bio-velvet 0.0.1

data/lib/bio-velvet/runner.rb

@@ -0,0 +1,91 @@
+require 'files'
+require 'systemu'
+
+module Bio
+  module Velvet
+    class Runner
+      include Bio::Velvet::Logging
+
+      # Run velveth and then velvetg, with the given kmer size. Returned
+      # is a Bio::Velvet::Result class, stored in a temporary directory.
+      # The temporary directory is removed upon program exit.
+      #
+      # The velveth_options and velvetg_options are strings to pass as arguments
+      # to velveth and velvetg, respectively.
+      #
+      # The final options argument is used to specify bio-velvet wrapper options. Currently:
+      # :output_assembly_path: a directory where the assembly takes place (by default, a temporary directory)
+      def velvet(kmer_length, velveth_options_string, velvetg_options_string='', options={})
+        res = velveth kmer_length, velveth_options_string, options
+        velvetg res, velvetg_options_string
+      end
+
+      def velveth(kmer_length, velveth_arguments, options={})
+        result = Result.new
+        outdir = nil
+        if options[:output_assembly_path]
+          log.debug "Using pre-defined assembly directory: #{options[:output_assembly_path]}"
+          outdir = options[:output_assembly_path]
+        else
+          outdir = Files.create.root
+        end
+        result.result_directory = outdir
+
+        # Run velveth
+        cmd = "velveth #{result.result_directory} #{kmer_length} #{velveth_arguments}"
+        log.info "Running velveth: #{cmd}" if log.info?
+        status, stdout, stderr = systemu cmd
+        if status.exitstatus != 0
+          raise VelvetRunnerException, "Error running velveth: #{stderr}\n#{stdout}"
+        end
+        result.velveth_stdout = stdout
+        result.velveth_stderr = stderr
+
+        return result
+      end
+
+      # Run velvetg, with a Bio::Velvet::Result object
+      # generated with velveth
+      def velvetg(velveth_result_object, velvetg_arguments)
+        cmd = "velvetg #{velveth_result_object.result_directory} #{velvetg_arguments}"
+        log.info "Running velvetg: #{cmd}" if log.info?
+        status, stdout, stderr = systemu cmd
+        if status.exitstatus != 0
+          raise VelvetRunnerException, "Error running velvetg: #{stderr}\n#{stdout}"
+        end
+        velveth_result_object.velvetg_stdout = stdout
+        velveth_result_object.velvetg_stderr = stderr
+
+        return velveth_result_object
+      end
+    end
+
+    class VelvetRunnerException < Exception; end
+
+    class Result
+      attr_accessor :velveth_stdout, :velveth_stderr
+      attr_accessor :velvetg_stdout, :velvetg_stderr
+      attr_accessor :result_directory
+
+      # Path to the LastGraph output from velvetg
+      def last_graph_path
+        File.join result_directory, 'LastGraph'
+      end
+
+      # Path to the contigs.fa output from velvetg
+      def contigs_path
+        File.join result_directory, 'contigs.fa'
+      end
+
+      # Path to the stats.txt output from velvetg
+      def stats_path
+        File.join result_directory, 'stats.txt'
+      end
+
+      # Return a Bio::Velvet::Graph object built from the LastGraph file
+      def last_graph
+        Bio::Velvet::Graph.parse_from_file(last_graph_path)
+      end
+    end
+  end
+end

data/spec/bio-velvet_arc_array_spec.rb

@@ -0,0 +1,123 @@
+require File.expand_path(File.dirname(__FILE__) + '/spec_helper')
+require 'bio'
+
+include Bio::Velvet
+
+describe "ArcArray" do
+  it 'should push' do
+    node1 = Graph::Node.new
+    node1.node_id = 1
+    node2 = Graph::Node.new
+    node2.node_id = 2
+    arc = Graph::Arc.new
+    arc.begin_node_id = 1
+    arc.end_node_id = 2
+
+    ary = Graph::ArcArray.new
+    ary.push arc
+    ary.to_a.should == [arc]
+
+    arc2 = Graph::Arc.new
+    arc2.begin_node_id = 1
+    arc2.end_node_id = 2
+
+    ary.push arc2
+    ary.to_a.should == [arc,arc2]
+  end
+
+  it 'should get arcs right' do
+    node1 = Graph::Node.new
+    node1.node_id = 1
+    node2 = Graph::Node.new
+    node2.node_id = 2
+    arc = Graph::Arc.new
+    arc.begin_node_id = 1
+    arc.end_node_id = 2
+
+    ary = Graph::ArcArray.new
+    ary.push arc
+    ary.get_arcs_by_node_id(1,2).should == [arc]
+    ary.get_arcs_by_node_id(2,1).should == [arc]
+    ary.get_arcs_by_node_id(1).should == [arc]
+    ary.get_arcs_by_node_id(2).should == [arc]
+    ary.get_arcs_by_node_id(3).should == []
+
+    arc2 = Graph::Arc.new
+    arc2.begin_node_id = 1
+    arc2.end_node_id = 2
+    ary.push arc2
+    ary.get_arcs_by_node_id(1,2).should == [arc, arc2]
+    ary.get_arcs_by_node_id(2,1).should == [arc, arc2]
+    ary.get_arcs_by_node_id(1).should == [arc, arc2]
+    ary.get_arcs_by_node_id(2).should == [arc, arc2]
+    ary.get_arcs_by_node_id(3).should == []
+
+
+    ary = Graph::ArcArray.new
+    arc = Graph::Arc.new
+    arc.begin_node_id = 1
+    arc.end_node_id = 1
+    ary.push arc
+    ary.get_arcs_by_node_id(1).should == [arc]
+    ary.get_arcs_by_node_id(1,1).should == [arc]
+
+    arc2 = Graph::Arc.new
+    arc2.begin_node_id = 1
+    arc2.end_node_id = 2
+    ary.push arc2
+    ary.get_arcs_by_node_id(1).should == [arc, arc2]
+    ary.get_arcs_by_node_id(2).should == [arc2]
+  end
+
+
+  it 'should length' do
+    node1 = Graph::Node.new
+    node1.node_id = 1
+    node2 = Graph::Node.new
+    node2.node_id = 2
+    arc = Graph::Arc.new
+    arc.begin_node_id = 1
+    arc.end_node_id = 2
+
+    ary = Graph::ArcArray.new
+    ary.length.should == 0
+    ary.push arc
+    ary.length.should == 1
+
+    arc2 = Graph::Arc.new
+    arc2.begin_node_id = 1
+    arc2.end_node_id = 2
+
+    ary.push arc2
+    ary.length.should == 2
+  end
+
+  it 'should delete' do
+    node1 = Graph::Node.new
+    node1.node_id = 1
+    node2 = Graph::Node.new
+    node2.node_id = 2
+    arc = Graph::Arc.new
+    arc.begin_node_id = 1
+    arc.end_node_id = 2
+
+    ary = Graph::ArcArray.new
+    ary.push arc
+    ary.to_a.should == [arc]
+    ary.delete arc
+    ary.to_a.should == []
+
+    ary.push arc
+
+    arc2 = Graph::Arc.new
+    arc2.begin_node_id = 1
+    arc2.end_node_id = 2
+    ary.push arc2
+    ary.length.should == 2
+    ary.delete arc2
+    ary.to_a.should == [arc]
+    ary.push arc2
+    ary.delete arc
+    ary.to_a.should == [arc2]
+  end
+end

data/spec/bio-velvet_graph_spec.rb

@@ -0,0 +1,290 @@
+require File.expand_path(File.dirname(__FILE__) + '/spec_helper')
+require 'bio'
+
+class String
+  def revcom
+    Bio::Sequence::NA.new(self).reverse_complement.to_s.upcase
+  end
+end
+
+describe "BioVelvet" do
+  it "should be able to parse a graph 1" do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'velvet_test_reads_assembly','Graph')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    graph.number_of_nodes.should eq(967)
+    graph.number_of_sequences.should eq(50000)
+    graph.hash_length.should eq(31)
+
+    graph.nodes[1].should be_kind_of(Bio::Velvet::Graph::Node)
+    graph.nodes.length.should eq(967)
+    graph.nodes[1].node_id.should eq(1)
+    graph.nodes[3].length.should == 3
+    graph.nodes[3].coverages.should eq([236,205,0,0])
+    graph.nodes[3].ends_of_kmers_of_node.should eq('TTG')
+    graph.nodes[3].ends_of_kmers_of_twin_node.should eq('ACA')
+
+    graph.arcs.length.should eq(563)
+    arcs = graph.get_arcs_by_node_id(2,712)
+    arcs.length.should == 1
+    arcs[0].begin_node_id.should eq(2)
+    arcs[0].end_node_id.should eq(712)
+    arcs[0].begin_node_direction.should eq(true)
+    arcs[0].end_node_direction.should eq(false)
+    arcs[0].multiplicity.should eq(1)
+  end
+
+  it "should be able to parse a graph that has read tracking" do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'velvet_test_reads_assembly_read_tracking','Graph2')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    graph.number_of_nodes.should eq(967)
+    graph.number_of_sequences.should eq(50000)
+    graph.hash_length.should eq(31)
+
+    graph.nodes[1].should be_kind_of(Bio::Velvet::Graph::Node)
+    graph.nodes.length.should eq(967)
+    graph.nodes[1].node_id.should eq(1)
+    graph.nodes[3].length.should == 3
+    graph.nodes[3].coverages.should eq([236,205,0,0])
+    graph.nodes[3].ends_of_kmers_of_node.should eq('TTG')
+    graph.nodes[3].ends_of_kmers_of_twin_node.should eq('ACA')
+
+
+    arcs = graph.get_arcs_by_node_id(2,712)
+    arcs.length.should == 1
+    arcs[0].begin_node_id.should eq(2)
+    arcs[0].end_node_id.should eq(712)
+    arcs[0].begin_node_direction.should eq(true)
+    arcs[0].end_node_direction.should eq(false)
+    arcs[0].multiplicity.should eq(1)
+
+    # NR	-967	1
+    # 49982	0	0
+    # === later
+    # NR	967	1
+    # 49981	0	0
+    node = graph.nodes[967]
+    node.short_reads.nil?.should eq(false)
+    node.short_reads.length.should eq(2), node.inspect
+    node.short_reads[0].read_id.should eq(49982)
+    node.short_reads[0].offset_from_start_of_node.should eq(0)
+    node.short_reads[0].start_coord.should eq(0)
+    node.short_reads[0].direction.should eq(false)
+    node.short_reads[1].read_id.should eq(49981)
+    node.short_reads[1].offset_from_start_of_node.should eq(0)
+    node.short_reads[1].start_coord.should eq(0)
+    node.short_reads[1].direction.should eq(true)
+
+    # NR	-951	2
+    #47210	0	0
+    #47223	41	0
+    # ====later
+    # NR	951	2
+    # 47209	54	0
+    # 47224	0	0
+    node = graph.nodes[951]
+    node.short_reads.length.should eq(4)
+    node.number_of_short_reads.should eq(4)
+    node.short_reads[1].offset_from_start_of_node.should eq(41)
+
+    # grep -A 50000 ^NR velvet_test_reads_assembly_read_tracking/Graph2 |grep -v NR |wc -l
+    # 40327
+    graph.nodes.collect{|n| n.short_reads.nil? ? 0 : n.short_reads.length}.reduce(:+).should eq(40327)
+  end
+
+  it 'should return sets of arcs by id' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'velvet_test_reads_assembly','LastGraph')
+    #    ARC     2       -578    1
+    #    ARC     2       -473    30
+    #    ARC     -2      650     3
+    #    ARC     -2      959     24
+    #    ARC     3       4       81
+    #    ARC     -3      -786    61
+    #    ARC     -3      -740    1
+    #    ARC     -3      -568    1
+    #    ARC     -3      754     6
+    # ....
+    #Bio::Log::CLI.logger('stderr'); Bio::Log::CLI.trace('info'); log = Bio::Log::LoggerPlus.new('bio-velvet'); Bio::Log::CLI.configure('bio-velvet')
+
+    arcs = graph.get_arcs_by_node_id(2,578)
+    arcs.length.should eq(1)
+    arcs[0].begin_node_forward?.should eq(true)
+    arcs[0].begin_node_id.should == 2
+    arcs[0].end_node_id.should == 578
+
+    arcs = graph.get_arcs_by_node_id(578,2)
+    arcs.length.should eq(1)
+    arcs[0].begin_node_forward?.should eq(true)
+    arcs[0].begin_node_id.should == 2
+    arcs[0].end_node_id.should == 578
+
+    arcs = graph.get_arcs_by_node_id(2,178)
+    arcs.length.should == 0
+  end
+
+  it 'should return a set of arcs by node objects' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'velvet_test_reads_assembly','LastGraph')
+    #    ARC     2       -578    1
+    #    ARC     2       -473    30
+    #    ARC     -2      650     3
+    #    ARC     -2      959     24
+    #    ARC     3       4       81
+    #    ARC     -3      -786    61
+    #    ARC     -3      -740    1
+    #    ARC     -3      -568    1
+    #    ARC     -3      754     6
+    # ....
+    #Bio::Log::CLI.logger('stderr'); Bio::Log::CLI.trace('info'); log = Bio::Log::LoggerPlus.new('bio-velvet'); Bio::Log::CLI.configure('bio-velvet')
+
+    node2 = graph.nodes.select{|n| n.node_id == 2}[0]
+    node650 = graph.nodes.select{|n| n.node_id == 650}[0]
+    node754 = graph.nodes.select{|n| n.node_id == 754}[0]
+
+    # forward
+    arcs = graph.get_arcs_by_node(node2, node650)
+    arcs.length.should eq(1)
+    arcs[0].begin_node_forward?.should eq(false)
+    arcs[0].begin_node_id.should == 2
+    arcs[0].end_node_id.should == 650
+
+    #reverse
+    arcs = graph.get_arcs_by_node(node650, node2)
+    arcs.length.should eq(1)
+    arcs[0].begin_node_forward?.should eq(false)
+    arcs[0].begin_node_id.should == 2
+    arcs[0].end_node_id.should == 650
+
+    # no connection
+    arcs = graph.get_arcs_by_node(node2, node754)
+    arcs.length.should == 0
+  end
+
+  it 'should have a functioning NodeArray class' do
+    na = Bio::Velvet::Graph::NodeArray.new
+    na.length.should eq(0)
+    node = Bio::Velvet::Graph::Node.new
+    na[1] = node
+    na.length.should eq(1)
+    na[1].should eq(node)
+  end
+
+  it "arcs should directions_opposing?" do
+    arc = Bio::Velvet::Graph::Arc.new
+    arc.begin_node_direction = true
+    arc.end_node_direction = true
+    arc.directions_opposing?.should eq(false)
+
+    arc.begin_node_direction = true
+    arc.end_node_direction = false
+    arc.directions_opposing?.should eq(true)
+
+    arc.begin_node_direction = false
+    arc.end_node_direction = false
+    arc.directions_opposing?.should eq(false)
+  end
+
+  it "nodes should correctly respond to #sequence" do
+    graph = Bio::Velvet::Graph.new
+    graph.hash_length = 31
+    node = Bio::Velvet::Graph::Node.new
+    node.parent_graph = graph
+    node.ends_of_kmers_of_node = 'AATCAAACTATAAAGTTTTAGAAGATAAAGTAACAACTTATACATGGGGATTCGGAGTTAAAAAAGTAGATTCAGAAAATATTTCAATAGATCTTGCAGGCGCAGCTTTTTCTGTTAGGGATAAAAATGGTAATGTAATTGGTAAATATACGTATGATTCTACTGGAAATGTGGTTTTATTAAAAGGAAAGGGTGTAACTGATAAAAATGGACGAGTTATATTTACTGGTTTAAAAGAAGGAGATTACTTTATAAAAGAAGAAAAAGCTCCTAAAGGGTATAGCCTTTTAAAAGAACCAGTAAAAGTTACTATAACAGCTCAAAAAGATGATAATGGAGAGTATACTGGTCAAGCAACTATATCTGTAACTAATGGCAATGAAGCTGGAAGTATAATAAATAATATTACTATGAATGATGGCAATGTATTATTTAATGTACAAATTAAAAACTATGCTGGTATTTCACTTCCAGGTACAGG'
+    node.ends_of_kmers_of_twin_node = 'TTTTTAATTTGTACATTAAATAATACATTGCCATCATTCATAGTAATATTATTTATTATACTTCCAGCTTCATTGCCATTAGTTACAGATATAGTTGCTTGACCAGTATACTCTCCATTATCATCTTTTTGAGCTGTTATAGTAACTTTTACTGGTTCTTTTAAAAGGCTATACCCTTTAGGAGCTTTTTCTTCTTTTATAAAGTAATCTCCTTCTTTTAAACCAGTAAATATAACTCGTCCATTTTTATCAGTTACACCCTTTCCTTTTAATAAAACCACATTTCCAGTAGAATCATACGTATATTTACCAATTACATTACCATTTTTATCCCTAACAGAAAAAGCTGCGCCTGCAAGATCTATTGAAATATTTTCTGAATCTACTTTTTTAACTCCGAATCCCCATGTATAAGTTGTTACTTTATCTTCTAAAACTTTATAGTTTGATTCTAAATCGTGATCTTTGGTAGAGATAAGTG'
+    node.sequence.should eq('CACTTATCTCTACCAAAGATCACGATTTAGAATCAAACTATAAAGTTTTAGAAGATAAAG
+TAACAACTTATACATGGGGATTCGGAGTTAAAAAAGTAGATTCAGAAAATATTTCAATAG
+ATCTTGCAGGCGCAGCTTTTTCTGTTAGGGATAAAAATGGTAATGTAATTGGTAAATATA
+CGTATGATTCTACTGGAAATGTGGTTTTATTAAAAGGAAAGGGTGTAACTGATAAAAATG
+GACGAGTTATATTTACTGGTTTAAAAGAAGGAGATTACTTTATAAAAGAAGAAAAAGCTC
+CTAAAGGGTATAGCCTTTTAAAAGAACCAGTAAAAGTTACTATAACAGCTCAAAAAGATG
+ATAATGGAGAGTATACTGGTCAAGCAACTATATCTGTAACTAATGGCAATGAAGCTGGAA
+GTATAATAAATAATATTACTATGAATGATGGCAATGTATTATTTAATGTACAAATTAAAA
+ACTATGCTGGTATTTCACTTCCAGGTACAGG'.gsub(/\n/,''))
+  end
+
+  it 'short nodes should respond to sequence properly 1' do
+    #Bio::Log::CLI.logger('stderr'); Bio::Log::CLI.trace('debug'); log = Bio::Log::LoggerPlus.new('bio-velvet'); Bio::Log::CLI.configure('bio-velvet')
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR,'short_node_LastGraph')
+    graph.nodes.length.should == 4
+    expect {graph.nodes[2].sequence}.to raise_error(Bio::Velvet::NotImplementedException)
+  end
+
+  it 'should really correctly respond to #sequence on real data' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'node_sequence','LastGraph')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    contig_seq_hash = {}
+    Bio::FlatFile.foreach(File.join(TEST_DATA_DIR, 'node_sequence','contigs.fa')) do |seq|
+      node_id = seq.definition.match(/^NODE_(\d+)_/)[1]
+      contig_seq_hash[node_id] = seq.seq
+    end
+    graph.nodes.each do |node|
+      seq = node.sequence
+      exp = contig_seq_hash[node.node_id.to_s]
+      seq.should eq(exp), "Node #{node.node_id}. Found\n#{seq}\nExpected\n#{exp}"
+    end
+  end
+
+  it 'should delete nodes correctly path nodes' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'short_node_LastGraph')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    deleted_nodes, deleted_arcs = graph.delete_nodes_if do |node|
+      node.node_id == 3
+    end
+    deleted_nodes.collect{|n| n.node_id}.sort.should == [3]
+    graph.nodes.collect{|n| n.node_id}.sort.should == [1,2,4]
+    deleted_arcs.collect{|a| [a.begin_node_id, a.end_node_id]}.sort.should == [[1,3],[3,4]]
+    graph.arcs.collect{|a| [a.begin_node_id, a.end_node_id]}.sort.should == [[1,2],[2,4]]
+
+    graph.nodes[1].node_id.should == 1
+    graph.nodes[3].should == nil
+    graph.nodes[4].node_id.should == 4
+  end
+
+  it 'should delete nodes correctly cap nodes' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'short_node_LastGraph')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    deleted_nodes, deleted_arcs = graph.delete_nodes_if do |node|
+      node.node_id == 4
+    end
+    deleted_nodes.collect{|n| n.node_id}.sort.should == [4]
+    graph.nodes.collect{|n| n.node_id}.sort.should == [1,2,3]
+    deleted_arcs.collect{|a| [a.begin_node_id, a.end_node_id]}.sort.should == [[2,4],[3,4]]
+    graph.arcs.collect{|a| [a.begin_node_id, a.end_node_id]}.sort.should == [[1,2],[1,3]]
+
+    graph.nodes[4].should == nil
+    graph.nodes[1].node_id.should == 1
+  end
+
+  it 'node#coverage' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'short_node_LastGraph')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    graph.nodes[1].coverage.should == 1140.0/228
+    graph.nodes[2].coverage.should == 58.0/29
+    graph.nodes[3].coverage.should == 114.0/38
+    graph.nodes[4].coverage.should == 1120.0/224
+  end
+
+  it 'should get neighbours_off_end' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'short_node_LastGraph')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    graph.neighbours_off_end(graph.nodes[1]).should == [graph.nodes[2], graph.nodes[3]]
+    graph.neighbours_off_end(graph.nodes[2]).should == [graph.nodes[4]]
+    graph.neighbours_off_end(graph.nodes[3]).should == [graph.nodes[4]]
+    graph.neighbours_off_end(graph.nodes[4]).should == [graph.nodes[2], graph.nodes[3]] #node 4 is revcom
+  end
+
+  it 'should get neighbours_into_start' do
+    graph = Bio::Velvet::Graph.parse_from_file File.join(TEST_DATA_DIR, 'short_node_LastGraph')
+    graph.should be_kind_of(Bio::Velvet::Graph)
+
+    graph.neighbours_into_start(graph.nodes[1]) == []
+    graph.neighbours_into_start(graph.nodes[2]) == [graph.nodes[1]]
+    graph.neighbours_into_start(graph.nodes[3]) == [graph.nodes[1]]
+    graph.neighbours_into_start(graph.nodes[4]) == []
+  end
+end