+
+  it 'properly controls interaction with database listing' do
+    visit '/'
+    fill_in('sequence', :with => sequence)
+    check(sample_nucl_db)
+    page.evaluate_script("$('.protein .checkbox').first().hasClass('disabled')")
+      .should eq(true)
+  end
+
+  it 'shows a dropdown menu when other blast methods are available' do
+    visit '/'
+    fill_in('sequence', :with => sequence)
+    check(sample_nucl_db)
+    page.save_screenshot('screenshot.png')
+    page.has_css?('button.dropdown-toggle').should eq(true)
+  end
+end

data/spec/config_spec.rb

@@ -0,0 +1,87 @@
+require 'spec_helper'
+require 'sequenceserver/config'
+
+# Test Config class.
+module SequenceServer
+  describe 'Config' do
+    let 'sample_config_file' do
+      File.join(SequenceServer.root, 'spec', 'sample.conf')
+    end
+
+    it 'behaves like a Hash' do
+      config = Config.new
+
+      config.should respond_to :[]
+      config.should respond_to :[]=
+      config.should respond_to :include?
+
+      config[:key] = 'value'
+      config[:key].should eq 'value'
+      config.include?(:key).should be_truthy
+    end
+
+    it 'has reasonable defaults' do
+      config = Config.new
+      config[:num_threads].should eq 1
+      config[:host].should eq '0.0.0.0'
+      config[:port].should eq 4567
+      config.config_file.should eq File.expand_path('~/.sequenceserver.conf')
+    end
+
+    it 'symbolizes keys' do
+      config = Config.new('key' => 'value')
+      config.include?('key').should be_falsey
+      config.include?(:key).should be_truthy
+      config[:key].should eq 'value'
+
+      config = Config.new(:config_file => sample_config_file)
+      config.include?('num_threads').should be_falsey
+      config.include?(:num_threads).should be_truthy
+    end
+
+    it 'changes database key, if present, to database_dir' do
+      # Does so for data Hash passed to Config.new.
+      config = Config.new(:database => 'database_dir')
+      config.include?(:database).should be_falsey
+      config[:database_dir].should eq 'database_dir'
+
+      # Does so for data parsed from config_file.
+      config = Config.new(:config_file => sample_config_file)
+      config.include?(:database).should be_falsey
+      config[:database_dir].should eq 'database_dir'
+
+      # If both database and database_dir key are present, database key is
+      # removed and database_dir key takes preecedence.
+      config = Config.new(:database     => 'database',
+                          :database_dir => 'database_dir')
+      config.include?(:database).should be_falsey
+      config[:database_dir].should eq 'database_dir'
+    end
+
+    it 'parses config_file and merges with defaults, values from config_file' \
+       'taking preecedence' do
+      config = Config.new(:config_file => sample_config_file)
+
+      # config_file key becomes config.config_file
+      config.include?(:config_file).should be_falsey
+      config.config_file.should eq sample_config_file
+
+      # First check that a default value is present. Then check that a value
+      # from config file is present.
+      #
+      # We use num_threads key from config_file to test. The default value of
+      # num_threads is 1, but is set to 10 in config_file. If the final value
+      # is 10, we have ensured that config_file takes preecedence over
+      # default values.
+      config[:port].should eq 4567
+      config[:num_threads].should eq 10
+    end
+
+    it 'merges arguments with defaults and values from config_file,' \
+       'arguments taking preecedence' do
+      config = Config.new(:config_file => sample_config_file,
+                          :num_threads => 20)
+      config[:num_threads].should eq 20
+    end
+  end
+end

data/spec/database/funky_ids/funky_ids.fa

@@ -0,0 +1,12 @@
+>abc|def
+GATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAG
+>abcdef#
+GATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAG
+>abc#def
+GATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAG
+>123#456
+GATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAG
+>123456#
+GATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAG
+>123456
+GATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAG