ruby-ensembl-api 0.9.6 → 1.0

data/samples/ensembl_genomes_example.rb

@@ -0,0 +1,60 @@
+#!/usr/bin/ruby
+
+require 'lib/ensembl'
+include Ensembl::Core
+
+DBConnection.ensemblgenomes_connect('bacillus_cereus_ZK',7) # Connect to the Ensembl Genomes MySQL server and fetch the data for 'bacillus_cereus_ZK'
+slice = Slice.fetch_by_region('chromosome',"Chromosome",4791870,4799024) # retrieve a slice for this specie
+
+puts "\nConnecting to 'bacillus_cereus_ZK' database..."
+# show all the species inside the collection, as 'bacillus_cereus_ZK' genome is stored inside the bacillus_collection database
+if  Collection.check
+  puts "Is this a collection? #{Collection.check}"
+  puts "\nOther species present inside the collection:"
+  Collection.species.each do |s|
+    puts s
+  end
+end
+
+puts "\nSequence:"
+# get the sequence
+puts slice.seq
+
+puts "\nGenes:"
+# get all the genes overlapping the slice
+genes = slice.genes
+genes.each do |g|
+  print "#{g.stable_id} #{g.name}\n"
+end
+
+# CHANGE DATABASE
+
+puts "\n########################\nConnecting to 'mycobacterium_collection' database..."
+DBConnection.ensemblgenomes_connect('mycobacterium_collection',7) # connect directly to a collection database
+slice = Slice.fetch_by_region('chromosome',"Chromosome",752908,759374,1,"Mycobacterium tuberculosis H37Rv") # manually set the species to fetch the slice from
+
+# show all the species inside the collection
+if  Collection.check
+  puts "\nIs this a collection? #{Collection.check}"
+  puts "\nOther species present inside the collection:"
+  Collection.species.each do |s|
+    puts s
+  end
+end
+
+puts "\nSequence:"
+# get the sequence
+puts slice.seq
+
+puts "\nGenes:"
+# get all the genes overlapping the slice
+genes = slice.genes
+genes.each do |g|
+  print "#{g.stable_id} #{g.name}\n"
+end
+
+
+
+
+
+

data/samples/examples_perl_tutorial.rb

@@ -0,0 +1,125 @@
+#!/usr/local/bin/ruby
+
+require File.dirname(__FILE__) + '/../lib/ensembl.rb'
+require 'yaml'
+require 'progressbar'
+
+include Ensembl::Core
+
+## Connecting to the Database
+DBConnection.connect('homo_sapiens',45)
+
+## Object adaptors
+# not necessary, ruby uses class methods instead
+
+## Slices
+puts "== Some slices: =="
+puts Slice.fetch_by_region('chromosome','X').to_yaml
+puts Slice.fetch_by_region('clone','AL359765.6').to_yaml
+puts Slice.fetch_by_region('supercontig','NT_011333').to_yaml
+puts Slice.fetch_by_region('chromosome', '20', 1000000, 2000000).to_yaml
+puts Slice.fetch_by_gene_stable_id('ENSG00000099889', 5000).to_yaml
+
+puts "== All chromosomes: =="
+Slice.fetch_all('chromosome', 'NCBI36').each do |chr|
+  puts chr.display_name
+end
+
+puts "== Number of clone slices: " + Slice.fetch_all('clone').length.to_s
+
+puts "== Subslices of chromosome 19 (length = 10000000; overlap = 250): =="
+Slice.fetch_by_region('chromosome','19').split(10000000, 250).each do |sub_slice|
+  puts sub_slice.display_name
+end
+
+puts "== Sequence of a very small slice: Chr19:112200..112250 =="
+slice = Slice.fetch_by_region('chromosome','19',112200,112250)
+puts slice.seq
+
+puts "== Query a slice about itself =="
+puts slice.to_yaml
+
+puts "== Get genes for a slice and print exons and introns=="
+slice = Slice.fetch_by_region('chromosome','19',112200,500000)
+slice.genes.each do |gene|
+  puts gene.stable_id
+  puts 'Exons for first transcript:'
+  puts gene.transcripts[0].exons.sort_by{|e| e.start}.collect{|e| e.start.to_s + '->' + e.stop.to_s}.join("\t")
+  puts 'Introns for first transcript:'
+  puts gene.transcripts[0].introns.sort_by{|i| i.start}.collect{|i| i.start.to_s + '->' + i.stop.to_s}.join("\t")
+  puts
+end
+
+puts "== Get DNA alignment features for 20:80000..88000 =="
+slice = Slice.fetch_by_region('chromosome','20',80000,88000)
+slice.dna_align_features[0..2].each do |daf|
+  puts daf.to_yaml
+end
+
+puts "== Get sequence for transcript ENST00000383673 =="
+transcript = Transcript.find_by_stable_id('ENST00000383673')
+puts transcript.seq
+
+puts "== Get synonyms for marker D9S1038E =="
+marker = Ensembl::Core::Marker.find_by_name('D9S1038E')
+marker.marker_synonyms[0..5].each do |ms|
+  puts ms.to_yaml
+end
+
+puts "== Get 5 features for this marker =="
+marker = Ensembl::Core::Marker.find_by_name('D9S1038E')
+marker.marker_features[0..5].each do |mf|
+  puts 'name: ' + marker.name
+  puts 'seq_region name: ' + mf.seq_region.name
+  puts 'start: ' + mf.seq_region_start.to_s
+  puts 'stop: ' + mf.seq_region_end.to_s
+end
+
+puts "== Get 5 features for chromosome 22 =="
+slice = Ensembl::Core::Slice.fetch_by_region('chromosome', '22')
+slice.marker_features.slice(0,5).each do |mf|
+  puts mf.marker.name + "\t" + mf.slice.display_name
+end
+
+puts "== Transcript: from cDNA to genomic positions =="
+transcript = Ensembl::Core::Transcript.find(276333)
+puts "Transcript is ENST00000215574"
+puts "Genomic position 488053 is cDNA position: " + transcript.genomic2cdna(488053).to_s
+puts "cDNA position 601 is genomic position: " + transcript.cdna2genomic(601).to_s
+puts "Genomic position 488053 is CDS position: " + transcript.genomic2cds(488053).to_s
+puts "CDS position 401 is genomic position: " + transcript.cds2genomic(401).to_s
+
+puts "== Transcript: get pieces of DNA for a transcript =="
+transcript = Ensembl::Core::Transcript.find_by_stable_id('ENST00000380593')
+puts transcript.stable_id
+puts "5'UTR: " + transcript.five_prime_utr_seq
+puts "3'UTR: " + transcript.three_prime_utr_seq
+puts "CDS: " + transcript.cds_seq
+puts "protein: " + transcript.protein_seq
+
+#### And now we'll do some stuff with cows.
+CoreDBConnection.connection.disconnect!
+CoreDBConnection.connect('bos_taurus')
+
+puts "== Projecting a slice from component to assembly: =="
+puts "==   scaffold Chr4.003.105:42..2007 to chromosome level =="
+source_slice = Slice.fetch_by_region('scaffold','Chr4.003.105', 42, 2007)
+target_slices = source_slice.project('chromosome')
+puts target_slices.collect{|s| s.display_name}.join("\n")
+
+puts "== Projecting a slice from assembly to components: =="
+puts "==   chromosome slice chr4:329500..380000 to contig level =="
+source_slice = Slice.fetch_by_region('chromosome', '4', 329500, 380000)
+target_slices = source_slice.project('contig')
+puts target_slices.collect{|s| s.display_name}.join("\n")
+
+puts "== Transforming a gene from chromosome level to scaffold level =="
+gene = Gene.find(2408)
+cloned_gene = gene.transform('scaffold')
+puts gene.slice.display_name
+puts cloned_gene.slice.display_name
+
+puts "== Relationships for Gene class =="
+puts 'belongs to: ' + Gene.reflect_on_all_associations(:belongs_to).collect{|a| a.name.to_s}.join(',')
+puts 'has many: ' + Gene.reflect_on_all_associations(:has_many).collect{|a| a.name.to_s}.join(',')
+

data/samples/small_example_ruby_api.rb

@@ -0,0 +1,34 @@
+#!/usr/bin/ruby
+require '../lib/ensembl'
+
+include Ensembl::Core
+
+DBConnection.connect('homo_sapiens')
+
+puts "== Get a slice =="
+slice = Slice.fetch_by_region('chromosome','4',10000,99999,-1)
+puts slice.display_name
+
+puts "== Print all gene for that slice (regardless of what coord_system genes are annotated on) =="
+slice.genes.each do |gene|
+  puts gene.stable_id + "\t" + gene.status + "\t" + gene.slice.display_name
+end
+
+puts "== Get a transcript and print its 5'UTR, CDS and protein sequence =="
+transcript = Transcript.find_by_stable_id('ENST00000380593')
+puts "5'UTR: " + transcript.five_prime_utr_seq
+puts "CDS: " + transcript.cds_seq
+puts "peptide: " + transcript.protein_seq
+
+DBConnection.connection.disconnect!
+DBConnection.connect('bos_taurus',45)
+
+puts "== Transforming a cow gene from chromosome level to scaffold level =="
+gene = Gene.find(2408)
+cloned_gene = gene.transform('scaffold')
+puts "Original: " + gene.slice.display_name
+puts "Now: " + cloned_gene.slice.display_name
+
+puts "== What things are related to a 'gene' object? =="
+puts 'Genes belong to: ' + Gene.reflect_on_all_associations(:belongs_to).collect{|a| a.name.to_s}.join(',')
+puts 'Genes have many: ' + Gene.reflect_on_all_associations(:has_many).collect{|a| a.name.to_s}.join(',')

data/samples/variation_example.rb

@@ -0,0 +1,67 @@
+#!/usr/bin/ruby
+
+# Based on Perl API tutorial 
+# http://www.ensembl.org/info/using/api/variation/variation_tutorial.html
+
+
+require File.dirname(__FILE__) + '/../lib/ensembl.rb'
+include Ensembl::Core
+include Ensembl::Variation
+
+Ensembl::Variation::DBConnection.connect('homo_sapiens',60)
+# The connection with the Core database can be omitted. It is created automatically
+# when needed, using Variation DB connection parameters. The database name is derived 
+# from Variation DB name. If you are using non conventional DB names (i.e. for a local copy of Ensembl database)
+# an exception will be raised. Otherwise, if a Core DB connection is already 
+# present, that connection will be used by default, instead of creating a new one.
+
+id = ['rs73514758','rs77811736']
+
+id.each do |i|
+  v = Variation.find_by_name(i)
+  v.variation_features.each do |vf|
+    
+    up_seq,down_seq = vf.flanking_seq # retrieve upstream and downstream flanking sequences
+    
+    seq_region_name = vf.fetch_region.seq_region.name # fetch the genomic region of the Variation and get the region name.
+                                                      # Automatically sets the connection with Core DB, if needed.
+    
+    puts "\n== VARIATION FEATURE =="
+    print "NAME: #{vf.variation_name}\n ALLELE: #{vf.allele_string}\n UPSTREAM SEQ: #{up_seq.seq} \n DOWNSTREAM SEQ:  #{down_seq.seq}\n SEQ REGION NAME :#{seq_region_name}\n"
+    vf.transcript_variations.each do |tv|
+      t = tv.transcript # retrieve Ensembl::Core::Transcript from Core DB. Automatically sets the connection, if necessary. 
+      puts "== TRANSCRIPT VARIATION =="
+      print "ALLELE PEPTIDE STRING: #{tv.peptide_allele_string} TRANSCRIPT STABLE ID: #{t.stable_id} GENE STABLE ID: #{t.gene.stable_id}\n"
+    end
+  end
+end
+
+# Returns all Variations present on a gemomic region
+
+puts "\n== SEARCHING FOR VARIATIONS ON CHR:1:50000:51000 =="
+
+# Even in this case, Variation DB connection can be set automatically by specific Slice methods
+
+s = Slice.fetch_by_region('chromosome',1,50000,51000) 
+variation_features = s.get_variation_features # automatically sets the connection with Variation DB, if needed.
+variation_features.each do |vf|
+  print "NAME: #{vf.variation_name} ALLELE: #{vf.allele_string} SEQ REGION NAME: #{vf.seq_region.name}\n"
+end
+
+puts "\n== GENOTYPED VARIATIONS =="
+
+genotyped_variation_features = s.get_genotyped_variation_features # automatically sets the connection with Variation DB, if needed.
+genotyped_variation_features.each do |gvf|
+  print "NAME: #{gvf.variation_name} ALLELE: #{gvf.allele_string} SEQ REGION NAME: #{gvf.seq_region.name}\n"
+end
+
+puts "\n== STRUCTURAL VARIATIONS ON CHR:11:60125:320837 =="
+slice = Ensembl::Core::Slice.fetch_by_region('chromosome',11,60125,320837)
+structural_variations = s.get_structural_variations
+structural_variations.each do |sv|
+  print "NAME: #{sv.variation_name} SEQ REGION NAME: #{sv.seq_region.name}\n"
+end
+
+puts "\n== What things are related to a 'variation' object? =="
+puts 'Variation belong to: ' + Variation.reflect_on_all_associations(:belongs_to).collect{|a| a.name.to_s}.join(',')
+puts 'Variation have many: ' + Variation.reflect_on_all_associations(:has_many).collect{|a| a.name.to_s}.join(',')

data/test/unit/{release_56 → release_60}/core/test_gene.rb

@@ -1,5 +1,5 @@
 #
-# = test/unit/release_56/core/test_gene.rb - Unit test for Ensembl::Core
+# = test/unit/release_53/core/test_gene.rb - Unit test for Ensembl::Core
 #
 # Copyright::   Copyright (C) 2009 Francesco Strozzi <francesco.strozzi@gmail.com>
 #
@@ -19,7 +19,7 @@ include Ensembl::Core
 class TestGene < Test::Unit::TestCase
   
   def setup
-    DBConnection.connect('homo_sapiens', 56)
+    DBConnection.connect('homo_sapiens', 60)
   end
   
   def teardown
@@ -31,10 +31,10 @@ class TestGene < Test::Unit::TestCase
     assert_equal("ENSG00000006451",g.stable_id)
     assert_equal("7",g.seq_region.name)
     assert_equal(39663082,g.start)
-    assert_equal(39747723 ,g.stop)
+    assert_equal(39747723,g.stop)
     assert_equal(1,g.strand)
     assert_equal(84642,g.seq.length)
-    assert_equal("Ras-related protein Ral-A Precursor  [Source:UniProtKB/Swiss-Prot;Acc:P11233]",g.description)
+    assert_equal("v-ral simian leukemia viral oncogene homolog A (ras related) [Source:HGNC Symbol;Acc:9839]",g.description)
     assert_equal("RALA",g.name)
   end
   
@@ -42,9 +42,9 @@ class TestGene < Test::Unit::TestCase
     g = Gene.find_by_stable_id("ENSG00000006451")
     t = g.transcripts
     assert_equal(5,t.size)
-    assert_equal("ENST00000434466",t[0].stable_id)
+    assert_equal("ENST00000005257",t[0].stable_id)
     t = t[0]
-    assert_equal(768,t.seq.length)
+    assert_equal(2880,t.seq.length)
   end
   
   def test_exons

data/test/unit/release_60/core/test_project_human.rb

@@ -0,0 +1,38 @@
+#
+# = test/unit/test_project.rb - Unit test for Ensembl::Core
+#
+# Copyright::   Copyright (C) 2009
+#               Jan Aerts <http://jandot.myopenid.com>
+#               Francesco Strozzi <francesco.strozzi@gmail.com>
+# License::     Ruby's
+#
+# $Id:
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+require 'test/unit'
+require 'lib/ensembl'
+
+include Ensembl::Core
+
+class AssemblyExceptions < Test::Unit::TestCase
+  
+  def setup
+    DBConnection.connect('homo_sapiens', 60)
+  end
+  
+  def teardown
+    DBConnection.remove_connection
+  end
+  
+  def test_chr_x
+    source_slice = Slice.fetch_by_region('chromosome','X', 2709497, 2709520)
+    assert_equal('ctgaagaattgtgtttcttcccta', source_slice.seq)
+  end
+
+  def test_slice_overlapping_PAR_and_allosome
+    source_slice = Slice.fetch_by_region('chromosome','Y',2709500,2709540)
+    assert_equal('AGAAACTGAAAATGCTAAGAAATTCAGTTCCAGGATATGAA', source_slice.seq.upcase)
+  end
+
+end

data/test/unit/{release_56 → release_60}/core/test_slice.rb

@@ -19,7 +19,7 @@ include Ensembl::Core
 class TestSlice < Test::Unit::TestCase
   
   def setup
-    DBConnection.connect('homo_sapiens', 56)
+    DBConnection.connect('homo_sapiens', 60)
   end
   
   def teardown
@@ -44,11 +44,4 @@ class TestSlice < Test::Unit::TestCase
     assert_equal(31786816,s_rev.stop)
   end
 
-  def test_slice_genes
-  	slice = Slice.fetch_by_region("chromosome","13",31773073,31909413,1)
-	genes = slice.genes
-	assert_equal("ENSG00000229427",genes[1].stable_id)
-  	assert_equal("ENSG00000187676",genes[0].stable_id)
-  end
-
 end

data/test/unit/release_60/core/test_transcript.rb

@@ -0,0 +1,126 @@
+#
+# = test/unit/test_transcript.rb - Unit test for Ensembl::Core
+#
+# Copyright::   Copyright (C) 2007
+#               Jan Aerts <http://jandot.myopenid.com>
+# License::     Ruby's
+#
+# $Id:
+require 'pathname'
+libpath = Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 4, 'lib')).cleanpath.to_s
+$:.unshift(libpath) unless $:.include?(libpath)
+
+require 'test/unit'
+
+require 'lib/ensembl'
+
+include Ensembl::Core
+
+DBConnection.connect('homo_sapiens', 60)
+
+class CodingPositions < Test::Unit::TestCase
+  def setup
+    # Transcript tr_fw is ENST00000215574
+    @tr_fw = Transcript.find_by_stable_id("ENST00000215574")
+    # Transcript tr_rev is ENST00000358041
+    @tr_rev = Transcript.find_by_stable_id("ENST00000358041")
+  end
+
+  def test_transcript_coords
+    assert_equal(531733, @tr_fw.seq_region_start)
+    assert_equal(542084, @tr_fw.seq_region_end)
+    assert_equal(644371, @tr_rev.seq_region_start)
+    assert_equal(647309, @tr_rev.seq_region_end)
+  end
+
+  def test_coding_regions_genomic_coords_of_fw
+    assert_equal(531932, @tr_fw.coding_region_genomic_start)
+    assert_equal(541552, @tr_fw.coding_region_genomic_end)
+  end
+
+  def test_coding_regions_genomic_coords_of_rev
+    assert_equal(646652, @tr_rev.coding_region_genomic_start)
+    assert_equal(647047, @tr_rev.coding_region_genomic_end)
+  end
+  
+  def test_coding_regions_cdna_coords_of_fw
+    assert_equal(200, @tr_fw.coding_region_cdna_start)
+    assert_equal(910, @tr_fw.coding_region_cdna_end)
+  end
+
+  def test_coding_regions_cdna_coords_of_rev
+    assert_equal(263, @tr_rev.coding_region_cdna_start)
+    assert_equal(658, @tr_rev.coding_region_cdna_end)
+  end
+  
+end
+
+class GenomicVsCDna < Test::Unit::TestCase
+  #From BioMart. Columns:
+  #  Ensembl_Transcript_ID
+  #  Chromosome
+  #  Strand
+  #  Ensembl_Exon_ID
+  #  Exon_Chr_Start
+  #  Exon_Chr_End
+  #  Exon_Rank_in_Transcript
+  #ENST00000215574	19	1	ENSE00000655676	531733	532108	1
+  #ENST00000215574	19	1	ENSE00000655677	535837	535923	2
+  #ENST00000215574	19	1	ENSE00000655678	536243	536340	3
+  #ENST00000215574	19	1	ENSE00000655679	537013	537147	4
+  #ENST00000215574	19	1	ENSE00000655680	541339	542084	5
+  #
+  #ENST00000315489	19	-1	ENSE00001215510	474621	474983	1
+  #ENST00000315489	19	-1	ENSE00001215495	472394	472501	2
+  #ENST00000315489	19	-1	ENSE00001215487	467649	467762	3
+  #ENST00000315489	19	-1	ENSE00001215506	463344	464364	4
+  def setup
+    # Transcript tr_fw is ENST00000215574
+    @tr_fw = Transcript.find_by_stable_id("ENST00000215574")
+    # Transcript tr_rev is ENST00000315489
+    @tr_rev = Transcript.find_by_stable_id("ENST00000315489")
+  end
+  
+  def test_identify_exon
+    assert_equal("ENSE00000655679", @tr_fw.exon_for_cdna_position(601).stable_id)
+    assert_equal("ENSE00000655679", @tr_fw.exon_for_genomic_position(537052).stable_id)
+    assert_equal("ENSE00001215487", @tr_rev.exon_for_cdna_position(541).stable_id)
+    assert_equal("ENSE00001215487", @tr_rev.exon_for_genomic_position(467693).stable_id)
+  end
+  
+  def test_cdna2genomic
+    assert_equal(537052, @tr_fw.cdna2genomic(601))
+    assert_equal(467693, @tr_rev.cdna2genomic(541))
+  end
+  
+  def test_cds2genomic
+    assert_equal(537052, @tr_fw.cds2genomic(401))
+    assert_equal(467693, @tr_rev.cds2genomic(304))
+  end
+  
+  def test_genomic2cdna
+    assert_equal(601, @tr_fw.genomic2cdna(537052))
+    assert_equal(541, @tr_rev.genomic2cdna(467693))
+  end
+  
+  def test_genomic2cds
+    assert_equal(401, @tr_fw.genomic2cds(537052))
+    assert_equal(304, @tr_rev.genomic2cds(467693))
+  end
+end
+
+class TestIntron < Test::Unit::TestCase
+  def setup
+    @transcript = Transcript.find_by_stable_id("ENST00000215574")
+    @introns = @transcript.introns
+  end
+  
+  def test_get_introns
+    assert_equal(4, @introns.length)
+  end
+  
+  def test_intron_slices
+    assert_equal('chromosome:GRCh37:19:532109:535836:1', @introns[0].slice.to_s)
+  end
+end
+