bio-assembly 0.0.2 → 0.1.0

data/lib/bio-assembly.rb

@@ -5,11 +5,10 @@ require 'bio-assembly/read'
 module Bio
 
    class Assembly
-      attr_accessor :contigs
-      
+           
       @@formats = { }
     
-      def self.create(path, format)
+      def self.open(path, format)
          streamer = @@formats[format]
          if streamer
             streamer.new(path)
@@ -22,21 +21,11 @@ module Bio
          @@formats[name] = self
       end
       
-      def contigs
-        # use each_contig to stream large files
-        parse_whole_file if @contigs.empty?
-        @contigs
-      end
-      
       def each_contig
          # implemented by each format subclass
       end
       
       private
-      
-      def num_contigs
-        contigs.size
-      end
 
       def num_reads
         read_num = 0
@@ -52,4 +41,5 @@ module Bio
    
 end
 
-require 'bio-assembly/ace'
+require 'bio-assembly/ace'
+require 'bio-assembly/caf'

data/lib/bio-assembly/ace.rb

@@ -9,22 +9,15 @@ class Assembly
 
       def initialize(path)
          @file = File.new(path, 'r') 
-         @contigs = Array.new
          parse_as
        end
 
       def each_contig
-        # check if file is already parsed
-        if @total_num_contigs.to_i == @contigs.size
-          @contigs.each{ |contig| yield contig }
-        else
           each_identifier do |identifier, attrs|
             next unless identifier == 'CO'
             contig = parse_contig(attrs)
-            @contigs.push contig
             yield(contig)   
           end
-        end
       end
 
       def to_ace
@@ -35,8 +28,9 @@ class Assembly
       end
 
       private
+      
       def parse_contig(attrs)
-        contig = Bio::Assembly::Contig.new
+        contig = Contig.new
         contig.name, base_num, @num_reads, base_segments_num, contig.orientation = attrs.split(" ")
         # keep track of the number of RD identifiers parsed
         @num_rds_parsed = 0
@@ -83,7 +77,7 @@ class Assembly
 
       # parse read meta data
       def parse_af(contig, attrs)
-        read = Bio::Assembly::Read.new
+        read = Read.new
         read.name , read.orientation, read.from = attrs.split(" ")
         contig.add_read read
       end
@@ -139,11 +133,9 @@ class Assembly
       # parse run meta data - ignored
       def parse_ct(contig, attrs)
       end
-
-   end # => end class Ace
    
-   # open contig class and write ace specific methods for contig objects         
-   class Contig
+   # extend contig class and write ace specific methods for contig objects         
+    class Contig < Bio::Assembly::Contig
 
       def to_ace
         ace = ""
@@ -176,10 +168,10 @@ class Assembly
         ace
       end
          
-   end # => end Contig class
+    end # => end Contig class
    
-   # open Read class to add ace specific methods for read objects
-   class Read
+    # extend Read class to add ace specific methods for read objects
+    class Read < Bio::Assembly::Read
 
      attr_accessor :base_sequences
   
@@ -238,7 +230,7 @@ class Assembly
         end
     
         def <=>(other)
-           unless other.kind_of?(Bio::Assembly::Read::BaseSequence)
+           unless other.kind_of?(Bio::Assembly::Ace::Read::BaseSequence)
               raise "[Error] markers are not comparable"
            end
            if self.from == other.from
@@ -251,8 +243,8 @@ class Assembly
   
       end # => end BaseSequence Class
 
-   end # => end Read Class
-   
+    end # => end Read Class
+  end # => end class Ace 
 
 end # => end class Assembly
 end # => end module Bio

data/lib/bio-assembly/caf.rb

@@ -0,0 +1,124 @@
+module Bio
+  class Assembly
+    class Caf < Bio::Assembly
+      
+      # register parser with superclass
+      register_parser :caf
+
+      def initialize(path)
+         @file = File.new(path, 'r') 
+      end
+      # iterator that return one contig at a time
+      def each_contig
+        contig = Contig.new
+        feature = Hash.new
+        @file.each do |line|
+          feature = parse_blocks(line,feature) # search the file for CAF blocks like DNA and Sequence
+          if feature[:type] == :read and feature[:parsed]
+            read = convert_to_read(feature)
+            contig.add_read(read)
+            feature = Hash.new
+          elsif feature[:type] == :contig and feature[:parsed]
+            contig = convert_to_contig(contig,feature)
+            yield contig
+            contig = Contig.new
+            feature = Hash.new
+          end
+        end
+      end
+
+      class Contig < Bio::Assembly::Contig
+      end 
+
+
+      class Read < Bio::Assembly::Read
+        attr_accessor :quality
+      end
+            
+      private
+      
+      def parse_blocks(line,feat)
+        keywords = line.split("\s")
+        case keywords[0]
+          when "DNA" then parse_dna(feat)
+          when "Sequence" then parse_seq(feat,line)
+        end  
+        return feat
+      end
+      
+      # parse DNA sequence and BaseQuality
+      def parse_dna(feat)
+        feat[:seq] = @file.gets("\n\n").tr("\n","")
+        newline = @file.gets
+        keywords = newline.split("\s")
+        feat[:qual] = @file.gets("\n\n").tr("\n"," ").rstrip if keywords[0] == "BaseQuality"
+        feat[:parsed] = true if feat[:type] == :contig
+      end
+      
+      # parse Sequence information like Name, Clipping, Strand and Type
+      def parse_seq(feat,line)
+        feat[:name] = line.split(":")[1].tr("\s|\n","")
+        sequence_block = @file.gets("\n\n")
+        sequence_block.split("\n").each do |l|
+          keywords = l.split("\s")
+          case keywords[0]
+            when "Clipping" then parse_clipping(feat,l)
+            when "Strand" then parse_strand(feat,l)
+            when "Assembled_from" then parse_af(feat,l)
+            when "Is_read" then feat[:type] = :read
+            when "Is_contig" then feat[:type] = :contig
+          end
+        end
+        feat[:parsed] = true if feat[:type] == :read
+      end
+      
+      # parse read coordinates for quality clipping
+      def parse_clipping(feat,line)
+        val = line.chomp.split("\s")
+        feat[:clipping_start] = val[-2]
+        feat[:clipping_end] = val[-1]
+      end
+      
+      # parse sequence strand information
+      def parse_strand(feat,line)
+        feat[:orientation] = line.split("\s")[1].tr("\n","")
+      end
+      
+      # parse Assembled_from lines in Contig. These lines also include read alignment positions within the contig
+      def parse_af(feat,line)
+        if feat[:af].nil?
+          feat[:af] = [line]
+        else
+          feat[:af] << line
+        end    
+      end
+
+      # convert a generic feature into a Caf::Read object
+      def convert_to_read(feature)
+        read = Read.new
+        read.name = feature[:name]
+        read.seq = feature[:seq]
+        read.quality = feature[:qual]
+        read.clear_range_from = feature[:clipping_start]
+        read.clear_range_to = feature[:clipping_end]
+        read.orientation = feature[:orientation]
+        return read       
+      end
+      
+      # convert a generic feature into a Caf::Contig object
+      def convert_to_contig(contig,feature)
+        contig.name = feature[:name]
+        contig.seq = feature[:seq]
+        contig.quality = feature[:qual]
+        # assign reads ranges using Assembled_from lines in Contig
+        feature[:af].each do |af|
+          val = af.split("\s")
+          contig.reads[val[-5]].from = val[-4]
+          contig.reads[val[-5]].to = val[-3]
+        end
+        return contig       
+      end
+
+    end # end Caf
+  end # end Assembly  
+end # end Bio

data/lib/bio-assembly/contig.rb

@@ -10,7 +10,7 @@ module Bio
       def initialize(str="")
         @reads = Hash.new
         @seq = Bio::Sequence::NA.new(str)
-        # counter for RD identifier
+        # counter for Reads
         @rds_parsed = 0
       end
 
@@ -54,6 +54,10 @@ module Bio
         seq.length
       end
       
+      def seq=(str)
+        @seq = Bio::Sequence::NA.new(str)
+      end
+      
       def num_base_segments
         num_base_sequences = 0
         each_read do |read|

data/lib/bio-assembly/maf.rb

@@ -0,0 +1,15 @@
+module Bio
+  class Assembly
+    class Maf < Bio::Assembly
+      
+      # register parser with superclass
+      register_parser :maf
+
+      def initialize(path)
+         @file = File.new(path, 'r') 
+         # TO DO
+      end
+
+    end # end Maf
+  end # end Assembly  
+end # end Bio

data/lib/bio-assembly/read.rb

@@ -26,6 +26,10 @@ module Bio
         @to = new_to.to_i
       end
       
+      def seq=(str)
+        @seq = Bio::Sequence::NA.new(str)
+      end
+      
       def clear_range_from=(new_clear_range_from)
         @clear_range_from = new_clear_range_from.to_i
       end

data/test/{test_bio-assembly.rb → test_bio-assembly-ace.rb}

@@ -1,14 +1,18 @@
 require 'helper'
 
-class TestBioAssembly < Test::Unit::TestCase
+class TestBioAssemblyAce < Test::Unit::TestCase
 
      def setup
        ace_filename = File.join('data', 'example1.ace')
-       @obj = Bio::Assembly.create(ace_filename, :ace)
+       @obj = Bio::Assembly.open(ace_filename, :ace)
 
        # pick a contig to do in depth tests on
        @contig = nil
-       @obj.each_contig { |c| @contig = c if c.name.to_i == 5 }
+       @tot_contig = []
+       @obj.each_contig do |c| 
+         @contig = c if c.name.to_i == 5 
+         @tot_contig << c
+       end   
 
        # pick a read to do in depth tests on
        @read = nil
@@ -17,13 +21,13 @@ class TestBioAssembly < Test::Unit::TestCase
 
      def test_num_contigs_parsed
        contigs_parsed = 13
-       assert_equal(contigs_parsed, @obj.contigs.size)
+       assert_equal(contigs_parsed, @tot_contig.size)
      end
 
      def test_num_reads_parsed
        reads_parsed_known = 1760
        reads_parsed = 0
-       @obj.contigs.each { |c| reads_parsed += c.reads.size }
+       @tot_contig.each { |c| reads_parsed += c.reads.size }
        assert_equal(reads_parsed_known, reads_parsed)
      end
 
@@ -34,12 +38,16 @@ class TestBioAssembly < Test::Unit::TestCase
 
      def test_contig_seq
        seq = "TTTCCGTCAGATGTAAAGGTTGCAGAACCGGACCATTCTTGCGTCTGATCTTTCAGGATCGGATCGTTGGCGTCGAACTTATCGCTGTCTTTAAAGACACGGCCCGCGTTTTTCCAGCTGTCGATTGAGTTGTCGCCGACCTTTTGATAAAACATGTAGATTGATGTGTCATCAGCGTCTTTCGGGCTTCCCGCAAGAGCAAACACAACGTGATAGCCGTTGTATTCAGCTACTGTTCCGTCAGCGTTTTGCAGCGGCCAGCTGTCCCACACATCAAGTCCTTTTGCAGACTCAATATTTTTAATCGTTGATTGATCGAATTGAGGCACTTGGTATTTTTCGTTTTGCTGCTGTTTAGGGATCTGCAGCATATCATGGCGTGTAATATGAGAGACGCCGTACGTTTCTTTGTATGCTTTTTGGTTATTTTCTTTCGCGAAGGCTTGAGTCGCTCCTCCTGCCAGAAGTGCAGTCGTAAAAGTCAGAACTGTGGCTTGTTTTACAATTTTTTTGATGTTCATGTTCATGTCTCCTTCTGTATGTACTGTTTTTTGCGATCTGCCGTTTCGATCCTCCCGAATTGACTAGTGGGTAGGCCTGGCGGCCGCCTGGCCGTCGACATTTAGGTGACACTATAGAAGGATCCGCGGAATTCCTTTTTAGATTGAGATAATGACTTTGTTTGGAAGGATGTA*TTTTCATTTAATTAAAGCAAATTCGTAATAAT*AAAGTTAAACAATTTAATTTCAAGATGATTCACAGGTTTGTTGCCTCAAAAGAAAACTTATATTAATGGCAAGTTGTGAATAATTTATGCAACTCTTGTGGACAAGTTGACTCAACTTTTCAC*TTTATGTTATATTGTAAGGATGTGACTTTGTTTTGGAAAATTATATTTAATTTGATAATTAACCAATATAAAAAAGATAAACCAAAAGCTATAAGTCGTAAATAAGGACATTGGAAACAAGAAATATTCTCTCCTGAACATTATTTTAAATTATGCGCAATATGCAAATTTATAAGTGTTAAGTTAAAAAGATTGTTAATGGTTCTGTTTATTACCCAAAGACTTTTTTAAAGTTTAAGTCGTTGCTAAGAGTGCAGCGTTTAGACAAATAAAAATGCAATAATCTTCTCGCTCGGGAGCTATGTCCCTCGCATAATATTCTTCAAAGTGTACAGTAAATATTCTAGAAAAGTGAAGTGTGAAAAAGATATATTGCTTGTTTTTATATTTTGTTAATACAACAAAACTTCAAAAACCTGCGGTGGGGGGGGGGGGATAGTCACTTCCGTCACCTTCACCCCTCTCGTTCACTATACTCCCTCGCCCTGGCGTAATGATGGGGGGATTGGGGGTAGTTGCCCCTTAATAAAGTTCAAACTTGATTTATTTCTAACTCGATACCAGTGATTTACAAATGTTTCTGAAATGGCATGGTTTTCCCTAATAAATGCCTAAAAACCCTGAGCTGAGCCCACGCCAATT"
-       assert_equal(seq, @contig.seq.to_s)
+       assert_equal(seq, @contig.seq.to_s.upcase)
+       assert_instance_of(Bio::Sequence::NA,@contig.seq)
+       assert_instance_of(Bio::Assembly::Ace::Contig,@contig)
      end
 
      def test_read_seq
        read_seq = 'GAAAAAAAAAGGCAGAAGTTTAATCAAAACGGATTTTTCCGTCAGATGTAAAGGTTGCAGAACCGGACCATTCTTGCGTCTGATCTTTCAGGATCGGATCGTTGGCGTCGAACTTATCGCTGTCTTTAAAGACACGGCCCGCGTTTTTCCAGCTGTCGATTGAGTTGTCGCCGACCTTTTGATAAAACATGTAGATTGATGTGTCATCAGCGTCTTTCGGGCTTCCCGCAAGAGCAAACACAACGTGATAGCCGTTGTATTCAGCTACTGTTCCGTCAGCGTTTTGCAGCGGCCAGCTGTCCCACACATCAAGTCCTTTTGCAGACTCAATATTTTTAATCGTTGATTGATCGAATTGAGGCACTTGGTATTTTTCGTTTTGCTGCTGTTTAGGGATCTGCAGCATATCATGGCGTGTAATATGAGAGACGCCGTACGTTTCTTTGTATGCTTTTTGGTTATTTTCTTTCGCGAAGGCTTGAGTCGCTCCTCCTGCCAGAAGTGCAGTCGTAAAAGTCAGAACTGTGGCTTGTTTTACAATTTTTTTGATGTTCATGTTCATGTCTCCTTCTGTATGTACTGTTTTTTGCGATCTGCCGTTTCGATCCTCCCGAATTGACTAGTGGGTAGGCCTGGCGGCCGCCTGGCCGTCGACATTTAGGTGACACTATAGAAGGATCCGCGGAATTCCTTTTTAGATTGAGATAATGACTTTGTTTGGAAGGATGTATTTTTCATTTAATTAAAGCAAATTCGTAATAAT*AAAGTTAAACAATTT*ATTTC*AGATGATTCACAGGTTTGTTGCCTCAAAAG*AAACTTATATTAATGGCAAGTTGTGAATAATTTATGCAACTCTTGTGGGACAAGTTGACTTCACCT'
-       assert_equal(read_seq, @read.seq.to_s)
+       assert_equal(read_seq, @read.seq.to_s.upcase)
+       assert_instance_of(Bio::Sequence::NA,@read.seq)
+       assert_instance_of(Bio::Assembly::Ace::Read,@read)
      end
 
      def test_read_range

data/test/test_bio-assembly-caf.rb

@@ -0,0 +1,54 @@
+require 'helper'
+
+class TestBioAssemblyCaf < Test::Unit::TestCase
+  
+  def setup
+    path = File.join('data','example.caf')
+    @caf = Bio::Assembly.open(path,:caf)
+    @contigs = []
+    @caf.each_contig {|c| @contigs << c}
+  end
+  
+  def test_contigs
+    assert_equal(2,@contigs.size)
+    assert_equal('Contig1',@contigs[0].name)
+    assert_equal('Contig2',@contigs[1].name)
+    assert_instance_of(Bio::Assembly::Caf::Contig,@contigs[0])
+  end
+  
+  def test_read_per_contig
+    assert_equal(21,@contigs[0].reads.size)
+    assert_equal(21,@contigs[0].num_reads)
+  end
+  
+  def test_contig_seq
+    seq = "TTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATANACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTGTATTTTTAGTAGGGATGGGGTTTCACCATGTTGGCCAAGCTGGTCTCGAGCTCCTGACCTAGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAGGAGGAAGGGATCCTAGAAAAACAGAGACAAGGCCAAACATGGTAGCTCACACCTGTAATNNNNNCACTTTGGGAGGCCAGTGCGGGTGAATCACGANGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAANCACCGTCTCTACTAAAATAAAAAGAAATTAGCTGGGTGTCGTGGCAGGTGCNTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACNACTAGTACAGTACTTACAGGGTTATTATGATGATTAAATGAGAGAATAGCTGTGAGGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTGTNTCTAATCTGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATATTCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATTTCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACGTTCTTTATCATTGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGCAAATTCGATTGTATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTGGAGAGAATAAAACAGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGTTTTTCAGTTCATGCTCTTTCATTTTTTACTCCCTCAGGTTAAAGCTNGAAGCTCAACAAAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTNNANNCNNNTCCNNNNNNNCTNNANNNNNNNACAAATGAACCAGTGAAAACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAAGAGGTCTCAGGTAGGTAGAGATGCCTTTTGTTGTTGTTGTTTTTGAGACAGGGTCTCATTGTGTCGCCCAGGCTGGAGTGCAGTGGGGCGAACATGACTCGCTACAGCCTTGACCTCCTGGACTCAAGCGATCCTTCTGTCTCAGCCTCCCAAGTAGCTGGGATCACAGGCATGTGACATCACACCCAGCTAATTTATTTATTTATTTATTTTTTAAGAGACTGGATCGACTGGGCACAGTGGCTCATGCCTGTAATCCCANCACTTTGGGAGGCCGAGGCAGGTGGATTACCGAGGTCAGGAGTTCAAGACCAGCCTGACCAACATGGAGAAACCCCATCTCTACTAAAAATACAAAATGAGCTGGGCATGGTGGTGCATGCCTGTAATCC"
+    assert_equal(seq,@contigs[0].seq.to_s.upcase)
+    assert_instance_of(Bio::Sequence::NA,@contigs[0].seq)
+  end
+  
+  def test_contig_qual
+    qual = "4 4 8 4 6 10 13 21 24 25 33 33 33 30 27 21 15 27 19 30 30 33 33 30 21 21 10 9 17 11 27 27 37 38 33 35 35 35 35 44 45 45 38 37 37 45 45 45 43 43 43 45 45 45 45 45 45 45 21 21 23 30 30 34 37 37 38 45 32 45 37 41 37 45 30 45 45 34 34 34 32 29 22 32 32 45 45 45 33 28 28 37 37 34 34 34 35 34 34 34 34 34 34 37 37 40 41 37 34 37 37 37 32 24 22 27 29 25 27 20 21 21 21 27 45 41 40 40 40 42 34 34 37 41 45 51 45 45 37 30 37 41 41 37 36 28 30 30 30 22 33 33 35 33 33 41 51 51 45 39 39 39 30 28 33 34 34 39 34 41 34 34 41 33 33 39 39 39 33 33 33 30 33 33 33 30 29 19 19 24 25 32 33 45 36 36 36 36 41 41 30 30 30 37 37 43 51 51 51 51 45 37 37 30 37 37 37 51 51 51 51 51 37 37 28 28 10 10 10 13 10 10 10 9 9 9 21 21 28 37 37 37 33 33 33 33 33 33 34 34 34 33 33 33 33 21 25 25 22 22 29 29 33 33 33 33 31 31 27 28 17 23 23 28 26 24 32 10 10 10 15 15 26 32 32 37 45 45 32 45 33 26 24 32 37 37 35 34 37 35 37 34 37 37 40 37 37 45 45 38 38 45 45 40 37 37 37 34 30 30 28 28 28 30 37 37 34 34 34 34 34 33 31 31 25 21 19 22 21 25 30 32 32 30 22 22 25 28 24 25 26 17 17 23 27 27 33 31 31 34 38 38 38 38 34 26 17 15 8 8 11 16 25 31 32 33 29 26 32 29 33 34 34 34 36 33 34 34 31 27 31 34 38 45 45 36 37 37 37 36 36 38 34 32 28 25 22 22 21 17 18 29 29 23 23 22 27 25 20 18 11 11 15 15 16 23 21 17 19 24 24 24 31 31 31 33 33 33 31 33 33 29 29 29 29 29 31 31 31 23 24 19 12 10 16 10 10 20 10 10 13 15 30 23 29 23 28 18 10 10 16 21 18 19 19 24 24 12 11 9 9 10 21 23 31 31 33 28 28 14 17 17 28 21 30 24 30 28 22 26 23 19 10 10 12 23 22 23 19 12 10 9 9 10 19 24 29 30 34 34 34 34 34 29 25 25 32 26 31 31 32 20 17 15 12 12 4 4 4 17 23 33 30 24 18 13 18 16 12 16 8 9 9 19 15 15 4 4 4 7 11 6 6 6 7 8 9 17 12 13 19 23 25 13 13 13 19 21 29 32 30 26 20 20 12 9 9 8 9 8 8 15 24 17 15 8 8 9 17 16 4 4 4 8 8 13 15 23 14 9 8 8 10 10 17 23 21 17 12 13 22 20 19 15 11 11 9 8 8 8 8 8 8 10 9 9 7 8 8 10 12 10 10 12 4 4 4 4 4 4 10 10 10 10 10 9 8 8 7 8 9 11 9 9 4"
+    assert_equal(qual,@contigs[1].quality)
+  end
+  
+  def test_read
+    read = nil
+    assert_nothing_raised do 
+      read = @contigs[0].find_read_by_name("22ak93c2.r1t")
+    end
+    seq = "GTCGCNCATAAGATTACGAGATCTCGAGCTCGGTACCCTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAGACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTGTATTTTTAGTAGGGATGGGGTTTCACCATGTTGGCCAAGCTGGTCTCGAGCTCCTGACCTAGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAGGAGGAAGGGATCCTAGAAAAACAGAGACAAGGCCAAACATGGTAGCTCACACCTGTAATCCCANCACTTTGGGAGGCCAGTGCGGGTGAATCACGAAGTCAGGAGTTCAAGACCACCCTGGCCAACATGGTGTAACACCTGCTCTCCTAAAATTAAACAAAATTTCATGGTTTGCGTGGGCCGTCTTGTCTCATCACTTCACTCCTGAGGGCCGGCGCCGGAAAGATATCTTGATCTGCGGCGCTCCGACCGTTTTCTTTAAACCTTACAACTCCCGACCTCCTCGCCTATCCTCCCTAAATCCTCGCCAGGCTCGCCTGCTTCAGCCACTCTTTCCTTCGCACCCTCCCCTCTCTTCAATATACTTCACCCGCCCATCCTTCACGCCGGCACGTATCCAATCTCTTCTTATCTTTCCGTATCCAANTCCCTTCTCCCTCTGCCGCGACCTTCGCCATCCCTCTGCGCGTCCTCTTCC"
+    assert_equal(seq,read.seq.to_s.upcase)
+    assert_instance_of(Bio::Sequence::NA,read.seq)
+    qual = "4 4 8 4 4 4 4 4 4 4 4 4 6 8 17 21 14 7 6 6 6 7 7 6 8 14 16 21 15 20 20 24 26 21 18 18 14 14 19 23 10 8 8 15 20 16 29 26 34 29 39 29 31 29 31 34 32 27 27 25 19 19 24 31 33 36 34 34 34 26 27 22 32 32 36 28 28 15 15 15 28 28 34 30 12 12 22 27 31 31 31 31 31 23 24 27 21 24 24 29 27 27 27 34 34 36 38 38 38 36 36 40 36 37 38 45 45 36 34 33 31 31 34 34 33 33 28 28 27 23 24 11 11 10 10 18 25 21 20 17 17 17 20 15 24 18 24 26 23 23 18 20 25 23 30 30 30 33 33 37 37 32 37 37 32 45 35 37 37 37 40 36 49 49 36 36 34 33 20 15 9 9 8 7 12 22 21 28 28 30 33 36 36 36 34 31 31 25 31 28 26 26 24 20 17 9 11 8 9 10 23 23 31 23 23 15 9 9 15 33 26 33 33 31 25 25 22 31 24 23 12 10 12 11 9 8 9 7 7 8 8 9 18 12 9 9 18 20 26 31 21 21 9 8 8 11 13 21 21 23 15 15 15 15 15 17 17 9 7 9 19 20 21 21 25 25 25 25 25 23 23 9 9 9 21 16 24 24 24 24 26 33 33 33 31 31 27 15 17 7 4 4 4 16 20 27 33 34 34 23 15 14 8 9 6 6 9 1 14 16 8 11 15 23 25 34 36 31 33 16 16 6 6 6 9 8 14 9 11 11 9 13 13 10 8 10 9 9 7 8 20 20 20 14 14 10 10 10 16 8 8 6 6 8 9 10 7 8 8 8 8 6 8 6 6 8 12 9 8 7 13 10 8 8 9 8 8 8 9 6 6 6 6 8 6 6 6 6 6 10 11 10 12 12 10 7 6 6 7 6 6 7 8 7 6 6 7 6 8 6 6 8 8 8 8 6 6 6 8 6 6 8 6 6 11 15 9 9 9 9 9 9 9 9 9 9 8 9 9 6 6 6 7 9 6 6 6 7 7 7 8 9 7 7 9 9 11 8 11 11 11 9 10 9 8 8 8 10 6 6 9 8 6 6 6 6 8 8 9 11 9 8 8 8 8 8 8 8 9 9 9 10 10 8 6 6 8 6 6 10 11 10 6 6 8 6 6 6 6 8 11 8 9 8 8 8 8 8 9 6 6 9 8 8 8 6 6 13 15 12 12 8 8 6 6 8 9 8 8 9 8 8 6 6 6 8 8 6 6 6 8 8 8 6 6 8 6 6 8 6 6 9 8 8 6 6 8 8 6 6 8 6 7 8 9 10 11 11 10 9 9 8 10 9 10 10 8 9 13 8 8 8 13 13 11 7 7 7 11 8 8 10 11 10 9 9 14 7 7 10 10 10 8 8 8 8 6 7 8 8 6 6 6 6 6 6 6 6 6 8 9 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 10 10 4 4 4 6 7 6 6 6 6 10 8 8 9 15 11 6 6 8 8 8 8 8 8 9 9 8 9 7 7 8 6 6 8 13 10 8 8 7 6 8 6 6 8 6 7 8 8 8 8 8 8 8 4"
+    assert_equal(qual,read.quality)
+    assert_equal(39,read.clear_range_from)
+    assert_equal(331,read.clear_range_to)
+    assert_equal(1,read.from)
+    assert_equal(293,read.to)
+    assert_equal("Reverse",read.orientation)
+    assert_instance_of(Bio::Assembly::Caf::Read,read)
+  end
+  
+  
+end

metadata

@@ -5,24 +5,38 @@ version: !ruby/object:Gem::Version
   prerelease: false
   segments: 
   - 0
+  - 1
   - 0
-  - 2
-  version: 0.0.2
+  version: 0.1.0
 platform: ruby
 authors: 
 - Chase Miller
+- Francesco Strozzi
 autorequire: 
 bindir: bin
 cert_chain: []
 
-date: 2010-12-27 00:00:00 -05:00
+date: 2011-01-12 00:00:00 -05:00
 default_executable: 
 dependencies: 
 - !ruby/object:Gem::Dependency 
-  type: :development
+  requirement: &id001 !ruby/object:Gem::Requirement 
+    none: false
+    requirements: 
+    - - ">="
+      - !ruby/object:Gem::Version 
+        hash: 5
+        segments: 
+        - 1
+        - 4
+        - 1
+        version: 1.4.1
+  type: :runtime
+  name: bio
+  version_requirements: *id001
   prerelease: false
-  name: shoulda
-  version_requirements: &id001 !ruby/object:Gem::Requirement 
+- !ruby/object:Gem::Dependency 
+  requirement: &id002 !ruby/object:Gem::Requirement 
     none: false
     requirements: 
     - - ">="
@@ -31,12 +45,12 @@ dependencies:
         segments: 
         - 0
         version: "0"
-  requirement: *id001
-- !ruby/object:Gem::Dependency 
   type: :development
+  name: shoulda
+  version_requirements: *id002
   prerelease: false
-  name: bundler
-  version_requirements: &id002 !ruby/object:Gem::Requirement 
+- !ruby/object:Gem::Dependency 
+  requirement: &id003 !ruby/object:Gem::Requirement 
     none: false
     requirements: 
     - - ~>
@@ -47,12 +61,12 @@ dependencies:
         - 0
         - 0
         version: 1.0.0
-  requirement: *id002
-- !ruby/object:Gem::Dependency 
   type: :development
+  name: bundler
+  version_requirements: *id003
   prerelease: false
-  name: jeweler
-  version_requirements: &id003 !ruby/object:Gem::Requirement 
+- !ruby/object:Gem::Dependency 
+  requirement: &id004 !ruby/object:Gem::Requirement 
     none: false
     requirements: 
     - - ~>
@@ -63,12 +77,12 @@ dependencies:
         - 5
         - 2
         version: 1.5.2
-  requirement: *id003
-- !ruby/object:Gem::Dependency 
   type: :development
+  name: jeweler
+  version_requirements: *id004
   prerelease: false
-  name: rcov
-  version_requirements: &id004 !ruby/object:Gem::Requirement 
+- !ruby/object:Gem::Dependency 
+  requirement: &id005 !ruby/object:Gem::Requirement 
     none: false
     requirements: 
     - - ">="
@@ -77,12 +91,12 @@ dependencies:
         segments: 
         - 0
         version: "0"
-  requirement: *id004
-- !ruby/object:Gem::Dependency 
   type: :development
+  name: rcov
+  version_requirements: *id005
   prerelease: false
-  name: bio
-  version_requirements: &id005 !ruby/object:Gem::Requirement 
+- !ruby/object:Gem::Dependency 
+  requirement: &id006 !ruby/object:Gem::Requirement 
     none: false
     requirements: 
     - - ">="
@@ -93,7 +107,10 @@ dependencies:
         - 4
         - 1
         version: 1.4.1
-  requirement: *id005
+  type: :development
+  name: bio
+  version_requirements: *id006
+  prerelease: false
 description: bioruby plugin to parse, write, and manipulate assembly data
 email: chmille4@gmail.com
 executables: []
@@ -112,13 +129,17 @@ files:
 - Rakefile
 - VERSION
 - bio-assembly.gemspec
+- data/example.caf
 - data/example1.ace
 - lib/bio-assembly.rb
 - lib/bio-assembly/ace.rb
+- lib/bio-assembly/caf.rb
 - lib/bio-assembly/contig.rb
+- lib/bio-assembly/maf.rb
 - lib/bio-assembly/read.rb
 - test/helper.rb
-- test/test_bio-assembly.rb
+- test/test_bio-assembly-ace.rb
+- test/test_bio-assembly-caf.rb
 has_rdoc: true
 homepage: http://github.com/chmille4/bioruby-assembly
 licenses: 
@@ -155,4 +176,5 @@ specification_version: 3
 summary: BioRuby Assembly plugin
 test_files: 
 - test/helper.rb
-- test/test_bio-assembly.rb
+- test/test_bio-assembly-ace.rb
+- test/test_bio-assembly-caf.rb