bio 1.5.2 → 1.6.0.pre.20181210

data/doc/RELEASE_NOTES-1.5.0.rdoc

@@ -0,0 +1,285 @@
+= BioRuby 1.5.0 RELEASE NOTES
+
+A lot of changes have been made to the BioRuby 1.5.0 after the version 1.4.3
+is released. This document describes important and/or incompatible changes
+since the BioRuby 1.4.3 release.
+
+For known problems, see KNOWN_ISSUES.rdoc.
+
+== NEWS
+
+=== Full support of Ruby 2.0.0, 2.1, and 2.2
+
+Ruby 2.0.0, 2.1, and 2.2 are now recommended Ruby versions for running
+BioRuby codes.
+
+=== Support of Ruby 1.8 will be stopped
+
+This release is the final BioRuby version that can be run on Ruby 1.8.
+
+=== License is updated to the new Ruby's License
+
+BioRuby is distributed under the same license as Ruby's. In October 2011,
+Ruby's License was changed from a dual license with GPLv2 to a dual license
+with 2-clause BSDL. Since BioRuby 1.5.0, we have updated to the
+new version of Ruby's License. For details about the license, see COPYING
+or COPYING.ja and BSDL. In addition, please do not forget to see LEGAL for
+exception files that are subjected to different licenses.
+
+=== Semantic Versioning will be introduced
+
+We will adopt the Semantic Versioning since the next release version, which
+will be BioRuby 1.5.1. This means that BioRuby 1.5.0 is NOT subject to the
+Semantic Versioning.
+
+
+== New features and improvements
+
+=== New method Bio::FastaFormat#first_name
+
+Bio::FastaFormat#first_name method is added to get the first word in the
+definition line. This method was proposed by Ben J. Woodcroft.
+
+=== Accuracy of Bio::SiRNA
+
+Accuracy of siRNA designing algorithms in Bio::SiRNA is improved,
+contributed by meso_cacase.
+
+=== Speed up of Bio::ClustalW::Report
+
+Running speed of Bio::ClustalW::Report is optimized, contributed by
+Andrew Grimm.
+
+=== Many warning messages are squashed
+
+Most warning messages when running ruby with "-w" option, e.g. "assigned
+but unused variable", "instance variable @xxx not initialized", are
+suppressed. Fixes are contributed by Kenichi Kamiya, Andrew Grimm, and
+BioRuby core members.
+
+=== Refactoring of codes
+
+Many existing codes are reviewed and refactored. Patches are contributed
+by Iain Barnett, Kenichi Kamiya, and BioRuby core members.
+
+
+== Bug fixes
+
+=== Bugs due to remote server changes
+
+==== Bio::PubMed
+
+Bio::PubMed#search, query, and pmfetch are re-implemented by using NCBI
+E-Utilities. They were broken because unofficial API was used.
+Paul Leader reported the bug and gave discussion.
+
+==== Bio::Hinv
+
+Bio::Hinv did not work because of the API server URL is changed.
+
+==== Bio::TogoWS::REST
+
+* Bio::TogoWS::REST#search with offset and limit did not work due to
+  TogoWS server spec change about URI escape.
+* Bio::TogoWS::REST#convert did not work because of the spec change of
+  TogoWS REST API.
+
+=== Bio::Fetch
+
+Bio::Fetch with default parameters did not work because BioRuby's default
+BioFetch server had been down. We have decided not to restore the service.
+For smooth migration of codes using BioRuby's BioFetch server, we provide
+"bio-old-biofetch-emulator" gem. See below "Imcompatible changes" for details.
+
+The bug was reported and discussed by Jose Irizarry, Robert A. Heiler, and
+others.
+
+=== BioSQL
+
+* Only do gsub on bio_ref.reference.authors if it exists.
+* Missing require when generating genbank output for BioSQL sequence.
+
+Contributed by Brynjar Smari Bjarnason.
+
+=== Bugs found in data format parsers
+
+* Bio::PDB#seqres SEQRES serNum digits were extended in PDB v3.2 (2008).
+  Thanks to a researcher who sent the patch.
+* Bio::Blast::Default::Report parse error when subject sequence contains
+  spaces. Edward Rice reported the bug.
+* Bio::UniProtKB#gene_name raised NoMethodError when gene_names method
+  returns nil. It should return nil. Candidate fix sent by Jose Irizarry.
+* Bio::PhyloXML::Parser.open_uri did not return block return value when
+  giving a block.
+
+=== Other bugs
+
+* lib/bio/shell/plugin/seq.rb: String#step and #skip (extended by bioruby
+  shell) did not yield the last part of the string due to a change from
+  Ruby 1.8 to 1.9.
+* Documentation and typo fixes. Contributed by many persons, including
+  Iain Barnett and ctSkennerton.
+
+
+== Renamed features
+
+=== Bio::SPTR, Bio::UniProt, Bio::SwissProt, and Bio::TrEMBL => Bio::UniProtKB
+
+The classes for parsing UniProtKB (former SwissProt and TrEMBL) data,
+Bio::SPTR, Bio::UniProt, Bio::SwissProt, and Bio::TrEMBL, are unified into
+the new class name Bio::UniProtKB, and old names are deprecated.
+
+For keeping backward compatibility, old class names Bio::SPTR, Bio::UniProt,
+Bio::SwissProt, and Bio::TrEMBL are still available, but warning message
+will be shown when using the old class names. These old class names will be
+deleted in the future.
+
+The file contatining Bio::UniProtKB class definition is also changed to
+lib/bio/db/embl/uniprotkb.rb. For keeping backward compatibility, old
+files sptr.rb, uniprot.rb, tremble.rb are still kept, but they will be
+removed in the future.
+
+
+== Deprecated features
+
+=== Bio::RefSeq, Bio::DDBJ
+
+Bio::RefSeq and Bio::DDBJ are deprecated because they are only an alias of
+Bio::GenBank. Warning message will be shown when loading the classes and
+initializing new instances. Please use Bio::GenBank instead.
+
+lib/bio/db/genbank/ddbj.rb and lib/bio/db/genbank/refseq.rb which contain
+Bio::DDBJ and Bio::RefSeq, respectively, are also deprecated. For keeping
+backward compatibility, old file are still kept, but they will be removed
+in the future.
+
+
+== Removed features
+
+=== Bio::SOAPWSDL
+
+Bio::SOAPWSDL (lib/bio/io/soapwsdl.rb) is removed because SOAP4R
+(SOAP/WSDL library in Ruby) is no longer bundled with Ruby since Ruby 1.9.
+For Ruby 1.9 or later, some gems of SOAP4R are available, but we think they
+are not well-maintained. Moreover, many SOAP servers have been retired
+(see below). So, we give up maintaining Bio::SOAPWSDL and all SOAP client
+classes in BioRuby.
+
+=== Bio::EBI::SOAP
+
+Bio::EBI::SOAP (lib/bio/io/ebisoap.rb) is removed because Bio::SOAPWSDL
+is removed.
+
+=== Bio::KEGG::API
+
+Bio::KEGG::API is removed because KEGG API SOAP service was discontinued in
+December 31, 2012. See http://www.kegg.jp/kegg/rest/ for the announcement
+of service discontinuation.
+
+=== Bio::DBGET
+
+Bio::DBGET is removed because it only supports old original DBGET protocols
+that was discontinued in 2004. Note that the DBGET is still available via
+the web. See http://www.genome.jp/en/gn_dbget.html for details.
+
+=== Bio::Ensembl
+
+Bio::Ensembl is removed because it does not work after the renewal of Ensembl
+web site in 2008. Instead, bio-ensembl gem which supports recent ensembl API
+is available.
+
+=== Bio::DDBJ::XML, Bio::DDBJ::REST
+
+Bio::DDBJ::XML and Bio::DDBJ::REST are removed because DDBJ Web API (WABI)
+web services were suspended in 2012 and then they were completely renewed
+with incompatible APIs in 2013.
+
+=== Bio::HGC::HiGet
+
+Bio::HGC::HiGet (lib/bio/io/higet.rb) is removed because the HiGet web server
+http://higet.hgc.jp/ have been down since 2011, and we think that the server
+will not be restored again.
+
+=== Bio::NCBI::SOAP
+
+Bio::NCBI::SOAP is removed because it always raises error during the parsing
+of WSDL files provided by NCBI. In addition, NCBI announced that the SOAP
+web service for the E-utilities will be terminated on July 1, 2015. Instead,
+Bio::NCBI::REST, REST client for the NCBI E-utility web service, is available.
+
+=== Bio::KEGG::Taxonomy
+
+Bio::KEGG::Taxonomy is removed because it does not work correctly. It raises
+error, it falls into infinite loop, or it returns apparently broken data.
+Moreover, KEGG closed public FTP site and the file "taxonomy" could only be
+obtained by paid subscribers.
+
+=== Bio.method_missing
+
+Bio.method_missing, that aims to provide shortcuts of Bio::Shell methods
+with shorter name without typing "Shell", is removed because most of the
+methods raises error mainly due to bypassing of initialization procedure.
+In addition, we now think that the use of method_missing should generally
+be avoid unless it is really necessary.
+
+=== extconf.rb
+
+extconf.rb, an alternative way to install BioRuby to the system, is removed
+because of avoiding potential confusions. Nowadays, extconf.rb is usually
+only used for building native extensions, but no native extensions are
+included in this release. Use gem or setup.rb to install BioRuby.
+
+
+== Incompatible changes
+
+Also see the above "Renamed features", "Deprecated features", and
+"Removed features" sections.
+
+=== Bio::Fetch
+
+The BioRuby default BioFetch server http://bioruby.org/cgi-bin/biofetch.rb,
+that was the default server for Bio::Fetch before BioRuby 1.4, is deprecated.
+Due to the service stop, default server URL in Bio::Fetch is removed, and
+we decide not to give any server URL by default for Bio::Fetch.
+
+As an alternative, new class Bio::Fetch::EBI which uses the EBI Dbfetch
+server is added. When changing codes form Bio::Fetch to Bio::Fetch::EBI,
+be careful of the differences of database names, default and available
+data formats between the former BioRuby BioFetch server and the EBI Dbfetch
+server.
+
+Methods directly affected are:
+
+* Bio::Fetch.new (Bio::Fetch#initialize) does not have default server URL,
+  and URL of a server must always be explicitly given as the first argument.
+* Bio::Fetch.query is removed.
+
+For the purpose running old codes, it is recommended to install
+bio-old-biofetch-emulator gem. The bio-old-biofetch-emulator gem emulates
+old BioRuby's default BioFetch server by using other existing web services.
+See https://rubygems.org/gems/bio-old-biofetch-emulator for details.
+We think many codes can run with no changes by simply installing the gem and
+adding "-r bio-old-biofetch-emulator" into the command-line when executing
+ruby.
+
+
+== Known issues
+
+The following issues are added or updated. See KNOWN_ISSUES.rdoc for other
+already known issues.
+
+=== Bio::PDB
+
+Bio::PDB should be updated to follow PDB format version 3.3.
+
+=== Bio::Blast::Report
+
+NCBI announces that that they are makeing a new version of BLAST XML data
+format. BioRuby should support it.
+
+=== Bio::Blast::Default::Report
+
+Bio::Blast::Default::Report currently supports legacy BLAST only.
+It may be better to support BLAST+ text output format, although NCBI
+do not recommend to do so because the format is unstable.
+

data/doc/Tutorial.rd

@@ -1248,102 +1248,13 @@ annotated phylogenetic trees. PhyloXML's parser in BioRuby is implemented in
 Bio::PhyloXML::Parser, and its writer in Bio::PhyloXML::Writer. 
 More information can be found at ((<www.phyloxml.org|URL:http://www.phyloxml.org>)).
 
-== Requirements
+Bio::PhyloXML have been split out from BioRuby core and have been released
+as bio-phyloxml gem. To use Bio::PhyloXML, install the bio-phyloxml gem.
 
-In addition to BioRuby, you need the libxml Ruby bindings. To install, execute:
-
-  % gem install -r libxml-ruby
-
-For more information see the ((<libxml installer page|URL:http://libxml.rubyforge.org/install.xml>))
-
-== Parsing a file
-
-    require 'bio'
-    
-    # Create new phyloxml parser
-    phyloxml = Bio::PhyloXML::Parser.open('example.xml')
-    
-    # Print the names of all trees in the file
-    phyloxml.each do |tree|
-      puts tree.name
-    end
-
-If there are several trees in the file, you can access the one you wish by specifying its index:
-
-    tree = phyloxml[3]
-
-You can use all Bio::Tree methods on the tree, since PhyloXML::Tree inherits from Bio::Tree. For example, 
-
-   tree.leaves.each do |node|
-     puts node.name
-   end
-
-PhyloXML files can hold additional information besides phylogenies at the end of the file. This info can be accessed through the 'other' array of the parser object.
-
-    phyloxml = Bio::PhyloXML::Parser.open('example.xml')
-    while tree = phyloxml.next_tree
-      # do stuff with trees
-    end 
-      
-    puts phyloxml.other
-
-== Writing a file
-
-    # Create new phyloxml writer
-    writer = Bio::PhyloXML::Writer.new('tree.xml')
-   
-    # Write tree to the file tree.xml
-    writer.write(tree1) 
-    
-    # Add another tree to the file
-    writer.write(tree2)
-
-== Retrieving data
-
-Here is an example of how to retrieve the scientific name of the clades included in each tree.
-
-    require 'bio'
-    
-    phyloxml = Bio::PhyloXML::Parser.open('ncbi_taxonomy_mollusca.xml')
-    phyloxml.each do |tree|
-      tree.each_node do |node|
-        print "Scientific name: ", node.taxonomies[0].scientific_name, "\n"
-      end
-    end
-
-== Retrieving 'other' data
-
-    require 'bio'
-    
-    phyloxml = Bio::PhyloXML::Parser.open('phyloxml_examples.xml')
-    while tree = phyloxml.next_tree
-     #do something with the trees
-    end
-
-    p phyloxml.other
-    puts "\n"
-    #=> output is an object representation
-    
-    #Print in a readable way
-    puts phyloxml.other[0].to_xml, "\n"
-    #=>:
-    #
-    #<align:alignment xmlns:align="http://example.org/align">
-    #  <seq name="A">acgtcgcggcccgtggaagtcctctcct</seq>
-    #  <seq name="B">aggtcgcggcctgtggaagtcctctcct</seq>
-    #  <seq name="C">taaatcgc--cccgtgg-agtccc-cct</seq>
-    #</align:alignment>
-    
-    #Once we know whats there, lets output just sequences
-    phyloxml.other[0].children.each do |node|
-     puts node.value
-    end
-    #=>
-    #
-    #acgtcgcggcccgtggaagtcctctcct
-    #aggtcgcggcctgtggaagtcctctcct
-    #taaatcgc--cccgtgg-agtccc-cct
+  % gem install bio-phyloxml
 
+The tutorial of Bio::PhyloXML is bundled in bio-phyloxml.
+((<URL:https://github.com/bioruby/bioruby-phyloxml/blob/master/doc/Tutorial.rd>))
 
 == The BioRuby example programs
 
@@ -1446,8 +1357,7 @@ At the moment there is no easy way of accessing BioPerl or BioPython directly fr
 
 == Installing required external libraries
 
-At this point for using BioRuby no additional libraries are needed, except if
-you are using the Bio::PhyloXML module; then you have to install libxml-ruby.
+At this point for using BioRuby no additional libraries are needed.
 
 This may change, so keep an eye on the Bioruby website. Also when
 a package is missing BioRuby should show an informative message.
@@ -1457,18 +1367,6 @@ painful, as the gem standard for packages evolved late and some still
 force you to copy things by hand. Therefore read the README's
 carefully that come with each package.
 
-=== Installing libxml-ruby
-
-The simplest way is to use the RubyGems packaging system:
-
-  gem install -r libxml-ruby
-
-If you get `require': no such file to load - mkmf (LoadError) error then do
-
-  sudo apt-get install ruby-dev
-
-If you have other problems with installation, then see ((<URL:http://libxml.rubyforge.org/install.xml>)).
-
 == Trouble shooting
 
 * Error: in `require': no such file to load -- bio (LoadError)

data/doc/Tutorial.rd.html

@@ -1011,99 +1011,27 @@ ToDo: add exemaples from George. I remember he did some cool post on BioSQL and
 annotated phylogenetic trees. PhyloXML's parser in BioRuby is implemented in 
 Bio::PhyloXML::Parser, and its writer in Bio::PhyloXML::Writer. 
 More information can be found at <a href="http://www.phyloxml.org">www.phyloxml.org</a>.</p>
-<h2><a name="label-24" id="label-24">Requirements</a></h2><!-- RDLabel: "Requirements" -->
-<p>In addition to BioRuby, you need the libxml Ruby bindings. To install, execute:</p>
-<pre>% gem install -r libxml-ruby</pre>
-<p>For more information see the <a href="http://libxml.rubyforge.org/install.xml">libxml installer page</a></p>
-<h2><a name="label-25" id="label-25">Parsing a file</a></h2><!-- RDLabel: "Parsing a file" -->
-<pre>require 'bio'
-
-# Create new phyloxml parser
-phyloxml = Bio::PhyloXML::Parser.open('example.xml')
-
-# Print the names of all trees in the file
-phyloxml.each do |tree|
-  puts tree.name
-end</pre>
-<p>If there are several trees in the file, you can access the one you wish by specifying its index:</p>
-<pre>tree = phyloxml[3]</pre>
-<p>You can use all Bio::Tree methods on the tree, since PhyloXML::Tree inherits from Bio::Tree. For example, </p>
-<pre>tree.leaves.each do |node|
-  puts node.name
-end</pre>
-<p>PhyloXML files can hold additional information besides phylogenies at the end of the file. This info can be accessed through the 'other' array of the parser object.</p>
-<pre>phyloxml = Bio::PhyloXML::Parser.open('example.xml')
-while tree = phyloxml.next_tree
-  # do stuff with trees
-end 
-
-puts phyloxml.other</pre>
-<h2><a name="label-26" id="label-26">Writing a file</a></h2><!-- RDLabel: "Writing a file" -->
-<pre># Create new phyloxml writer
-writer = Bio::PhyloXML::Writer.new('tree.xml')
-
-# Write tree to the file tree.xml
-writer.write(tree1) 
-
-# Add another tree to the file
-writer.write(tree2)</pre>
-<h2><a name="label-27" id="label-27">Retrieving data</a></h2><!-- RDLabel: "Retrieving data" -->
-<p>Here is an example of how to retrieve the scientific name of the clades included in each tree.</p>
-<pre>require 'bio'
-
-phyloxml = Bio::PhyloXML::Parser.open('ncbi_taxonomy_mollusca.xml')
-phyloxml.each do |tree|
-  tree.each_node do |node|
-    print "Scientific name: ", node.taxonomies[0].scientific_name, "\n"
-  end
-end</pre>
-<h2><a name="label-28" id="label-28">Retrieving 'other' data</a></h2><!-- RDLabel: "Retrieving 'other' data" -->
-<pre>require 'bio'
-
-phyloxml = Bio::PhyloXML::Parser.open('phyloxml_examples.xml')
-while tree = phyloxml.next_tree
- #do something with the trees
-end
-
-p phyloxml.other
-puts "\n"
-#=&gt; output is an object representation
-
-#Print in a readable way
-puts phyloxml.other[0].to_xml, "\n"
-#=&gt;:
-#
-#&lt;align:alignment xmlns:align="http://example.org/align"&gt;
-#  &lt;seq name="A"&gt;acgtcgcggcccgtggaagtcctctcct&lt;/seq&gt;
-#  &lt;seq name="B"&gt;aggtcgcggcctgtggaagtcctctcct&lt;/seq&gt;
-#  &lt;seq name="C"&gt;taaatcgc--cccgtgg-agtccc-cct&lt;/seq&gt;
-#&lt;/align:alignment&gt;
-
-#Once we know whats there, lets output just sequences
-phyloxml.other[0].children.each do |node|
- puts node.value
-end
-#=&gt;
-#
-#acgtcgcggcccgtggaagtcctctcct
-#aggtcgcggcctgtggaagtcctctcct
-#taaatcgc--cccgtgg-agtccc-cct</pre>
-<h2><a name="label-29" id="label-29">The BioRuby example programs</a></h2><!-- RDLabel: "The BioRuby example programs" -->
+<p>Bio::PhyloXML have been split out from BioRuby core and have been released
+as bio-phyloxml gem. To use Bio::PhyloXML, install the bio-phyloxml gem.</p>
+<pre>% gem install bio-phyloxml</pre>
+<p>The tutorial of Bio::PhyloXML is bundled in bio-phyloxml.
+<a href="https://github.com/bioruby/bioruby-phyloxml/blob/master/doc/Tutorial.rd">&lt;URL:https://github.com/bioruby/bioruby-phyloxml/blob/master/doc/Tutorial.rd&gt;</a></p>
+<h2><a name="label-24" id="label-24">The BioRuby example programs</a></h2><!-- RDLabel: "The BioRuby example programs" -->
 <p>Some sample programs are stored in ./samples/ directory. For example, the n2aa.rb program (transforms a nucleic acid sequence into an amino acid sequence) can be run using:</p>
 <pre>./sample/na2aa.rb test/data/fasta/example1.txt </pre>
-<h2><a name="label-30" id="label-30">Unit testing and doctests</a></h2><!-- RDLabel: "Unit testing and doctests" -->
+<h2><a name="label-25" id="label-25">Unit testing and doctests</a></h2><!-- RDLabel: "Unit testing and doctests" -->
 <p>BioRuby comes with an extensive testing framework with over 1300 tests and 2700
 assertions. To run the unit tests:</p>
 <pre>cd test
 ruby runner.rb</pre>
 <p>We have also started with doctest for Ruby. We are porting the examples
 in this tutorial to doctest - more info upcoming.</p>
-<h2><a name="label-31" id="label-31">Further reading</a></h2><!-- RDLabel: "Further reading" -->
+<h2><a name="label-26" id="label-26">Further reading</a></h2><!-- RDLabel: "Further reading" -->
 <p>See the BioRuby in anger Wiki.  A lot of BioRuby's documentation exists in the
 source code and unit tests. To really dive in you will need the latest source
 code tree. The embedded rdoc documentation for the BioRuby source code can be viewed online at
 <a href="http://bioruby.org/rdoc/">&lt;URL:http://bioruby.org/rdoc/&gt;</a>.</p>
-<h2><a name="label-32" id="label-32">BioRuby Shell</a></h2><!-- RDLabel: "BioRuby Shell" -->
+<h2><a name="label-27" id="label-27">BioRuby Shell</a></h2><!-- RDLabel: "BioRuby Shell" -->
 <p>The BioRuby shell implementation is located in ./lib/bio/shell. It is very interesting
 as it uses IRB (the Ruby intepreter) which is a powerful environment described in
 <a href="http://ruby-doc.org/docs/ProgrammingRuby/html/irb.html">Programming Ruby's IRB chapter</a>. IRB commands can be typed directly into the shell, e.g.</p>
@@ -1112,26 +1040,26 @@ as it uses IRB (the Ruby intepreter) which is a powerful environment described i
 <p>Additionally, you also may want to install the optional Ruby readline support -
 with Debian libreadline-ruby. To edit a previous line you may have to press
 line down (down arrow) first.</p>
-<h1><a name="label-33" id="label-33">Helpful tools</a></h1><!-- RDLabel: "Helpful tools" -->
+<h1><a name="label-28" id="label-28">Helpful tools</a></h1><!-- RDLabel: "Helpful tools" -->
 <p>Apart from rdoc you may also want to use rtags - which allows jumping around
 source code by clicking on class and method names. </p>
 <pre>cd bioruby/lib
 rtags -R --vi</pre>
 <p>For a tutorial see <a href="http://rtags.rubyforge.org/">here</a></p>
-<h1><a name="label-34" id="label-34">APPENDIX</a></h1><!-- RDLabel: "APPENDIX" -->
-<h2><a name="label-35" id="label-35">Biogem: Additional BioRuby plugins</a></h2><!-- RDLabel: "Biogem: Additional BioRuby plugins" -->
+<h1><a name="label-29" id="label-29">APPENDIX</a></h1><!-- RDLabel: "APPENDIX" -->
+<h2><a name="label-30" id="label-30">Biogem: Additional BioRuby plugins</a></h2><!-- RDLabel: "Biogem: Additional BioRuby plugins" -->
 <p>Biogem is one of the exciting developments for Ruby in bioinformatics! Biogems
 add new functionality next to the BioRuby core project (BioRuby is a biogem itself). A biogem is simply installed with </p>
 <pre>gem install bio                 # The core BioRuby gem
 gem install bio-core            # BioRuby + stable pure Ruby biogems
 gem install bio-core-ext        # bio-core + stable Ruby extensions</pre>
 <p>Information on these biogems, and the many others available, see <a href="http://biogems.info/">Biogems.info</a> or <a href="http://gems.bioruby.org/">gems.bioruby.org</a>.</p>
-<h2><a name="label-36" id="label-36">Ruby Ensembl API</a></h2><!-- RDLabel: "Ruby Ensembl API" -->
+<h2><a name="label-31" id="label-31">Ruby Ensembl API</a></h2><!-- RDLabel: "Ruby Ensembl API" -->
 <p>The Ruby Ensembl API is a Ruby API to the Ensembl database. It is NOT currently
 included in the BioRuby archives. To install it, see
 <a href="http://wiki.github.com/jandot/ruby-ensembl-api">the Ruby-Ensembl Github</a>
 for more information.</p>
-<h3><a name="label-37" id="label-37">Gene Ontology (GO) through the Ruby Ensembl API</a></h3><!-- RDLabel: "Gene Ontology (GO) through the Ruby Ensembl API" -->
+<h3><a name="label-32" id="label-32">Gene Ontology (GO) through the Ruby Ensembl API</a></h3><!-- RDLabel: "Gene Ontology (GO) through the Ruby Ensembl API" -->
 <p>Gene Ontologies can be fetched through the Ruby Ensembl API package:</p>
 <pre>require 'ensembl'
 Ensembl::Core::DBConnection.connect('drosophila_melanogaster')
@@ -1148,32 +1076,25 @@ infile.each do |line|
 end</pre>
 <p>Prints each mosq. accession/uniq identifier and the GO terms from the Drosphila
 homologues.</p>
-<h2><a name="label-38" id="label-38">Using BioPerl or BioPython from Ruby</a></h2><!-- RDLabel: "Using BioPerl or BioPython from Ruby" -->
+<h2><a name="label-33" id="label-33">Using BioPerl or BioPython from Ruby</a></h2><!-- RDLabel: "Using BioPerl or BioPython from Ruby" -->
 <p>A possible route is to opt for JRuby and Jython on the JAVA virtual machine (JVM).</p>
 <p>At the moment there is no easy way of accessing BioPerl or BioPython directly from Ruby. A possibility is to create a Perl or Python server that gets accessed through XML/RPC or SOAP.</p>
-<h2><a name="label-39" id="label-39">Installing required external libraries</a></h2><!-- RDLabel: "Installing required external libraries" -->
-<p>At this point for using BioRuby no additional libraries are needed, except if
-you are using the Bio::PhyloXML module; then you have to install libxml-ruby.</p>
+<h2><a name="label-34" id="label-34">Installing required external libraries</a></h2><!-- RDLabel: "Installing required external libraries" -->
+<p>At this point for using BioRuby no additional libraries are needed.</p>
 <p>This may change, so keep an eye on the Bioruby website. Also when
 a package is missing BioRuby should show an informative message.</p>
 <p>At this point installing third party Ruby packages can be a bit
 painful, as the gem standard for packages evolved late and some still
 force you to copy things by hand. Therefore read the README's
 carefully that come with each package.</p>
-<h3><a name="label-40" id="label-40">Installing libxml-ruby</a></h3><!-- RDLabel: "Installing libxml-ruby" -->
-<p>The simplest way is to use the RubyGems packaging system:</p>
-<pre>gem install -r libxml-ruby</pre>
-<p>If you get `require': no such file to load - mkmf (LoadError) error then do</p>
-<pre>sudo apt-get install ruby-dev</pre>
-<p>If you have other problems with installation, then see <a href="http://libxml.rubyforge.org/install.xml">&lt;URL:http://libxml.rubyforge.org/install.xml&gt;</a>.</p>
-<h2><a name="label-41" id="label-41">Trouble shooting</a></h2><!-- RDLabel: "Trouble shooting" -->
+<h2><a name="label-35" id="label-35">Trouble shooting</a></h2><!-- RDLabel: "Trouble shooting" -->
 <ul>
 <li>Error: in `require': no such file to load -- bio (LoadError)</li>
 </ul>
 <p>Ruby is failing to find the BioRuby libraries - add it to the RUBYLIB path, or pass
 it to the interpeter. For example:</p>
 <pre>ruby -I$BIORUBYPATH/lib yourprogram.rb</pre>
-<h2><a name="label-42" id="label-42">Modifying this page</a></h2><!-- RDLabel: "Modifying this page" -->
+<h2><a name="label-36" id="label-36">Modifying this page</a></h2><!-- RDLabel: "Modifying this page" -->
 <p>IMPORTANT NOTICE: This page is maintained in the BioRuby source code 
 repository. Please edit the file there otherwise changes may get
 lost. See <!-- Reference, RDLabel "BioRuby Developer Information" doesn't exist --><em class="label-not-found">BioRuby Developer Information</em><!-- Reference end --> for repository and mailing list