bioroebe 0.10.80 → 0.12.12

data/lib/bioroebe/count/count_amount_of_aminoacids.rb

@@ -143,7 +143,8 @@ class CountAmountOfAminoacids < ::Bioroebe::CommandlineApplication # === Bioroeb
     # ======================================================================= #
     if @be_verbose
       erev "This protein (#{yellow(n_members.to_s)}#{rev} aminoacids) has "\
-           "the following aminoacid composition (Frame 1)."; e
+           "#{olivedrab('the following aminoacid composition')}#{rev} "\
+           "(Frame 1)."; e
     end
     sorted = @hash.sort_by(&:first)
     sorted.each {|key, value|
@@ -158,7 +159,7 @@ class CountAmountOfAminoacids < ::Bioroebe::CommandlineApplication # === Bioroeb
         ') ('+name_of_the_aminoacid+')' if @be_verbose
     }
     if @be_verbose
-      report_how_many_aminoacids_we_have_found
+      report_how_many_aminoacids_we_have_found; e
       report_the_molecular_mass_of_these_aminoacids
       report_the_number_of_negatively_and_positively_charged_residues
       report_the_atomic_composition

data/lib/bioroebe/count/count_amount_of_nucleotides.rb

@@ -425,6 +425,9 @@ class CountAmountOfNucleotides < ::Bioroebe::CommandlineApplication # === Bioroe
     if File.exist? i.to_s
       i = File.read(i.to_s).strip.delete(N)
     end
+    if i.is_a? Array
+      i = i.join(' ').strip
+    end
     i = i.to_s.dup if i.frozen?
     i.upcase! # Want to keep it upcased.
     @dna_string = i

data/lib/bioroebe/crystal/README.md

@@ -0,0 +1,2 @@
+This may contain experimental crystal support for the bioroebe
+project.

data/lib/bioroebe/crystal/to_rna.cr

@@ -0,0 +1,19 @@
+module Bioroebe
+
+  # ========================================================================= #
+  # === Bioroebe.to_rna
+  # ========================================================================= #
+  def self.to_rna(i = ARGV)
+    if i.is_a? Array
+      i = i.first?
+    end
+    if i.nil? || i.empty?
+      return i
+    else
+      return i.gsub("T","U")
+    end
+  end
+
+end
+
+puts Bioroebe.to_rna(ARGV)

data/lib/bioroebe/data/README.md

@@ -1,10 +1,13 @@
-This directory may contain some FASTA files or .pdb files, as
-that may be of help of people who end up using the BioRoebe
-project.
+This directory may contain some FASTA files or .pdb files, as that may 
+be of help of people who end up using the BioRoebe project.
+
+That dataset can be quickly tested and used to demonstrate how the 
+BioRoebe project works.
+
+In the pdb/ directory there is presently only one .pdb file. This 
+file is used mostly for a test .rb file in the test/ directory.
+
+The directory electron_microscopy/ is used primarily for cryo-electron
+microscopy and what not, using software such as relion.
 
-That dataset can be quickly tested and used to demonstrate how
-the BioRoebe project works.
 
-In the pdb/ directory there is presently only one .pdb file.
-This file is used mostly for a test .rb file in the test/
-directory.

data/lib/bioroebe/data/electron_microscopy/pos_example.pos

@@ -0,0 +1,396 @@
+# XMIPP_STAR_1 * 
+# 
+data_mic_1_36kx_4
+loop_
+ _xcoor
+ _ycoor
+ _cost
+      2950         48     2.000000 
+      2965         69     2.000000 
+      2991         65     2.000000 
+      2927        346     2.000000 
+      2961        368     2.000000 
+      3043        421     2.000000 
+      3092        311     2.000000 
+      3067        306     2.000000 
+      3075        271     2.000000 
+      3064        256     2.000000 
+      3115        357     2.000000 
+      2854        466     2.000000 
+      2886        510     2.000000 
+      2902        474     2.000000 
+      3036        563     2.000000 
+      3030        579     2.000000 
+      2890        755     2.000000 
+      2926        755     2.000000 
+      2972        730     2.000000 
+      2466        394     2.000000 
+      2444        421     2.000000 
+      2468        438     2.000000 
+      2486        400     2.000000 
+      2352        440     2.000000 
+      2359        266     2.000000 
+      2368        293     2.000000 
+      2407        286     2.000000 
+      2347        168     2.000000 
+      2361        136     2.000000 
+      2368        110     2.000000 
+      2358         90     2.000000 
+      2326         86     2.000000 
+      2161        166     2.000000 
+      2155        139     2.000000 
+      2129        152     2.000000 
+      2126        184     2.000000 
+      2028        141     2.000000 
+      2036        112     2.000000 
+      2000        104     2.000000 
+      2018         74     2.000000 
+      1970         66     2.000000 
+      1960         45     2.000000 
+      1940         57     2.000000 
+      2005         26     2.000000 
+      1686        190     2.000000 
+      1667        216     2.000000 
+      1628        210     2.000000 
+      1688        238     2.000000 
+      1707        215     2.000000 
+      1678        262     2.000000 
+      1836        368     2.000000 
+      1861        404     2.000000 
+      2092        256     2.000000 
+      2223        308     2.000000 
+      2219        338     2.000000 
+      2244        326     2.000000 
+      2270        324     2.000000 
+      2181        438     2.000000 
+      2271        452     2.000000 
+      2281        676     2.000000 
+      2253        748     2.000000 
+      2100        684     2.000000 
+      2068        700     2.000000 
+      2083        731     2.000000 
+      2102        805     2.000000 
+      2354        856     2.000000 
+      2384        860     2.000000 
+      2508        822     2.000000 
+      2545        839     2.000000 
+      2531        869     2.000000 
+      2551        886     2.000000 
+      2585        892     2.000000 
+      2580        916     2.000000 
+      2597        872     2.000000 
+      2624        859     2.000000 
+      2573       1103     2.000000 
+      2529       1125     2.000000 
+      2562       1132     2.000000 
+      3109        913     2.000000 
+      3138        894     2.000000 
+      3159        910     2.000000 
+      3162        877     2.000000 
+      3167        853     2.000000 
+      1744        946     2.000000 
+      1755        618     2.000000 
+      2048       1063     2.000000 
+      1499        131     2.000000 
+      1497        101     2.000000 
+      1530         75     2.000000 
+      1244        117     2.000000 
+      1227         54     2.000000 
+      1097        464     2.000000 
+       915        547     2.000000 
+       757        519     2.000000 
+       755        540     2.000000 
+       782        528     2.000000 
+       810        747     2.000000 
+       790        769     2.000000 
+       829        759     2.000000 
+      1355        767     2.000000 
+      1480        590     2.000000 
+      1505        585     2.000000 
+      1631        838     2.000000 
+      1587        854     2.000000 
+      1479        911     2.000000 
+      1460        925     2.000000 
+      1074       1064     2.000000 
+      1097       1120     2.000000 
+      1055       1151     2.000000 
+      1017       1159     2.000000 
+      1027       1185     2.000000 
+      2192        884     2.000000 
+      1606        530     2.000000 
+      1688        510     2.000000 
+       668        728     2.000000 
+       664        749     2.000000 
+       732       1000     2.000000 
+       764       1023     2.000000 
+       788        972     2.000000 
+       817        964     2.000000 
+       839        980     2.000000 
+       940        947     2.000000 
+       950        924     2.000000 
+       441        184     2.000000 
+       429        232     2.000000 
+       689        288     2.000000 
+       697        317     2.000000 
+       722        298     2.000000 
+       740        328     2.000000 
+       256        406     2.000000 
+       280        420     2.000000 
+       316        433     2.000000 
+       240        496     2.000000 
+       406        527     2.000000 
+       440        563     2.000000 
+       200        690     2.000000 
+       201        710     2.000000 
+       228        715     2.000000 
+       227        692     2.000000 
+       259        714     2.000000 
+        93        745     2.000000 
+        86        784     2.000000 
+       544        712     2.000000 
+       550        735     2.000000 
+       540        628     2.000000 
+       571        600     2.000000 
+       926        632     2.000000 
+       937        662     2.000000 
+      1374        208     2.000000 
+      1295        131     2.000000 
+       757         90     2.000000 
+      1337        903     2.000000 
+      1417        770     2.000000 
+       296        962     2.000000 
+       284        991     2.000000 
+       241        899     2.000000 
+       258        880     2.000000 
+        33        982     2.000000 
+        24       1007     2.000000 
+       100       1029     2.000000 
+       158       1149     2.000000 
+       190       1188     2.000000 
+       240       1205     2.000000 
+       309       1100     2.000000 
+       328       1144     2.000000 
+      1230       1118     2.000000 
+      1219       1158     2.000000 
+      1402        960     2.000000 
+      1300        812     2.000000 
+      1436        715     2.000000 
+      1289        721     2.000000 
+      1328        464     2.000000 
+      1441        401     2.000000 
+       481        234     2.000000 
+       474        257     2.000000 
+       561        351     2.000000 
+       600        350     2.000000 
+       594        370     2.000000 
+       444        431     2.000000 
+        88        629     2.000000 
+        91        845     2.000000 
+       109        875     2.000000 
+       126        840     2.000000 
+       145        847     2.000000 
+       185       1022     2.000000 
+       342        829     2.000000 
+      1112        782     2.000000 
+      1169        587     2.000000 
+       309        149     2.000000 
+        89        507     2.000000 
+       255         78     2.000000 
+       164       1306     2.000000 
+       190       1327     2.000000 
+       158       1341     2.000000 
+       218       1473     2.000000 
+       222       1497     2.000000 
+       244       1488     2.000000 
+       465       1411     2.000000 
+       485       1394     2.000000 
+       493       1419     2.000000 
+       223       1610     2.000000 
+       208       1633     2.000000 
+       234       1639     2.000000 
+       142       1753     2.000000 
+       323       1762     2.000000 
+       336       1793     2.000000 
+       395       1659     2.000000 
+       569       1681     2.000000 
+       603       1678     2.000000 
+       587       1710     2.000000 
+       906       1477     2.000000 
+       930       1511     2.000000 
+       995       1549     2.000000 
+       888       1351     2.000000 
+       958       1317     2.000000 
+      1202       1287     2.000000 
+      1228       1279     2.000000 
+      1251       1297     2.000000 
+      1229       1323     2.000000 
+      1483       1430     2.000000 
+      1448       1357     2.000000 
+      1456       1451     2.000000 
+      1457       1474     2.000000 
+      1475       1476     2.000000 
+      1256       1651     2.000000 
+      1291       1656     2.000000 
+      1268       1683     2.000000 
+      1295       1683     2.000000 
+      1251       1722     2.000000 
+      1252       1751     2.000000 
+      1319       1696     2.000000 
+      1342       1715     2.000000 
+      1054       1679     2.000000 
+      1080       1671     2.000000 
+      1084       1649     2.000000 
+      1103       1632     2.000000 
+       682       1833     2.000000 
+       739       1840     2.000000 
+       766       1878     2.000000 
+       802       1883     2.000000 
+       824       1835     2.000000 
+       889       1816     2.000000 
+       900       1785     2.000000 
+       377       1971     2.000000 
+       361       1946     2.000000 
+        43       2293     2.000000 
+        63       2270     2.000000 
+        86       2175     2.000000 
+        33       1996     2.000000 
+       239       2028     2.000000 
+       399       2046     2.000000 
+       427       2077     2.000000 
+       314       2308     2.000000 
+       334       2320     2.000000 
+       277       2408     2.000000 
+       384       2419     2.000000 
+       512       2402     2.000000 
+       602       2176     2.000000 
+       588       2145     2.000000 
+       833       2365     2.000000 
+      1193       2275     2.000000 
+      1260       2290     2.000000 
+      1286       2299     2.000000 
+      1557       2185     2.000000 
+      1585       2216     2.000000 
+      1343       1890     2.000000 
+      1312       1868     2.000000 
+      1201       1843     2.000000 
+      1085       1763     2.000000 
+       476       1650     2.000000 
+      1339       1532     2.000000 
+      2314       1268     2.000000 
+      1791       1654     2.000000 
+      1762       1686     2.000000 
+      1746       1720     2.000000 
+      1811       1684     2.000000 
+      1837       1626     2.000000 
+      1864       1645     2.000000 
+      1876       1622     2.000000 
+      2003       1635     2.000000 
+      1997       1685     2.000000 
+      1960       1747     2.000000 
+      2035       1665     2.000000 
+      2049       1632     2.000000 
+      2063       1577     2.000000 
+      2123       1557     2.000000 
+      2208       1615     2.000000 
+      2215       1674     2.000000 
+      2191       1723     2.000000 
+      2165       1726     2.000000 
+      1973       1839     2.000000 
+      1883       1965     2.000000 
+      1867       1985     2.000000 
+      1709       1829     2.000000 
+      1626       1863     2.000000 
+      1646       1879     2.000000 
+      1678       1883     2.000000 
+      1678       1668     2.000000 
+      2226       1937     2.000000 
+      2205       1968     2.000000 
+      2225       1989     2.000000 
+      2239       1969     2.000000 
+      2258       1992     2.000000 
+      2329       1773     2.000000 
+      2343       1751     2.000000 
+      2287       2160     2.000000 
+      2265       2202     2.000000 
+      2254       2235     2.000000 
+      2234       2221     2.000000 
+      2477       2201     2.000000 
+      2464       2264     2.000000 
+      2522       2257     2.000000 
+      2568       2262     2.000000 
+      2569       2293     2.000000 
+      2599       2292     2.000000 
+      2635       2302     2.000000 
+      2635       2332     2.000000 
+      2822       2207     2.000000 
+      2845       2194     2.000000 
+      2855       2227     2.000000 
+      2858       2260     2.000000 
+      2851       2064     2.000000 
+      2831       2014     2.000000 
+      2845       1990     2.000000 
+      2793       1982     2.000000 
+      2555       1809     2.000000 
+      2557       1869     2.000000 
+      2550       1887     2.000000 
+      2555       1758     2.000000 
+      2547       1612     2.000000 
+      2567       1593     2.000000 
+      2509       1653     2.000000 
+      2437       1640     2.000000 
+      2408       1642     2.000000 
+      2860       1644     2.000000 
+      2859       1616     2.000000 
+      2881       1474     2.000000 
+      2723       1326     2.000000 
+      2737       1292     2.000000 
+      1865       2127     2.000000 
+      1940       2140     2.000000 
+      1982       2148     2.000000 
+      1923       2286     2.000000 
+      1973       2315     2.000000 
+      1744       2424     2.000000 
+      1641       2298     2.000000 
+      2700       2347     2.000000 
+      2735       2295     2.000000 
+      2741       2405     2.000000 
+      2742       2437     2.000000 
+      2479       2091     2.000000 
+      2458       2107     2.000000 
+      3164       2271     2.000000 
+      3138       2278     2.000000 
+      3085       2290     2.000000 
+      3057       2315     2.000000 
+      3030       2298     2.000000 
+      2973       2318     2.000000 
+      2945       2378     2.000000 
+      3037       2409     2.000000 
+      2928       1896     2.000000 
+      2908       1888     2.000000 
+      2986       1901     2.000000 
+      3006       1875     2.000000 
+      3036       1890     2.000000 
+      2924       1770     2.000000 
+      2921       1736     2.000000 
+      2865       1732     2.000000 
+      3010       1654     2.000000 
+      3009       1630     2.000000 
+      3000       1769     2.000000 
+      3020       1530     2.000000 
+      3079       1510     2.000000 
+      3119       1528     2.000000 
+      2247       1782     2.000000 
+      2486       1305     2.000000 
+      2608       1274     2.000000 
+      3063       1436     2.000000 
+      2964       1424     2.000000 
+      1961        883     2.000000 
+      1966        862     2.000000 
+      2410        785     2.000000 
+      3082       1221     2.000000 
+      3170       1103     2.000000 
+      2037       1232     2.000000 
+      2349       1462     2.000000 
+       581        213     2.000000 
+       593        764     2.000000 
+      1393        237     2.000000 

data/lib/bioroebe/data/electron_microscopy/test_particles.star

@@ -0,0 +1,36 @@
+
+data_images
+
+loop_ 
+_rlnImageName #1 
+_rlnCoordinateX #2 
+_rlnCoordinateY #3 
+_rlnMicrographName #4 
+000001@Particles/Micrographs/1_36kx_6_particles.mrcs   283.000000   285.000000 Micrographs/1_36kx_6.mrc 
+000002@Particles/Micrographs/1_36kx_6_particles.mrcs   187.000000   232.000000 Micrographs/1_36kx_6.mrc 
+000003@Particles/Micrographs/1_36kx_6_particles.mrcs   661.000000   377.000000 Micrographs/1_36kx_6.mrc 
+000004@Particles/Micrographs/1_36kx_6_particles.mrcs   702.000000   386.000000 Micrographs/1_36kx_6.mrc 
+000005@Particles/Micrographs/1_36kx_6_particles.mrcs   684.000000   407.000000 Micrographs/1_36kx_6.mrc 
+000006@Particles/Micrographs/1_36kx_6_particles.mrcs   684.000000   591.000000 Micrographs/1_36kx_6.mrc 
+000007@Particles/Micrographs/1_36kx_6_particles.mrcs   810.000000   297.000000 Micrographs/1_36kx_6.mrc 
+000008@Particles/Micrographs/1_36kx_6_particles.mrcs   786.000000   244.000000 Micrographs/1_36kx_6.mrc 
+000009@Particles/Micrographs/1_36kx_6_particles.mrcs   826.000000   247.000000 Micrographs/1_36kx_6.mrc 
+000010@Particles/Micrographs/1_36kx_6_particles.mrcs   847.000000   240.000000 Micrographs/1_36kx_6.mrc 
+000011@Particles/Micrographs/1_36kx_6_particles.mrcs   927.000000   376.000000 Micrographs/1_36kx_6.mrc 
+000012@Particles/Micrographs/1_36kx_6_particles.mrcs   930.000000   380.000000 Micrographs/1_36kx_6.mrc 
+000013@Particles/Micrographs/1_36kx_6_particles.mrcs   967.000000   412.000000 Micrographs/1_36kx_6.mrc 
+000014@Particles/Micrographs/1_36kx_6_particles.mrcs   948.000000   417.000000 Micrographs/1_36kx_6.mrc 
+000015@Particles/Micrographs/1_36kx_6_particles.mrcs   802.000000   552.000000 Micrographs/1_36kx_6.mrc 
+000016@Particles/Micrographs/1_36kx_6_particles.mrcs   778.000000   547.000000 Micrographs/1_36kx_6.mrc 
+000017@Particles/Micrographs/1_36kx_6_particles.mrcs   652.000000   549.000000 Micrographs/1_36kx_6.mrc 
+000018@Particles/Micrographs/1_36kx_6_particles.mrcs   464.000000   533.000000 Micrographs/1_36kx_6.mrc 
+000019@Particles/Micrographs/1_36kx_6_particles.mrcs   278.000000   653.000000 Micrographs/1_36kx_6.mrc 
+000020@Particles/Micrographs/1_36kx_6_particles.mrcs  1052.000000   653.000000 Micrographs/1_36kx_6.mrc 
+000021@Particles/Micrographs/1_36kx_6_particles.mrcs  1143.000000   671.000000 Micrographs/1_36kx_6.mrc 
+000022@Particles/Micrographs/1_36kx_6_particles.mrcs  1095.000000   119.000000 Micrographs/1_36kx_6.mrc 
+000023@Particles/Micrographs/1_36kx_6_particles.mrcs  1131.000000   102.000000 Micrographs/1_36kx_6.mrc 
+000024@Particles/Micrographs/1_36kx_6_particles.mrcs  1148.000000   122.000000 Micrographs/1_36kx_6.mrc 
+000025@Particles/Micrographs/1_36kx_6_particles.mrcs   434.000000   103.000000 Micrographs/1_36kx_6.mrc 
+000026@Particles/Micrographs/1_36kx_6_particles.mrcs   324.000000    72.000000 Micrographs/1_36kx_6.mrc 
+000027@Particles/Micrographs/1_36kx_6_particles.mrcs    82.000000    83.000000 Micrographs/1_36kx_6.mrc 
+000028@Particles/Micrographs/1_36kx_6_particles.mrcs   196.000000   495.000000 Micrographs/1_36kx_6.mrc 

data/lib/bioroebe/data/fasta/human/Homo_sapiens_hemoglobin_subunit_alpha_HBB_mRNA.fasta

@@ -0,0 +1,9 @@
+>NM_000558.5:38-466 Homo sapiens hemoglobin subunit alpha (HBA1), mRNA CDS for the 142 aa protein https://www.ncbi.nlm.nih.gov/protein/NP_000549.1
+
+ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCG
+AGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTT
+CGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCC
+GTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGG
+TGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGA
+GTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAA
+TACCGTTAA

data/lib/bioroebe/data/fasta/human/Homo_sapiens_hemoglobin_subunit_beta_HBB_mRNA.fasta

@@ -0,0 +1,8 @@
+>NM_000518.5 Homo sapiens hemoglobin subunit beta (HBB), mRNA CDS for the 147 aa protein https://www.ncbi.nlm.nih.gov/protein/NP_000509.1
+
+ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT
+GGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCC
+ACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGC
+CTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT
+CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCA
+CCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAA

data/lib/bioroebe/data/fasta/human/README.md

@@ -0,0 +1,2 @@
+Sequences specific to humans ("Homo sapiens") will be
+stored in this directory.

data/lib/bioroebe/electron_microscopy/coordinate_analyzer.rb

@@ -19,11 +19,6 @@ module ElectronMicroscopy
 
 class CoordinateAnalyzer < ::Bioroebe::CommandlineApplication # === Bioroebe::ElectronMicroscopy::CoordinateAnalyzer
 
-  # =========================================================================== #
-  # === NAMESPACE
-  # =========================================================================== #
-  NAMESPACE = inspect
-
   # =========================================================================== #
   # === STORE_HERE
   # =========================================================================== #
@@ -44,10 +39,7 @@ class CoordinateAnalyzer < ::Bioroebe::CommandlineApplication # === Bioroebe::El
   # =========================================================================== #
   def reset
     super()
-    # ========================================================================= #
-    # === @namespace
-    # ========================================================================= #
-    @namespace = NAMESPACE
+    infer_the_namespace
     # ========================================================================= #
     # === @dataset
     # ========================================================================= #
@@ -71,7 +63,7 @@ class CoordinateAnalyzer < ::Bioroebe::CommandlineApplication # === Bioroebe::El
   # Which internal base directory to use.
   # =========================================================================== #
   def base?
-    "#{ROEBE_HOME_DIR}Image*"
+    "#{log_dir?}image*"
   end
 
   # =========================================================================== #
@@ -94,10 +86,10 @@ class CoordinateAnalyzer < ::Bioroebe::CommandlineApplication # === Bioroebe::El
   # =========================================================================== #
   def analyze_dataset
     if @dataset.empty?
-      opnn; e 'Can not analyze anything as the dataset (from '+
-               simp(base?)+') is empty.'
+      erev 'Can not analyze anything as the dataset (from '+
+           simp(base?)+rev+') is empty.'
     else
-      opnn; e 'Analyzing the dataset.'
+      erev 'Analyzing the dataset.'
       @dataset.sort.each_with_index {|entry, index|
         index += 1
         index = '%02d' % index
@@ -105,7 +97,7 @@ class CoordinateAnalyzer < ::Bioroebe::CommandlineApplication # === Bioroebe::El
         data = data.select {|inner_entry| inner_entry.include? '    ' }
         n_lines = data.size
         entry = '%-41s' % entry
-        opnn; e '  '+sfile(entry)+' has '+simp(n_lines.to_s)+' particles.'
+        erev '  '+sfile(entry)+rev+' has '+simp(n_lines.to_s)+rev+' particles.'
         # Next, we store this directly into the file.
         append_what_into('Image '+index+': '+n_lines.to_s+N, store_where?)
         @n_total_particles += n_lines
@@ -132,16 +124,21 @@ class CoordinateAnalyzer < ::Bioroebe::CommandlineApplication # === Bioroebe::El
   # It will generate the file total_amount_of_particles. 
   # =========================================================================== #
   def generate_a_report
-    opnn; e "Now generating a report into `#{sfile(store_where?)}`."
-    append_what_into(N+N+'Total: '+@n_total_particles.to_s+N,
-      store_where?)
+    erev "Now generating a report into `#{sfile(store_where?)}#{rev}`."
+    append_what_into(
+      N+N+'Total: '+@n_total_particles.to_s+N,
+      store_where?
+    )
   end
 
   # =========================================================================== #
   # === startup_message
   # =========================================================================== #
   def startup_message
-    opnn; e 'We attempt to analyze the coordinates next.'
+    opnn { :no_trailing }
+    e
+    e
+    erev 'Attempting to analyze the coordinates next.'
   end
 
   # =========================================================================== #

data/lib/bioroebe/{fasta_and_fastq/parse_fasta/run.rb → electron_microscopy/electron_microscopy_module.rb}

@@ -2,19 +2,27 @@
 # Encoding: UTF-8
 # frozen_string_literal: true
 # =========================================================================== #
-# require 'bioroebe/fasta_and_fastq/parse_fasta/run.rb' 
+# require 'bioroebe/electron_microscopy/electron_microscopy_module.rb'
+# include Bioroebe::ElectronMicroscopy
 # =========================================================================== #
 module Bioroebe
 
-class ParseFasta < ::Bioroebe::CommandlineApplication # === Bioroebe::ParseFasta
+module ElectronMicroscopy
 
   # ========================================================================= #
-  # === run                                                         (run tag)
+  # === DEFAULT_XMIPP_HEADER
+  #
+  # The header for xmipp.
   # ========================================================================= #
-  def run
-    menu
-    do_process_the_commandline_arguments_that_are_files
-    do_save_the_file if save_the_file?
-  end
+  DEFAULT_XMIPP_HEADER = '# XMIPP_STAR_1 *
+#
+data_noname
+loop_
+ _image
+ _micrograph
+ _xcoor
+ _ycoor
+
+'
 
 end; end

data/lib/bioroebe/electron_microscopy/fix_pos_file.rb

@@ -18,11 +18,6 @@ class FixPosFile < ::Bioroebe::CommandlineApplication # === Bioroebe::ElectronMi
 
   require 'bioroebe/electron_microscopy/parse_coordinates.rb'
 
-  # ========================================================================= #
-  # === NAMESPACE
-  # ========================================================================= #
-  NAMESPACE = inspect
-
   # ========================================================================= #
   # === initialize
   # ========================================================================= #
@@ -43,10 +38,7 @@ class FixPosFile < ::Bioroebe::CommandlineApplication # === Bioroebe::ElectronMi
   def reset
     super()
     set_fix_this_pos_file
-    # ======================================================================= #
-    # === @namespace
-    # ======================================================================= #
-    @namespace = NAMESPACE
+    infer_the_namespace
   end
 
   # ========================================================================= #