bio-assembly 0.0.2 → 0.1.0

Sign up to get free protection for your applications and to get access to all the features.
data/Gemfile CHANGED
@@ -3,6 +3,8 @@ source "http://rubygems.org"
3
3
  # Example:
4
4
  # gem "activesupport", ">= 2.3.5"
5
5
 
6
+ gem "bio", ">= 1.4.1"
7
+
6
8
  # Add dependencies to develop your gem here.
7
9
  # Include everything needed to run rake, tests, features, etc.
8
10
  group :development do
@@ -1,4 +1,4 @@
1
- Copyright (c) 2010 Chase Miller
1
+ Copyright (c) 2010 Chase Miller and Francesco Strozzi
2
2
 
3
3
  Permission is hereby granted, free of charge, to any person obtaining
4
4
  a copy of this software and associated documentation files (the
@@ -2,14 +2,54 @@
2
2
 
3
3
  BioRuby plugin for parsing, writing, and maniuplating assembly data
4
4
 
5
+ Currently supports ACE and CAF formats
6
+
5
7
  == Install
6
8
 
7
9
  gem install bio-assembly
8
10
 
9
11
  == Usage
10
12
 
11
- Examples on my blog:
12
- http://chasemiller4.blogspot.com/2010/10/bioruby-ace-parser-example.html
13
+ require 'bio-assembly'
14
+
15
+ # ace file path
16
+ asm = Bio::Assembly.new("data.ace", :ace)
17
+
18
+ # iterate through contigs (streams each contig)
19
+ asm.each_contig do |contig|
20
+
21
+ # print name and consensus seq
22
+ puts contig.name
23
+ puts contig.consensus_seq
24
+
25
+ # iterate through reads
26
+ contig.each_read do |read|
27
+
28
+ # print name, sequence and orientation
29
+ puts read.name
30
+ puts read.seq
31
+ puts read.orientation
32
+
33
+ # print the postion of the read
34
+ # in relation to the consensus seq
35
+ puts read.from
36
+ puts read.to
37
+
38
+ # print the portion of the read
39
+ # that was used to create the consensus
40
+ puts read.clear_range_from
41
+ puts read.clear_range_to
42
+
43
+ end
44
+
45
+ # grab the reads that make up a particular region of the contig
46
+ reads_in_region = contig.find_reads_in_range(10, 50)
47
+
48
+ end
49
+
50
+ # experimental - output ace
51
+ file = File.new('out.ace', 'w')
52
+ file.puts asm.to_ace
13
53
 
14
54
  == Contributing to bio-assembly
15
55
 
@@ -23,6 +63,6 @@ http://chasemiller4.blogspot.com/2010/10/bioruby-ace-parser-example.html
23
63
 
24
64
  == Copyright
25
65
 
26
- Copyright (c) 2010 Chase Miller. See LICENSE.txt for
66
+ Copyright (c) 2011 Chase Miller and Francesco Strozzi. See LICENSE.txt for
27
67
  further details.
28
68
 
data/Rakefile CHANGED
@@ -18,7 +18,7 @@ Jeweler::Tasks.new do |gem|
18
18
  gem.summary = "BioRuby Assembly plugin"
19
19
  gem.description = "bioruby plugin to parse, write, and manipulate assembly data"
20
20
  gem.email = "chmille4@gmail.com"
21
- gem.authors = ["Chase Miller"]
21
+ gem.authors = ["Chase Miller","Francesco Strozzi"]
22
22
  # Include your dependencies below. Runtime dependencies are required when using your gem,
23
23
  # and development dependencies are only needed for development (ie running rake tasks, tests, etc)
24
24
  # gem.add_runtime_dependency 'jabber4r', '> 0.1'
data/VERSION CHANGED
@@ -1 +1 @@
1
- 0.0.2
1
+ 0.1.0
@@ -5,11 +5,11 @@
5
5
 
6
6
  Gem::Specification.new do |s|
7
7
  s.name = %q{bio-assembly}
8
- s.version = "0.0.2"
8
+ s.version = "0.1.0"
9
9
 
10
10
  s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version=
11
- s.authors = ["Chase Miller"]
12
- s.date = %q{2010-12-27}
11
+ s.authors = ["Chase Miller", "Francesco Strozzi"]
12
+ s.date = %q{2011-01-12}
13
13
  s.description = %q{bioruby plugin to parse, write, and manipulate assembly data}
14
14
  s.email = %q{chmille4@gmail.com}
15
15
  s.extra_rdoc_files = [
@@ -25,13 +25,17 @@ Gem::Specification.new do |s|
25
25
  "Rakefile",
26
26
  "VERSION",
27
27
  "bio-assembly.gemspec",
28
+ "data/example.caf",
28
29
  "data/example1.ace",
29
30
  "lib/bio-assembly.rb",
30
31
  "lib/bio-assembly/ace.rb",
32
+ "lib/bio-assembly/caf.rb",
31
33
  "lib/bio-assembly/contig.rb",
34
+ "lib/bio-assembly/maf.rb",
32
35
  "lib/bio-assembly/read.rb",
33
36
  "test/helper.rb",
34
- "test/test_bio-assembly.rb"
37
+ "test/test_bio-assembly-ace.rb",
38
+ "test/test_bio-assembly-caf.rb"
35
39
  ]
36
40
  s.homepage = %q{http://github.com/chmille4/bioruby-assembly}
37
41
  s.licenses = ["MIT"]
@@ -40,7 +44,8 @@ Gem::Specification.new do |s|
40
44
  s.summary = %q{BioRuby Assembly plugin}
41
45
  s.test_files = [
42
46
  "test/helper.rb",
43
- "test/test_bio-assembly.rb"
47
+ "test/test_bio-assembly-ace.rb",
48
+ "test/test_bio-assembly-caf.rb"
44
49
  ]
45
50
 
46
51
  if s.respond_to? :specification_version then
@@ -48,12 +53,14 @@ Gem::Specification.new do |s|
48
53
  s.specification_version = 3
49
54
 
50
55
  if Gem::Version.new(Gem::VERSION) >= Gem::Version.new('1.2.0') then
56
+ s.add_runtime_dependency(%q<bio>, [">= 1.4.1"])
51
57
  s.add_development_dependency(%q<shoulda>, [">= 0"])
52
58
  s.add_development_dependency(%q<bundler>, ["~> 1.0.0"])
53
59
  s.add_development_dependency(%q<jeweler>, ["~> 1.5.2"])
54
60
  s.add_development_dependency(%q<rcov>, [">= 0"])
55
61
  s.add_development_dependency(%q<bio>, [">= 1.4.1"])
56
62
  else
63
+ s.add_dependency(%q<bio>, [">= 1.4.1"])
57
64
  s.add_dependency(%q<shoulda>, [">= 0"])
58
65
  s.add_dependency(%q<bundler>, ["~> 1.0.0"])
59
66
  s.add_dependency(%q<jeweler>, ["~> 1.5.2"])
@@ -61,6 +68,7 @@ Gem::Specification.new do |s|
61
68
  s.add_dependency(%q<bio>, [">= 1.4.1"])
62
69
  end
63
70
  else
71
+ s.add_dependency(%q<bio>, [">= 1.4.1"])
64
72
  s.add_dependency(%q<shoulda>, [">= 0"])
65
73
  s.add_dependency(%q<bundler>, ["~> 1.0.0"])
66
74
  s.add_dependency(%q<jeweler>, ["~> 1.5.2"])
@@ -0,0 +1,2755 @@
1
+ DNA : 22ak93c2.r1t
2
+ GTCGCnCATAAGATTACGAGATCTCGAGCTCGGTACCCTTCAAGCGATTCTCCTGCCTCA
3
+ GCCTCCCGAGTAGCTGGGATTATAGACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTG
4
+ TATTTTTAGTAGGGATGGGGTTTCACCATGTTGGCCAAGCTGGTCTCGAGCTCCTGACCT
5
+ AGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAGGA
6
+ GGAAGGGATCCTAgAAAAACAGAGACAAGGCCAAACATGGTAgCTCACACCTGTAATCCC
7
+ AnCACTTTGGGAGGCCagTGCGGGTGAATCACGAAGTCAGGAGTTCAAGACCACCCTGGC
8
+ CAACATGGTGTAACACCTGCTCTCCTAAAATTAAACAAAATTTCATGGTTTGCGTGGGCC
9
+ GTCTTGTCTCATCACTTCACTCCTGAGGGCCGGCGCCGGAAAGATATCTTGATCTGCGGC
10
+ GCTCCGACCGTTTTCTTTAAACCTTACAACTCCCGACCTCCTCGCCTATCCTCCCTAAAT
11
+ CCTCGCCAGGCTCGCCTGCTTCAGCCACTCTTTCCTTCGCACCCTCCCCTCTCTTCAATA
12
+ TACTTCACCCGCCCATCCTTCACGCCGGCACGTATCCAATCTCTTCTTATCTTTCCGTAT
13
+ CCAAnTCCCTTCTCCCTCTGCCGCGACCTTCGCCATCCCTCTGCGCGTCCTCTTCC
14
+
15
+ BaseQuality : 22ak93c2.r1t
16
+ 4 4 8 4 4 4 4 4 4 4 4 4 6 8 17 21 14 7 6 6 6 7 7 6 8 14 16 21 15 20 20
17
+ 24 26 21 18 18 14 14 19 23 10 8 8 15 20 16 29 26 34 29 39 29 31 29 31
18
+ 34 32 27 27 25 19 19 24 31 33 36 34 34 34 26 27 22 32 32 36 28 28 15
19
+ 15 15 28 28 34 30 12 12 22 27 31 31 31 31 31 23 24 27 21 24 24 29 27
20
+ 27 27 34 34 36 38 38 38 36 36 40 36 37 38 45 45 36 34 33 31 31 34 34
21
+ 33 33 28 28 27 23 24 11 11 10 10 18 25 21 20 17 17 17 20 15 24 18 24
22
+ 26 23 23 18 20 25 23 30 30 30 33 33 37 37 32 37 37 32 45 35 37 37 37
23
+ 40 36 49 49 36 36 34 33 20 15 9 9 8 7 12 22 21 28 28 30 33 36 36 36 34
24
+ 31 31 25 31 28 26 26 24 20 17 9 11 8 9 10 23 23 31 23 23 15 9 9 15 33
25
+ 26 33 33 31 25 25 22 31 24 23 12 10 12 11 9 8 9 7 7 8 8 9 18 12 9 9 18
26
+ 20 26 31 21 21 9 8 8 11 13 21 21 23 15 15 15 15 15 17 17 9 7 9 19 20
27
+ 21 21 25 25 25 25 25 23 23 9 9 9 21 16 24 24 24 24 26 33 33 33 31 31
28
+ 27 15 17 7 4 4 4 16 20 27 33 34 34 23 15 14 8 9 6 6 9 1 14 16 8 11 15
29
+ 23 25 34 36 31 33 16 16 6 6 6 9 8 14 9 11 11 9 13 13 10 8 10 9 9 7 8
30
+ 20 20 20 14 14 10 10 10 16 8 8 6 6 8 9 10 7 8 8 8 8 6 8 6 6 8 12 9 8 7
31
+ 13 10 8 8 9 8 8 8 9 6 6 6 6 8 6 6 6 6 6 10 11 10 12 12 10 7 6 6 7 6 6
32
+ 7 8 7 6 6 7 6 8 6 6 8 8 8 8 6 6 6 8 6 6 8 6 6 11 15 9 9 9 9 9 9 9 9 9
33
+ 9 8 9 9 6 6 6 7 9 6 6 6 7 7 7 8 9 7 7 9 9 11 8 11 11 11 9 10 9 8 8 8
34
+ 10 6 6 9 8 6 6 6 6 8 8 9 11 9 8 8 8 8 8 8 8 9 9 9 10 10 8 6 6 8 6 6 10
35
+ 11 10 6 6 8 6 6 6 6 8 11 8 9 8 8 8 8 8 9 6 6 9 8 8 8 6 6 13 15 12 12 8
36
+ 8 6 6 8 9 8 8 9 8 8 6 6 6 8 8 6 6 6 8 8 8 6 6 8 6 6 8 6 6 9 8 8 6 6 8
37
+ 8 6 6 8 6 7 8 9 10 11 11 10 9 9 8 10 9 10 10 8 9 13 8 8 8 13 13 11 7 7
38
+ 7 11 8 8 10 11 10 9 9 14 7 7 10 10 10 8 8 8 8 6 7 8 8 6 6 6 6 6 6 6 6
39
+ 6 8 9 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 10 10 4 4 4 6 7 6 6 6 6
40
+ 10 8 8 9 15 11 6 6 8 8 8 8 8 8 9 9 8 9 7 7 8 6 6 8 13 10 8 8 7 6 8 6 6
41
+ 8 6 7 8 8 8 8 8 8 8 4
42
+
43
+
44
+ Sequence : 22ak93c2.r1t
45
+ Is_read
46
+ Padded
47
+ Staden_id 11
48
+ Clipping QUAL 39 331
49
+ Align_to_SCF 1 43 1 43
50
+ Align_to_SCF 44 317 45 318
51
+ Align_to_SCF 319 716 319 716
52
+ SCF_File 22ak93c2.r1tSCF
53
+ Primer Universal_primer
54
+ Strand Reverse
55
+ Dye Dye_terminator
56
+ Template 22ak93c2
57
+ Clone bK216E10
58
+ Sequencing_vector "m13mp18"
59
+ Seq_vec SVEC 1 38 "M13mp18"
60
+ Tag ALUS 43 180
61
+ Tag DONE 43 43 "AUTO-EDIT: deleted C at 43 (terminator, isolated, strong)"
62
+ Tag DONE 254 254 "AUTO-EDIT: replaced T by g at 254 (terminator, isolated, strong)"
63
+ Tag ALUS 269 402
64
+ Tag DONE 283 283 "AUTO-EDIT: replaced T by g at 283 (terminated, isolated, strong)"
65
+ Tag AMBG 298 302 "AUTOEDIT: Check this edit cluster!"
66
+ Tag DONE 317 317 "AUTO-EDIT: replaced C by a at 317 (terminated, compound, strong)"
67
+ Tag DONE 318 318 "AUTO-EDIT: inserted g at 318 (terminated, compound, strong)"
68
+
69
+ DNA : 22ak93c1.r1ta
70
+ GGGGGGATGATACAATTCGAGCTCGGTACCTTCAAGCGATTCTCCTGCCTCAGCCTCCCG
71
+ AGTAGCTGGGATTATAAACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTGTATTTTTA
72
+ GTAGGGATGGGGTTTCACCATGTTGGCCAaGCTGGTCTCGAGCTCCTGACCTAGGATtAC
73
+ AGGCCTAaGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAgGAGGAAGGGA
74
+ TCCTAGAAAAACAGAGACAAgGCCAAACATGGTAGCTCACACCTGTAATCCCAGCACTTT
75
+ GGGAgGCCAgTGCGGGTGAATCACgAAGTCAGGAGTTCAAGACCATCCTGGCCAACATGG
76
+ TGTAACACCGTCTCTCCTAGGATAAACCGAAATCACCTGGGTGTCCTGGCAAGTGCCTGT
77
+ CATCCCTGACCACTTGGAAAGCTGAGCCGAATCCTTATCCCnGAAAGTAAGGTTACGTGA
78
+ ACCCACATCAAACCACTGCGCTCCAGCCCAAAACATCGTGTTATACTCTGTCGCGACATT
79
+ GATGCCCAAAAAACAGGACCGCTATTGGGAGACACTCCCGGGTAATTGGGATTGAGGAGG
80
+ TTAAAGAAAACTCTTGATCTGAGAAAAAAGACCCTATCCTGGCGAGAAAACCACATGTGG
81
+ ACCACACCGCTTCACTTTGTCTAAGCAAAAAACGCCCCACTTGAAGATGACCCCCCCAGC
82
+ TGAAATCTTCCATTAATCCCCGAACATAAAGGTTTAACCCAAAATTTCCTGTTAGACCGC
83
+ CTTCTGAAGTTTCTAAAATTCTATGGGTAGGGACAAAAGTCCCTCGTTGAATTTCTAGGA
84
+ TACTTCCAAATATCCCCCACCTCTCCCCTGGGATCCCGATAGCTTTCTTGTCCCTAAAAA
85
+ AAACTTTGTTCAAACGGAGAAACCACACCCGGGGAAAATTCCCCTTTTCTTGGGGTTTAG
86
+ GTTTCTTTAAATAAATGCTGGGCACCAATCCTCAAATGAGTTCTTACCCAATCCCATATG
87
+ TTTTTAATCCTCAACAACAACCTTATTTCCTTAAGAGACCTCTCCTCGGAAATCATTTCA
88
+ AAACAAAAAAAACACTTAAGCCTTGGGTCTTTGGGACCCCCCAAAAAAAAAACATAAAGG
89
+ GGTGGCACCGTATACGCCTTGCCCATCTTTCTAGTGGAAGATAACGAAACGGTAGCTGGG
90
+ GCCAACCAGGCATCAGTGGGGGATACCGCTAAATGTTGGGGAACACCCAAAAACCCATCT
91
+ GCAGGCACCGCGAATGCGGAAAAGCGCACGCTATCACAAATGGTATATGGGCACC
92
+
93
+ BaseQuality : 22ak93c1.r1ta
94
+ 8 10 8 9 16 9 9 9 11 8 8 9 10 11 11 10 19 24 26 24 26 22 21 17 13 16
95
+ 11 11 10 10 14 14 19 22 24 26 32 32 33 29 29 29 27 27 27 27 27 32 32
96
+ 25 27 20 25 19 32 27 29 32 32 32 34 34 21 23 12 14 14 27 32 32 29 28
97
+ 27 34 31 34 34 34 37 34 32 32 30 30 28 28 28 30 30 33 33 33 30 30 34
98
+ 34 34 37 40 38 37 34 32 34 32 37 32 37 37 28 28 28 33 33 33 33 32 30
99
+ 30 29 28 21 23 14 12 30 32 45 45 41 41 30 25 22 33 33 34 23 21 18 12
100
+ 12 11 13 27 27 23 23 11 11 9 10 11 18 18 30 15 20 12 11 10 20 12 14 14
101
+ 32 32 33 28 28 18 23 18 12 12 20 12 16 13 18 14 15 12 32 23 21 10 10 9
102
+ 9 10 16 18 21 9 9 9 18 21 14 14 12 10 14 14 23 27 24 19 19 24 28 30 29
103
+ 29 34 34 29 25 17 12 12 16 14 14 23 10 10 10 11 15 21 24 18 25 11 11
104
+ 15 32 28 34 34 29 32 32 37 37 34 34 31 28 28 25 22 17 14 11 10 10 8 8
105
+ 9 14 8 8 12 17 18 15 13 18 17 17 10 10 10 22 16 24 30 24 28 27 32 19
106
+ 12 12 12 30 21 17 9 9 9 9 17 16 24 24 23 20 12 12 7 7 7 14 13 10 10 10
107
+ 23 23 22 15 17 18 24 24 15 17 11 10 8 8 8 13 20 25 17 17 17 20 20 18
108
+ 10 11 12 12 11 25 10 12 12 9 8 8 8 8 8 12 14 9 9 9 9 10 10 8 8 11 9 9
109
+ 9 14 20 20 19 15 15 15 15 11 11 6 6 9 8 10 12 12 15 15 10 9 10 11 7 7
110
+ 9 11 14 11 11 10 11 9 14 14 23 19 18 14 12 10 10 10 10 10 16 11 11 9 8
111
+ 8 9 8 11 11 9 8 8 10 9 12 13 9 9 8 8 8 8 8 6 6 11 6 6 8 11 9 9 9 6 6
112
+ 12 9 9 6 6 8 11 9 8 6 7 9 9 7 8 4 4 4 6 8 6 6 8 8 6 6 8 6 8 12 12 14
113
+ 10 9 10 11 9 8 7 7 7 7 10 8 8 6 6 8 6 6 8 10 8 6 6 10 8 10 9 10 10 9 8
114
+ 8 6 6 6 6 8 8 8 9 9 9 9 7 7 9 9 10 10 10 13 12 9 9 9 9 7 8 8 8 9 8 8 9
115
+ 9 9 8 6 6 8 6 6 6 7 7 9 9 10 8 8 7 7 7 9 10 10 8 6 6 6 6 6 10 10 8 6 6
116
+ 8 8 8 7 9 7 10 7 11 8 8 8 8 9 9 9 8 8 6 6 10 11 16 8 7 7 7 6 8 6 6 8
117
+ 10 11 9 9 9 7 7 8 7 7 7 7 7 8 11 9 16 16 24 22 15 9 8 13 13 12 12 9 9
118
+ 9 9 9 7 7 7 7 7 7 7 8 7 7 7 6 9 11 9 8 8 9 9 9 7 9 10 14 12 9 9 8 8 6
119
+ 6 6 6 8 6 6 8 6 6 6 6 6 9 8 10 10 9 10 10 13 10 11 6 7 11 6 6 8 6 6 6
120
+ 6 6 6 9 9 7 7 8 8 8 8 8 9 8 9 13 11 8 6 6 6 9 9 8 8 8 8 8 8 8 11 8 7
121
+ 10 12 7 7 9 8 6 6 8 8 7 7 10 8 8 7 7 7 8 8 8 8 7 7 7 7 7 10 9 10 12 10
122
+ 7 7 6 9 6 6 6 6 7 9 7 7 4 10 9 7 6 8 6 6 8 6 6 9 6 7 7 10 10 10 10 13
123
+ 13 8 9 8 8 8 6 7 10 11 10 9 8 6 6 6 6 6 8 8 7 9 7 7 7 7 7 7 7 10 10 10
124
+ 8 8 8 7 7 8 8 8 8 6 6 7 7 7 9 8 6 8 6 6 6 8 8 8 7 9 9 12 15 9 8 7 9 8
125
+ 8 9 8 8 6 8 12 11 7 7 7 7 7 7 9 11 11 9 9 9 10 9 9 9 8 8 8 8 8 7 7 12
126
+ 13 13 15 11 11 7 7 7 9 11 10 12 6 6 6 6 8 7 7 7 8 10 10 10 10 13 9 12
127
+ 11 11 6 6 6 6 8 8 6 7 7 12 10 13 9 8 7 7 10 7 7 15 17 15 12 17 20 15
128
+ 13 15 6 6 6 6 8 8 6 6 6 7 7 7 10 7 7 10 11 8 8 5 5 8 8 12 12 8 10 6 6
129
+ 6 6 8 8 7 7 7 12 10 7 7 9 7 7 9 9 8 9 10 10 8 8 9 11 9 8 9 9 11 11 9 9
130
+ 8 6 8 6 6 6 6 6 6 6 6 8 8 8 8 12 6 6 6 6 8 6 7 7 6 8 6 6 8 8 10 11 10
131
+ 12 7 8 8 9 12 6 6 6 6 6 6 6 6 8 9 9 9 9 9 8 7 8 7 7 7 8 7 7 7 7 9 9 9
132
+ 9 6 6 6 6 14 8 8 8 8 8 6 6 7 7 7 11 9 7 6 6 6 6 10 6 6 6 8 8 7 8 7 7 6
133
+ 7 7 8 8 12 13 15 15 21 9 10 9 8 8 10 6 6 6 6 4 4 4 8 8 8 7 6 6 6 6 6 6
134
+ 6 6 6 6 6 9 9 9 6 6 6 10 6 10 15 20 12 9 8 6 6 6 6 6 8 8 6 6 6 6 8 12
135
+ 13 12 10 9 8 11 8 10 9 7 7 4 4 6 6 8 4 4 4 6 8 6 6 6 8 8 13 10 8 9 9 9
136
+ 7 7 9 10 8 8 6 6 6 6 6 6 10 11 10 10 10 7 7 8 6 6 8 6 6 8 10 13 8 11 8
137
+ 11 10 6 6 6 7 11 14 11 11 6 6 8 8 8 9 9 9 9 7 7 10 10 6 6 6 6 6 6 8 8
138
+ 8 7 7 7 8 8 11 11 11 7 6 8 6 6 8 8 6 6 10 10 13 8 8 6 6 6 8 9 9 6 6 9
139
+ 9 8 8 6 6 8 6 6 8 8 4
140
+
141
+
142
+ Sequence : 22ak93c1.r1ta
143
+ Is_read
144
+ Padded
145
+ Staden_id 12
146
+ Clipping QUAL 31 335
147
+ Align_to_SCF 1 1315 1 1315
148
+ SCF_File 22ak93c1.r1taSCF
149
+ Primer Universal_primer
150
+ Strand Reverse
151
+ Dye Dye_terminator
152
+ Template 22ak93c1
153
+ Clone bK216E10
154
+ Sequencing_vector "m13mp18"
155
+ Seq_vec SVEC 1 30 "M13mp18"
156
+ Tag ALUS 31 172
157
+ Tag DONE 150 150 "AUTO-EDIT: replaced T by a at 150 (terminator, isolated, strong)"
158
+ Tag DONE 178 178 "AUTO-EDIT: replaced G by t at 178 (terminator, isolated, strong)"
159
+ Tag DONE 188 188 "AUTO-EDIT: replaced T by a at 188 (terminator, isolated, strong)"
160
+ Tag DONE 230 230 "AUTO-EDIT: replaced T by g at 230 (terminator, isolated, strong)"
161
+ Tag DONE 261 261 "AUTO-EDIT: replaced C by g at 261 (terminated, isolated, strong)"
162
+ Tag ALUS 262 446
163
+ Tag DONE 305 305 "AUTO-EDIT: replaced T by g at 305 (terminated, isolated, strong)"
164
+ Tag DONE 310 310 "AUTO-EDIT: inserted g at 310 (terminated, compound, strong)"
165
+ Tag DONE 325 325 "AUTO-EDIT: replaced A by g at 325 (terminated, isolated, strong)"
166
+
167
+ DNA : 22am91h5.r1t
168
+ GGGnnATAGATACGATCCGAGCTCGGTACCCATGTTGGCCAAGCTGGTCTCGAGCTCCTG
169
+ ACCTAGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGC
170
+ AGGAGGAAGGGATCCTAGAAAAACAGAGACAAGGCCAAACATGGTAGCTCACACCTGTAA
171
+ TCCCAGCACTTTGGGAGGCCAGTGCGGGTGAATCACGAAGTCAGGAGTTCAAGACCAGCC
172
+ TGGCCAACATGGTGAAACACCGTCTCTACTAAAATAAAAAGAAATTAGCTGGGTGTCGTG
173
+ GCAGGTGCCTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGGAGAATCGCTTGAACCCGG
174
+ GAGGTGGAGGTTGCAnTGAGCCGAGATCACGCGACTGCACTCCAGCCCAACCAATAATGT
175
+ GAGACTCTGTCTCGAnAAnnnAAAGCnGAAAACAGACnnCTAGTACnGTACTTAACGGGG
176
+ TAATTATAATAATTAAATGAAAAAAATAnCTGTGAGGTGATTGATATAnTGCTGTTGCTA
177
+ AATACAACTAACATTTTAATATACCGGTGGAGTGTTTCTAATCTGAnAATCCAAATTAGA
178
+ AATGCTCACAGTCTGAAACTTTTTGAGCACCAACTAATGTTCAAAGAATTGCTATGGACC
179
+ ATATGGGTGGTTGATTTT
180
+
181
+ BaseQuality : 22am91h5.r1t
182
+ 4 8 4 4 4 4 4 7 10 9 10 15 10 7 7 10 10 9 19 20 33 34 34 34 36 36 33
183
+ 33 31 33 33 32 31 31 26 26 27 23 30 26 26 26 26 34 34 38 38 38 37 45
184
+ 45 37 37 37 37 45 45 45 45 37 37 37 45 45 32 18 10 21 18 28 29 33 33
185
+ 33 33 45 45 42 42 37 33 33 33 36 33 33 30 30 30 30 32 36 33 33 33 33
186
+ 33 33 37 37 45 45 37 37 37 33 33 35 35 35 35 43 35 42 42 35 35 34 34
187
+ 34 29 29 22 27 27 27 37 27 37 45 33 30 30 37 28 32 32 10 10 21 32 32
188
+ 34 27 23 12 11 9 9 9 18 21 28 31 33 30 30 30 30 34 34 34 34 31 33 34
189
+ 34 33 31 33 33 33 33 33 33 45 45 40 37 37 37 33 33 30 30 30 30 33 30
190
+ 33 26 26 26 25 23 18 14 12 20 23 27 25 21 21 21 28 28 30 31 31 31 31
191
+ 32 21 21 12 6 6 9 9 14 17 19 17 10 16 13 8 8 11 13 9 13 12 14 14 21 23
192
+ 26 34 36 34 31 22 24 20 28 28 33 27 28 25 27 24 34 32 23 12 12 12 23
193
+ 23 33 28 34 34 37 32 32 15 11 11 32 32 40 37 38 18 11 9 9 18 25 45 34
194
+ 28 28 9 9 20 29 45 38 34 23 23 10 23 23 33 33 33 21 21 13 25 25 25 29
195
+ 27 33 30 33 33 34 33 30 30 19 19 30 30 30 26 26 30 27 27 23 19 15 24
196
+ 27 28 21 9 9 9 19 14 12 10 12 12 13 17 28 18 19 21 24 24 25 24 24 24
197
+ 24 18 18 13 18 8 8 8 10 10 10 7 7 7 8 8 12 15 4 4 4 25 18 21 17 15 16
198
+ 14 9 9 17 14 17 9 17 8 8 10 10 10 11 17 17 22 24 23 24 24 19 13 10 8
199
+ 15 15 10 9 9 9 16 12 12 14 19 18 26 24 22 22 24 25 21 24 24 32 19 20 9
200
+ 9 4 4 4 4 4 4 4 4 17 16 16 4 4 4 7 10 8 7 6 13 8 8 4 4 4 4 8 8 7 7 7 4
201
+ 4 4 17 23 12 9 8 7 7 8 7 10 10 8 6 6 6 6 6 10 10 7 7 7 7 9 7 8 10 7 7
202
+ 8 6 6 8 8 8 9 10 7 12 4 4 4 9 9 7 6 6 7 6 6 10 9 7 8 10 7 7 7 9 4 4 4
203
+ 14 8 8 9 7 6 6 8 8 8 7 7 6 6 9 7 7 10 13 8 9 8 8 8 14 7 7 7 7 9 8 12
204
+ 12 4 4 4 7 7 7 7 8 8 8 7 7 7 7 7 7 8 10 8 6 6 6 4 4 4 8 12 9 9 17 9 7
205
+ 7 7 7 6 6 6 6 8 10 6 6 6 8 6 6 6 6 6 6 6 6 6 6 6 6 6 13 11 9 8 7 8 7 7
206
+ 7 8 7 9 8 7 6 6 4 6 6 8 7 7 7 6 8 6 6 8 7 7 9 9 10 11 7 6 6 6 6 6 12 9
207
+ 8 8 12 11 10 8 7 7 4 4 4 7 7 8 4
208
+
209
+
210
+ Sequence : 22am91h5.r1t
211
+ Is_read
212
+ Padded
213
+ Staden_id 20
214
+ Clipping QUAL 32 361
215
+ Align_to_SCF 1 678 1 678
216
+ SCF_File 22am91h5.r1tSCF
217
+ Primer Universal_primer
218
+ Strand Reverse
219
+ Dye Dye_terminator
220
+ Template 22am91h5
221
+ Clone bK216E10
222
+ Sequencing_vector "m13mp18"
223
+ Seq_vec SVEC 1 31 "M13mp18"
224
+ Tag ALUS 153 443
225
+
226
+ DNA : 22aq40a8.s1
227
+ AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACAGAGACAAGGCCAAACATGG
228
+ TAGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAGTGCGGGTGAATCACGAGGTCAG
229
+ GAGTTCAAGACCAGCCTGGCCAACATGGTGAA-CACCGTCTCTACTAAAATAAAAAGAAA
230
+ TTAGCTGGGTGTCGTGGCAGGTGCTtGTAATCCCAGCCACTTGGGAAGCTGAGGCAGGAG
231
+ AATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTCCA
232
+ GCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACAACTAG
233
+ TACAGTACTTACAGGGTTATTATGATGATTAnATGAGAGAATAGCTGTGAGGTGATTGAT
234
+ ATAGTGCTGTGCTTAAATACAACTATCAATTTTATTATACGGGGTTGAGTGTTTCCAATC
235
+ TGAAAATCCCAAATTTGGAATGCTCTACGGTCTGAAACCTTTTTTGAGCACCGACCTAAA
236
+
237
+ BaseQuality : 22aq40a8.s1
238
+ 7 9 10 11 11 23 27 25 25 9 9 9 12 14 23 27 24 21 21 16 22 22 22 24 23
239
+ 23 23 30 30 30 30 30 32 34 31 31 34 34 28 28 28 30 30 30 28 28 28 34
240
+ 34 34 34 34 34 37 34 34 34 34 34 34 37 37 37 37 37 37 37 32 34 29 29
241
+ 29 45 38 40 40 37 37 32 37 37 37 37 37 37 37 37 37 40 40 40 40 40 37
242
+ 30 30 32 22 22 22 32 32 41 45 45 41 41 45 30 32 27 32 32 40 37 37 40
243
+ 37 37 45 45 45 40 40 37 37 37 37 37 37 37 37 40 37 37 37 31 32 28 28
244
+ 28 32 32 37 34 37 38 38 38 27 27 11 1 11 10 21 27 34 34 37 37 34 34 45
245
+ 45 45 38 37 37 37 37 37 37 34 34 34 34 33 30 30 28 28 28 28 28 30 37
246
+ 37 37 37 33 36 36 31 31 31 24 24 24 24 21 21 17 12 4 4 4 14 17 26 25
247
+ 25 31 34 34 31 31 31 33 31 31 34 35 37 37 32 32 34 34 30 31 31 34 30
248
+ 33 30 30 30 33 33 30 30 23 22 22 32 32 40 34 36 34 31 26 28 26 24 16 9
249
+ 9 9 8 15 22 22 25 25 31 31 30 30 28 30 30 30 30 28 28 28 30 30 30 30
250
+ 30 37 32 27 23 18 18 27 27 34 34 31 33 30 30 28 28 28 28 28 30 34 33
251
+ 33 33 33 30 26 26 23 23 23 30 37 36 32 32 24 23 21 20 28 31 29 30 22
252
+ 21 18 13 15 23 26 34 34 36 33 30 30 30 30 25 25 25 26 23 26 25 24 24
253
+ 25 27 25 22 14 15 12 12 12 21 21 25 25 22 21 21 24 19 19 14 16 11 13
254
+ 14 20 27 30 28 28 28 30 33 34 34 23 23 16 7 7 4 4 4 18 17 21 23 21 17
255
+ 11 13 18 18 18 20 18 18 11 14 7 7 7 15 20 18 11 10 15 23 18 16 10 8 8
256
+ 13 17 18 14 14 14 13 13 14 17 18 13 13 9 9 9 14 12 18 18 11 11 5 5 5 6
257
+ 6 6 8 12 10 13 15 11 11 11 8 6 6 6 6 6 8 6 6 8 8 8 7 7 9 9 8 8 19 8 8
258
+ 14 8 8 6 6 11 9 9 8 14 6 6 7 7 8 6 7 6 6 9 9 10 15 14 12 7 7 7 7 13 15
259
+ 22 22 19 14 9 8 8 8 12 15 19 7 6 10 9 8 6 7 9 9 10 10 8 8 7 7 4 4
260
+
261
+
262
+ Sequence : 22aq40a8.s1
263
+ Is_read
264
+ Padded
265
+ Staden_id 3
266
+ Clipping QUAL 39 388
267
+ Align_to_SCF 1 152 1 152
268
+ Align_to_SCF 154 540 153 539
269
+ SCF_File 22aq40a8.s1SCF
270
+ Primer Universal_primer
271
+ Strand Forward
272
+ Dye Dye_primer
273
+ Template 22aq40a8
274
+ Clone bK216E10
275
+ Sequencing_vector "m13mp18"
276
+ Seq_vec SVEC 1 38 "M13mp18"
277
+ Tag ALUS 49 339
278
+ Tag DONE 206 206 "AUTO-EDIT: replaced N by t at 206 (terminated, compound, strong)"
279
+
280
+ DNA : 22an02b10.s1t
281
+ CGTGCCTGCAGGTCGACTCTAGAGGATCCCCCCTGTAATCCCAGCACTTTGGGAGGCCAg
282
+ TGCGGGTGAATCACgATGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACACCG
283
+ TCTCTACTAAAATAAAAAGAAATTAGCTGGGTGTCgTGGCAGGTGCCTGTAATCCCAGCC
284
+ ACTTGGGAAGCTGAgGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCC
285
+ GAgATCACGCGACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAA
286
+ AAAGCAGAGACAAGACAACTAGTACAGTACTTACaGGGTTATTATGATGATTAAATGAGA
287
+ gAATAGCTGTGAgGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATA
288
+ CGGGTTGAGTGTATCTAATCTGAAAATCCAAAATCAGAAATGCGCTACAGTCTGAAACTT
289
+ TTTTGAGCACCGACCTAATGTTCCAAGGAAGTGCTTATCGGAGCACCATGGGTCGGTACA
290
+ CATTTGGGTCGGGAATATnCCACCAGTGAGTACCATAAAATGCCAATATCCCCTCCCACC
291
+ CCCAACA
292
+
293
+ BaseQuality : 22an02b10.s1t
294
+ 7 7 9 12 10 15 16 17 13 13 21 18 23 17 28 28 37 37 37 33 26 26 17 19
295
+ 12 21 25 36 45 45 34 34 34 34 34 37 37 37 37 37 32 25 9 9 13 17 17 14
296
+ 18 18 21 29 32 19 18 18 18 21 9 9 9 23 19 30 30 37 29 37 37 32 34 23
297
+ 20 13 13 10 13 22 32 21 17 17 23 18 10 10 10 12 13 9 9 14 23 29 28 22
298
+ 22 32 33 37 34 34 34 34 34 34 34 30 37 32 37 37 41 34 33 33 33 21 21
299
+ 14 14 14 24 28 41 37 32 32 21 21 21 25 30 30 37 30 37 30 30 30 32 36
300
+ 28 27 17 27 27 37 32 37 36 37 25 23 10 10 10 32 21 23 10 15 10 23 23
301
+ 36 32 32 34 34 34 37 37 25 25 13 9 9 21 25 25 32 32 32 41 32 28 28 11
302
+ 22 22 32 32 13 13 10 11 9 10 10 12 12 14 32 32 29 22 22 21 21 17 21 27
303
+ 41 41 41 28 27 32 27 27 29 37 32 34 17 15 14 28 23 25 20 9 9 9 25 10
304
+ 12 12 14 13 10 10 9 16 13 23 23 14 14 22 25 34 28 28 22 28 28 28 19 18
305
+ 10 10 11 19 21 28 28 28 30 30 30 23 18 10 10 28 32 32 34 28 28 28 28
306
+ 28 31 34 34 25 25 12 19 11 14 14 25 21 24 24 18 18 18 22 23 13 11 10
307
+ 10 10 10 14 13 10 9 9 7 8 14 17 16 10 10 13 16 15 18 18 18 18 14 15 12
308
+ 12 9 12 9 12 12 13 9 14 10 18 19 14 9 13 11 18 14 15 15 16 20 19 18 14
309
+ 9 8 8 6 6 6 11 9 9 14 17 20 12 13 6 6 8 8 11 10 21 23 15 14 13 13 14
310
+ 21 27 28 32 29 34 28 27 23 14 10 10 12 17 15 13 11 11 11 18 28 33 24
311
+ 18 14 12 17 12 12 18 22 19 19 24 28 20 21 19 19 20 17 17 26 25 20 9 14
312
+ 7 7 7 15 21 33 27 27 18 20 19 15 15 20 18 14 14 8 8 9 9 9 7 7 7 7 7 8
313
+ 9 9 12 7 7 9 11 10 11 13 13 11 7 7 8 15 17 26 25 25 27 25 24 21 19 20
314
+ 18 13 13 14 9 9 14 18 17 12 15 16 21 20 18 8 7 6 6 6 13 20 25 18 11 14
315
+ 9 9 9 11 11 12 12 15 15 18 10 10 8 8 10 10 9 9 9 16 11 7 7 6 6 8 4 4 4
316
+ 4 4 6 10 10 13 13 12 6 6 6 6 12 15 12 11 11 4 4 4 6 6 6 6 6 8 6 6 6 8
317
+ 6 8 11 13 8 8 6 6 6 6 9 16 9 13 13 17 14 13 9 7 7 12 8 8 8 9 9 9 9 9 9
318
+ 8 8 8 10 9 7
319
+
320
+
321
+ Sequence : 22an02b10.s1t
322
+ Is_read
323
+ Padded
324
+ Staden_id 21
325
+ Clipping QUAL 32 446
326
+ Align_to_SCF 1 607 1 607
327
+ SCF_File 22an02b10.s1tSCF
328
+ Primer Universal_primer
329
+ Strand Forward
330
+ Dye Dye_terminator
331
+ Template 22an02b10
332
+ Clone bK216E10
333
+ Sequencing_vector "m13mp18"
334
+ Seq_vec SVEC 1 31 "M13mp18"
335
+ Tag ALUS 32 301
336
+ Tag DONE 60 60 "AUTO-EDIT: inserted g at 60 (terminated, compound, strong)"
337
+ Tag DONE 75 75 "AUTO-EDIT: replaced A by g at 75 (terminated, isolated, strong)"
338
+ Tag DONE 156 156 "AUTO-EDIT: replaced C by g at 156 (terminated, isolated, strong)"
339
+ Tag DONE 195 195 "AUTO-EDIT: replaced A by g at 195 (terminated, isolated, strong)"
340
+ Tag DONE 243 243 "AUTO-EDIT: replaced T by g at 243 (terminated, isolated, strong)"
341
+ Tag DONE 335 335 "AUTO-EDIT: replaced T by a at 335 (all_stranded, isolated, strong)"
342
+ Tag DONE 361 361 "AUTO-EDIT: replaced C by g at 361 (terminated, isolated, strong)"
343
+ Tag DONE 373 373 "AUTO-EDIT: replaced C by g at 373 (terminated, isolated, strong)"
344
+
345
+ DNA : 22ak67d6.r1t
346
+ CGCGCCCCTCnGACTCCGGCCCTAnCACGGTACCCACTTTGGGAGGCCAGTGCGGGTGAA
347
+ TCACGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACACCGTCTCTACTAA
348
+ AATAAAAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAG
349
+ CTGAgGCAGGAGAATCGCTTGAACCCGGGAgGTGGAGGTTGCAGTGAGCCGAGATCACGC
350
+ GACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGA
351
+ TCAGATCACTAGTACAGTACTTACGGGCTTATTATGATGATTAAATGAGAGAATACCTGT
352
+ GAGGTGATTGATATATTGCTGTGCTTAATACAnACTATCATTTTATTATACGGGTCGAGT
353
+ GTTTCTAATCTGACAATCCAAATTAGAAATGCTCTACAGTCTGAAACCTTTTTGAGCACC
354
+ CACCTACTGTTCAAAGGACGTGCTTATTGGAGCATTATGGGTTGTAACATTTTTGGGTTG
355
+ GGAATTTTCACCCATTAGTACTATAAATGCCATTTTCCAAAAAATCTGAATCTAAAATTT
356
+ CTGGTCCTACCAGCATTTGCTAGGGATCCCACCCGTCTTCTTCCTTACCTGTTTAAGTCT
357
+ TATAAATC
358
+
359
+ BaseQuality : 22ak67d6.r1t
360
+ 6 6 6 4 8 11 15 8 4 4 4 4 8 6 6 9 7 8 9 8 4 4 4 4 4 4 10 9 9 21 19 33
361
+ 30 33 30 30 30 28 28 28 23 23 20 11 11 16 12 13 17 21 25 28 33 33 33
362
+ 38 34 34 34 33 30 22 22 12 14 21 10 12 21 21 16 14 11 13 13 14 21 21
363
+ 21 19 15 18 23 23 25 30 28 33 38 38 33 33 30 30 30 30 30 30 30 37 37
364
+ 45 45 33 33 33 33 33 33 40 42 49 42 40 40 40 34 34 31 35 34 35 37 42
365
+ 42 37 32 19 9 9 11 23 19 28 30 30 28 38 45 37 37 37 32 32 24 34 34 30
366
+ 30 26 21 20 11 27 27 40 34 30 30 28 30 30 30 23 18 17 9 9 18 16 16 24
367
+ 24 24 23 21 18 11 11 18 25 25 16 9 7 9 15 11 8 7 9 7 7 8 16 16 27 28
368
+ 25 20 16 10 10 9 13 8 8 7 12 4 4 4 14 6 6 6 7 9 6 7 7 7 7 16 10 20 15
369
+ 13 11 9 9 8 8 8 15 8 10 10 17 14 9 9 19 15 15 7 7 12 20 19 25 25 22 18
370
+ 17 7 9 12 20 21 25 21 21 20 22 28 32 30 25 25 12 12 18 32 32 36 49 49
371
+ 33 33 24 20 13 12 16 18 20 14 25 23 25 19 12 11 8 8 4 4 4 4 4 8 8 6 4
372
+ 6 8 15 17 21 19 15 8 8 8 8 10 7 7 13 9 7 11 14 6 6 4 4 4 6 12 8 13 17
373
+ 21 18 19 19 20 18 18 15 10 15 14 13 14 8 8 8 9 8 8 10 10 8 8 15 17 17
374
+ 17 17 14 13 19 17 16 12 10 14 15 17 15 14 8 8 7 7 15 19 18 12 11 16 12
375
+ 15 11 10 13 13 11 4 4 4 10 12 12 18 12 14 9 10 9 10 21 22 18 14 6 6 6
376
+ 6 6 8 4 4 4 8 8 7 8 7 9 14 7 8 7 10 16 31 17 14 4 4 4 10 11 8 10 13 17
377
+ 13 8 8 9 8 8 12 12 14 14 7 7 7 7 7 7 7 8 9 13 11 10 7 10 7 6 6 10 8 8
378
+ 23 23 12 7 7 7 7 7 10 10 18 6 6 6 6 6 6 7 7 7 6 6 6 7 6 6 4 4 4 4 8 11
379
+ 18 15 23 11 9 8 7 7 7 7 7 7 8 15 18 8 10 10 12 8 6 8 6 6 6 7 7 12 10
380
+ 12 18 11 12 10 19 19 15 15 10 10 9 7 11 7 8 9 10 7 7 6 6 6 6 4 6 7 7 7
381
+ 7 9 9 9 13 13 9 7 7 7 9 7 7 7 6 6 6 6 8 8 9 8 11 8 7 6 6 6 6 9 7 8 7 7
382
+ 6 8 6 6 9 10 12 10 13 12 6 6 6 6 6 7 6 6 7 7 7 11 13 11 9 8 6 6 8 6 6
383
+ 8 12 14 8 8 8 6 13 8 8 8 6 7 8 7 8 9 8 10 6 6 10 11 17 20 16 11 11 7 6
384
+ 8 8 9 8 6 12 10 7 7 8 8 4
385
+
386
+
387
+ Sequence : 22ak67d6.r1t
388
+ Is_read
389
+ Padded
390
+ Staden_id 19
391
+ Clipping QUAL 30 292
392
+ Align_to_SCF 1 668 1 668
393
+ SCF_File 22ak67d6.r1tSCF
394
+ Primer Universal_primer
395
+ Strand Reverse
396
+ Dye Dye_terminator
397
+ Template 22ak67d6
398
+ Clone bK216E10
399
+ Sequencing_vector "m13mp18"
400
+ Tag ALUS 35 291
401
+ Tag DONE 185 185 "AUTO-EDIT: replaced C by g at 185 (terminated, isolated, strong)"
402
+ Tag DONE 211 211 "AUTO-EDIT: replaced T by g at 211 (terminated, isolated, strong)"
403
+
404
+ DNA : 22ak64b1.s1t
405
+ TGGGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTGAAACACCGTCTCTACTAAA
406
+ ATAAAAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAGC
407
+ TGAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAgATCACGCG
408
+ ACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGAC
409
+ AAGAcCACTAGTACAGTACTTACAGGGTtATTATGATGATTAAATGAGAGAATAGCTGTG
410
+ AGGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTG
411
+ TTTCTAATCTGAaAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACC
412
+ GACCTAAATGTTCAAAGGGAGGTGCTTAATTGGAGCATTATGGGTTGTTAGATCTTTGGG
413
+ TTGGGAATATTCAACC
414
+
415
+ BaseQuality : 22ak64b1.s1t
416
+ 4 4 8 11 13 20 16 16 16 19 24 32 31 37 37 35 34 29 32 18 32 24 33 33
417
+ 37 37 37 23 32 11 10 21 17 37 34 34 45 45 45 45 32 29 26 26 28 30 30
418
+ 33 45 45 49 49 45 43 45 45 45 45 45 37 45 45 45 45 45 45 45 37 37 37
419
+ 38 32 40 37 41 37 45 32 45 45 44 37 45 30 45 45 33 33 33 33 33 22 37
420
+ 37 45 45 45 40 37 34 37 37 33 32 32 33 33 33 33 40 40 40 42 40 42 37
421
+ 37 37 45 45 45 45 45 35 34 34 28 28 18 21 17 17 27 38 38 45 34 34 34
422
+ 34 34 34 34 34 34 34 34 34 34 34 34 37 34 34 33 33 33 33 28 31 31 36
423
+ 34 31 36 36 34 33 20 14 8 8 8 8 14 23 27 31 36 33 36 38 30 30 28 28 28
424
+ 30 30 27 30 30 30 30 33 33 23 21 18 18 17 20 32 37 37 45 45 45 45 34
425
+ 34 34 45 45 45 44 45 37 45 45 45 37 40 37 37 33 40 44 40 40 36 31 31
426
+ 28 25 22 27 14 14 8 9 10 8 7 8 7 12 18 18 23 15 9 9 15 15 20 20 25 28
427
+ 25 21 21 18 18 8 9 8 6 6 8 11 14 28 28 28 30 30 30 30 31 30 31 25 22
428
+ 22 27 15 15 15 16 13 17 25 25 30 25 27 28 31 24 24 19 24 29 33 27 31
429
+ 31 31 31 28 27 22 14 15 27 32 40 37 36 36 36 33 33 34 33 27 13 14 7 7
430
+ 8 18 23 32 32 23 20 20 33 30 27 27 21 14 14 18 21 18 21 15 15 17 11 11
431
+ 16 24 23 30 23 14 10 13 14 15 10 8 9 16 16 28 4 4 4 10 11 12 9 8 10 14
432
+ 20 18 19 19 19 10 10 12 15 25 23 26 26 28 18 14 14 16 20 15 14 12 12
433
+ 12 21 23 25 24 21 17 17 14 21 20 19 12 9 9 8 9 8 10 7 6 9 8 7 8 9 7 7
434
+ 7 6 6 8 7 8 6 6 6 6 6 13 11 6 6 6 8 10 11 8 9 9 10 10 15 10 11 12 16
435
+ 13 10 9 7 7 7 7 9 10 8 8 7 6 6 6 6 6 14 10 7 7 7 9 9 10 11 16 16 7 6 4
436
+ 4 4 8 4
437
+
438
+
439
+ Sequence : 22ak64b1.s1t
440
+ Is_read
441
+ Padded
442
+ Staden_id 8
443
+ Clipping QUAL 40 416
444
+ Align_to_SCF 1 496 1 496
445
+ SCF_File 22ak64b1.s1tSCF
446
+ Primer Universal_primer
447
+ Strand Forward
448
+ Dye Dye_terminator
449
+ Template 22ak64b1
450
+ Clone bK216E10
451
+ Sequencing_vector "m13mp18"
452
+ Seq_vec SVEC 1 39 "M13mp"
453
+ Tag CONF 44 44 "AUTOEDIT: possible compression"
454
+ Tag CONF 96 96 "AUTOEDIT: possible compression"
455
+ Tag DONE 172 172 "AUTO-EDIT: replaced A by g at 172 (terminated, isolated, strong)"
456
+ Tag DONE 245 245 "AUTO-EDIT: replaced A by c at 245 (all_stranded, compound, strong)"
457
+ Tag AMBG 246 246 "AUTOEDIT: Check this edit stack (conflict & possible misassembly))!"
458
+ Tag DONE 269 269 "AUTO-EDIT: replaced C by t at 269 (all_stranded, isolated, strong)"
459
+ Tag DONE 373 373 "AUTO-EDIT: replaced N by a at 373 (terminated, isolated, strong)"
460
+
461
+ DNA : 22ak81h10.s1t
462
+ GTGGCATGCCTGCAGGTCAACTCTAAAAGATCCCCTGAAACACCGTCTCTACTAAAATAA
463
+ AAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAgCCACTTGGGAAGCTGAG
464
+ GCAGGAGAATCGCTTGAACCCGGGAgGTGGAgGTTGCAGTGAGCCGAGATCACGCGACTG
465
+ CACTCCAGCCCAAcCAATAGTGTGAGACTCTGTCTCGAaaAAaAAAAAGCAgAGACaAGA
466
+ CCACTAGTACAGTACTTACAGGGTTATTATGATGATTAAaTGAGAGAATAGCTGTGAGGT
467
+ GATTGATATAGTGCTGTGCTTAATACaAACTATCATTTTATTATACGGGTTGAGTGTTTC
468
+ TAATCTGAAAATCCaaAATTAGAAATGCTCTACAGTCTGAAACTTTtTTGAGCACCGACC
469
+ TACTGTGCACAGGAAGTGCTTATTGGAGCATGATGGGTTGTTACATATTTGGGTTGGGAA
470
+ TATTCACCCAGTAAGTACTATAAAATGCAAATATTCCAACAAG
471
+
472
+ BaseQuality : 22ak81h10.s1t
473
+ 6 6 6 6 6 8 9 16 11 13 21 20 22 22 22 15 14 9 9 9 9 15 18 15 9 9 9 9 9
474
+ 15 23 36 36 36 36 34 38 40 30 28 28 28 30 32 37 37 36 38 37 44 45 45
475
+ 49 49 45 45 37 37 38 45 45 45 38 37 37 38 38 37 37 34 34 34 32 32 38
476
+ 45 49 45 45 45 45 37 33 33 27 27 18 18 30 32 36 36 36 36 36 36 36 34
477
+ 32 21 18 4 4 4 18 17 27 28 33 36 36 36 49 36 36 36 34 34 45 27 27 30
478
+ 25 27 12 20 20 34 34 38 37 37 34 34 25 25 18 18 21 29 38 45 21 28 14
479
+ 14 14 27 21 34 18 17 17 32 27 25 22 13 13 10 18 15 32 32 32 37 28 22
480
+ 22 21 14 10 10 11 23 22 28 20 14 14 8 8 11 20 20 16 12 16 16 28 21 19
481
+ 10 10 10 19 18 20 20 14 14 32 32 34 32 25 18 18 18 18 27 32 32 24 24
482
+ 23 23 14 10 10 10 9 9 10 11 12 12 12 12 17 11 11 11 10 8 6 6 8 8 10 16
483
+ 16 16 11 14 10 9 9 9 17 11 11 11 14 15 22 18 14 14 11 11 15 27 22 19
484
+ 23 27 30 28 22 18 16 11 10 10 11 9 10 11 11 12 15 20 27 27 23 21 14 10
485
+ 10 10 10 14 22 25 22 14 14 22 32 38 34 34 34 31 24 18 14 12 9 10 10 23
486
+ 18 24 16 16 18 18 18 19 18 17 21 18 18 12 14 21 27 37 34 34 28 28 34
487
+ 27 27 28 31 20 18 11 9 9 12 11 11 27 15 15 20 23 26 14 8 8 8 8 14 16
488
+ 23 19 19 28 31 31 31 25 18 11 11 18 10 10 10 10 11 12 16 16 21 23 12
489
+ 12 13 23 13 13 19 11 10 10 10 10 10 18 21 28 16 19 29 32 19 19 8 8 8
490
+ 10 10 18 18 22 21 16 18 22 21 11 11 14 14 15 14 18 7 7 7 7 7 7 14 18
491
+ 10 10 9 9 14 15 15 23 20 22 19 19 21 16 11 11 9 8 8 9 9 18 14 11 9 9
492
+ 15 8 9 10 8 9 8 8 8 14 14 25 27 16 9 8 14 8 9 17 13 18 15 8 8 7 7 7 7
493
+ 6 6 6 6 6 4 4 4 8 9 10 17 11 15 12 17 9 9 10 7 7 7 10 11 10 7 7 7 6 6
494
+ 8 6 6 8 4
495
+
496
+
497
+ Sequence : 22ak81h10.s1t
498
+ Is_read
499
+ Padded
500
+ Staden_id 5
501
+ Clipping QUAL 36 418
502
+ Align_to_SCF 1 523 1 523
503
+ SCF_File 22ak81h10.s1tSCF
504
+ Primer Universal_primer
505
+ Strand Forward
506
+ Dye Dye_terminator
507
+ Template 22ak81h10
508
+ Clone bK216E10
509
+ Sequencing_vector "m13mp18"
510
+ Seq_vec SVEC 1 35 "M13mp1"
511
+ Tag ALUS 36 216
512
+ Tag DONE 103 103 "AUTO-EDIT: replaced N by g at 103 (terminated, isolated, strong)"
513
+ Tag DONE 146 146 "AUTO-EDIT: replaced T by g at 146 (terminated, isolated, strong)"
514
+ Tag DONE 152 152 "AUTO-EDIT: replaced A by g at 152 (terminated, isolated, strong)"
515
+ Tag DONE 194 194 "AUTO-EDIT: replaced G by c at 194 (all_stranded, isolated, strong)"
516
+ Tag DONE 219 219 "AUTO-EDIT: replaced G by a at 219 (all_stranded, compound, strong)"
517
+ Tag DONE 220 220 "AUTO-EDIT: replaced C by a at 220 (all_stranded, compound, strong)"
518
+ Tag DONE 223 223 "AUTO-EDIT: replaced G by a at 223 (all_stranded, isolated, strong)"
519
+ Tag DONE 232 232 "AUTO-EDIT: replaced C by g at 232 (all_stranded, isolated, strong)"
520
+ Tag DONE 237 237 "AUTO-EDIT: replaced G by a at 237 (all_stranded, isolated, strong)"
521
+ Tag DONE 280 280 "AUTO-EDIT: replaced G by a at 280 (terminated, isolated, strong)"
522
+ Tag DONE 327 327 "AUTO-EDIT: replaced G by a at 327 (terminated, isolated, strong)"
523
+ Tag DONE 375 375 "AUTO-EDIT: replaced T by a at 375 (terminated, compound, strong)"
524
+ Tag DONE 376 376 "AUTO-EDIT: replaced C by a at 376 (terminated, compound, strong)"
525
+ Tag DONE 407 407 "AUTO-EDIT: replaced C by t at 407 (terminated, isolated, strong)"
526
+
527
+ DNA : 22ak66c6.s1t
528
+ nCGTGGCTGCCTGCAGGTCGACTCTAGAGGATCCCCACCGTCTCTACTAAAATAAAAAGA
529
+ AATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGG
530
+ AGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTC
531
+ CAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACAACT
532
+ AGTACAGTACTTACAGGGTTATTATGATGATTAAATGAGAGAATAGCTGTGAGGTGATTG
533
+ ATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTGTTTCTAATC
534
+ TGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATG
535
+ TTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATATTC
536
+ AACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATtTC
537
+ TGGTCCTAAGCAAGCATnTTGCAAAGGGATACGCAACCTGTAGTACGTCCTTTATCATTG
538
+ TnTCAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAnCAnATTCGATTGTA
539
+ TTATT
540
+
541
+ BaseQuality : 22ak66c6.s1t
542
+ 4 4 8 4 6 10 13 21 24 25 33 33 33 30 27 21 15 27 19 30 30 33 33 30 21
543
+ 21 10 9 17 11 27 27 37 38 33 35 35 35 35 44 45 45 38 37 37 45 45 45 43
544
+ 43 43 45 45 45 45 45 45 45 21 21 23 30 30 34 37 37 38 45 32 45 37 41
545
+ 37 45 30 45 45 34 34 34 32 29 22 32 32 45 45 45 33 28 28 37 37 34 34
546
+ 34 35 34 34 34 34 34 34 37 37 40 41 37 34 37 37 37 32 24 22 27 29 25
547
+ 27 20 21 21 21 27 45 41 40 40 40 42 34 34 37 41 45 51 45 45 37 30 37
548
+ 41 41 37 36 28 30 30 30 22 33 33 35 33 33 41 51 51 45 39 39 39 30 28
549
+ 33 34 34 39 34 41 34 34 41 33 33 39 39 39 33 33 33 30 33 33 33 30 29
550
+ 19 19 24 25 32 33 45 36 36 36 36 41 41 30 30 30 37 37 43 51 51 51 51
551
+ 45 37 37 30 37 37 37 51 51 51 51 51 37 37 28 28 10 10 10 13 10 10 10 9
552
+ 9 9 21 21 28 37 37 37 33 33 33 33 33 33 34 34 34 33 33 33 33 21 25 25
553
+ 22 22 29 29 33 33 33 33 31 31 27 28 17 23 23 28 26 24 32 10 10 10 15
554
+ 15 26 32 32 37 45 45 32 45 33 26 24 32 37 37 35 34 37 35 37 34 37 37
555
+ 40 37 37 45 45 38 38 45 45 40 37 37 37 34 30 30 28 28 28 30 37 37 34
556
+ 34 34 34 34 33 31 31 25 21 19 22 21 25 30 32 32 30 22 22 25 28 24 25
557
+ 26 17 17 23 27 27 33 31 31 34 38 38 38 38 34 26 17 15 8 8 11 16 25 31
558
+ 32 33 29 26 32 29 33 34 34 34 36 33 34 34 31 27 31 34 38 45 45 36 37
559
+ 37 37 36 36 38 34 32 28 25 22 22 21 17 18 29 29 23 23 22 27 25 20 18
560
+ 11 11 15 15 16 23 21 17 19 24 24 24 31 31 31 33 33 33 31 33 33 29 29
561
+ 29 29 29 31 31 31 23 24 19 12 10 16 10 10 20 10 10 13 15 30 23 29 23
562
+ 28 18 10 10 16 21 18 19 19 24 24 12 11 9 9 10 21 23 31 31 33 28 28 14
563
+ 17 17 28 21 30 24 30 28 22 26 23 19 10 10 12 23 22 23 19 12 10 9 9 10
564
+ 19 24 29 30 34 34 34 34 34 29 25 25 32 26 31 31 32 20 17 15 12 12 4 4
565
+ 4 17 23 33 30 24 18 13 18 16 12 16 8 9 9 19 15 15 4 4 4 7 11 6 6 6 7 8
566
+ 9 17 12 13 19 23 25 13 13 13 19 21 29 32 30 26 20 20 12 9 9 8 9 8 8 15
567
+ 24 17 15 8 8 9 17 16 4 4 4 8 8 13 15 23 14 9 8 8 10 10 17 23 21 17 12
568
+ 13 22 20 19 15 11 11 9 8 8 8 8 8 8 10 9 9 7 8 8 10 12 10 10 12 4 4 4 4
569
+ 4 4 10 10 10 10 10 9 8 8 7 8 9 11 9 9 4
570
+
571
+
572
+ Sequence : 22ak66c6.s1t
573
+ Is_read
574
+ Padded
575
+ Staden_id 18
576
+ Clipping QUAL 37 548
577
+ Align_to_SCF 1 665 1 665
578
+ SCF_File 22ak66c6.s1tSCF
579
+ Primer Universal_primer
580
+ Strand Forward
581
+ Dye Dye_terminator
582
+ Template 22ak66c6
583
+ Clone bK216E10
584
+ Sequencing_vector "m13mp18"
585
+ Seq_vec SVEC 1 36 "M13mp"
586
+ Tag ALUS 38 221
587
+ Tag DONE 538 538 "AUTO-EDIT: replaced N by t at 538 (terminated, isolated, strong)"
588
+
589
+ DNA : 22ak93c1.s1lt
590
+ TTTCTTTGGGGGCAATCTTGATGCTAGCGTCGTTCAAGATGATCCACACCCAGCTCACTG
591
+ TTTTATTCTCTCCAATAATCCTAAGCAAGCTCTCAAAATATAAATATGCTTTTTAATAAT
592
+ ACAATCGAATTTGCTATACCACCTCAGAATCTGTACCACAATATATTAACTACTTAAAAC
593
+ AATGATAAAGAACGTACTACAGGTTGCGTATCCCTTTGCAAAATGCTTGCTTAGGACCAG
594
+ AAATGTTTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTACTGGTTG
595
+ AATATTCCCAACCCAAAAATCTAACAACCCATAATGCTCCAATAAGCACTTCCTTTGAAC
596
+ ATTAGGTCGGTGCTCAAAAAAGTTTCAGACTGTAGAGCATTTCTAATTTTGGATTTTCAG
597
+ ATTAGAAACACTCAACCCGTATAATAAAATGATAGTTTGTATTAAGCACAGCACTATATC
598
+ AATCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTACTGTACTA
599
+ gTTGTCTTGTCTCTGCTTTTTTTTTTTCgAgACAGAGTCTCACACTATTGGTTGGGCTGG
600
+ AATGCAnTCGCGTGATCTCGGCTCACTGGCAACCTCCACCTCCCGGGG
601
+
602
+ BaseQuality : 22ak93c1.s1lt
603
+ 4 4 4 4 4 4 4 4 9 6 4 8 15 11 4 6 4 12 8 9 10 12 11 8 8 6 7 8 14 14 9
604
+ 4 4 8 8 8 8 8 4 6 8 11 9 10 8 9 9 11 10 9 9 9 9 9 9 16 16 32 23 29 21
605
+ 27 27 22 22 20 28 32 37 37 34 31 30 28 28 24 29 29 34 34 38 32 32 18
606
+ 22 18 22 22 28 29 37 37 37 37 35 35 34 34 35 34 37 37 37 37 37 37 34
607
+ 37 37 37 37 32 32 28 28 31 30 30 30 23 23 23 28 27 21 32 13 13 16 24
608
+ 32 34 31 30 28 28 28 28 28 34 34 34 34 33 25 16 9 9 10 23 32 33 41 37
609
+ 34 28 30 30 30 28 28 22 27 25 32 25 30 27 22 24 22 22 28 25 24 30 30
610
+ 30 30 30 30 24 28 13 10 10 23 20 18 9 9 9 18 23 30 30 30 28 24 19 25
611
+ 11 11 12 27 31 34 30 30 30 30 37 45 51 41 39 28 28 28 25 25 24 30 34
612
+ 39 39 39 39 39 39 36 31 13 10 9 10 10 23 23 9 9 13 23 31 31 14 14 31
613
+ 31 13 9 9 9 23 23 23 13 9 9 9 31 31 41 51 36 31 14 13 31 19 30 31 31
614
+ 22 34 25 33 33 33 30 24 29 30 18 24 24 11 11 24 24 33 39 34 34 30 30
615
+ 34 22 22 14 19 18 23 23 17 31 24 37 33 33 33 33 33 28 34 18 18 27 34
616
+ 34 38 27 20 20 24 24 30 30 39 34 34 30 22 22 24 33 33 33 33 28 24 24
617
+ 22 30 22 24 24 33 33 33 39 51 51 41 32 27 17 25 17 31 31 34 19 15 10
618
+ 10 31 14 27 21 30 30 24 24 30 34 39 39 41 36 34 30 30 30 34 31 16 9 9
619
+ 10 20 19 16 11 9 9 9 13 23 22 28 28 37 33 33 33 28 32 18 13 10 20 18
620
+ 10 32 21 31 23 14 9 9 9 16 11 9 9 10 20 25 33 30 30 28 32 28 28 37 35
621
+ 35 34 34 34 34 34 37 40 37 33 32 25 12 10 10 16 16 28 32 32 34 30 28
622
+ 28 29 31 33 32 28 30 30 25 21 16 19 19 19 27 19 14 14 22 22 28 25 29
623
+ 29 29 30 30 23 23 21 18 14 21 17 24 19 32 32 37 37 31 30 30 28 31 30
624
+ 34 34 28 28 28 28 31 31 30 28 28 28 30 30 25 32 10 10 10 23 23 27 17
625
+ 17 22 17 23 23 23 24 20 17 4 4 4 14 16 24 22 19 18 13 19 9 12 14 25 25
626
+ 33 32 29 40 38 49 49 49 34 34 17 14 8 7 7 9 9 10 8 7 7 9 10 15 17 18
627
+ 22 24 18 18 18 22 20 24 24 28 18 19 18 19 21 24 25 14 12 8 8 9 14 12 4
628
+ 4 4 17 17 17 14 9 9 9 12 21 21 18 12 10 13 10 11 9 12 12 8 7 8 8 9 10
629
+ 9 15 10 8 9 10 10 21 21 28 27 18 14 7 7
630
+
631
+
632
+ Sequence : 22ak93c1.s1lt
633
+ Is_read
634
+ Padded
635
+ Staden_id 1
636
+ Clipping QUAL 56 598
637
+ Align_to_SCF 1 648 1 648
638
+ SCF_File 22ak93c1.s1ltSCF
639
+ Primer Universal_primer
640
+ Strand Forward
641
+ Dye Dye_primer
642
+ Template 22ak93c1
643
+ Clone bK216E10
644
+ Sequencing_vector "m13mp18"
645
+ Seq_vec SVEC 1 47 "M13mp18"
646
+ Tag DONE 541 541 "AUTO-EDIT: replaced N by g at 541 (all_stranded, isolated, strong)"
647
+ Tag ALUS 559 647
648
+ Tag DONE 569 569 "AUTO-EDIT: replaced A by g at 569 (all_stranded, isolated, strong)"
649
+ Tag DONE 571 571 "AUTO-EDIT: replaced A by g at 571 (all_stranded, isolated, strong)"
650
+
651
+ DNA : 22ak64e2.s1t
652
+ GTAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTTTGCAAAATGCTTGCTTA
653
+ GGACCAGAAATGTTTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTA
654
+ CTGGTTGAATATTCCCAACCCAAAAATCTAACAACCCATAATGCTCCAATAAGCACTTCC
655
+ TTTGAACATTAGGTCGGTGCTCAAAAAAGTTTCAGACTGTAGAGCATTTCTAATTTTGGA
656
+ TTTTCAGATTAGAAACACTCAACCCGTATAATAAAATGATAGTTTGTATTAAGCACAGCA
657
+ CTATATCAATCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTAC
658
+ TGTACTAGTTGTCTTGTCTCTGCTTTTTTTTTTTCGAGACAGAGTCTCACACTATTGGTT
659
+ GGACTGGAGTGCAATTCnCCTGAATTCGGCTCACGGCAACTTCAACCTCCCGGGTTCAAG
660
+ TGAATCTCCTC
661
+
662
+ BaseQuality : 22ak64e2.s1t
663
+ 4 4 8 10 12 15 18 18 28 30 30 30 30 26 37 34 30 30 22 22 20 23 16 11
664
+ 11 18 23 23 23 28 9 9 10 9 21 12 32 34 45 45 45 45 38 30 30 30 30 30
665
+ 28 34 30 33 33 33 33 33 43 45 45 32 18 10 11 11 25 23 10 10 22 32 38
666
+ 37 27 27 27 23 20 9 9 10 23 25 25 21 9 9 10 29 32 45 45 45 45 45 45 37
667
+ 37 37 38 45 37 41 28 29 28 28 28 28 34 34 33 33 33 28 28 34 33 34 34
668
+ 34 34 34 34 45 37 37 29 37 37 45 45 45 45 42 37 34 35 35 35 34 34 34
669
+ 34 34 37 37 37 45 45 35 35 35 35 35 35 35 37 37 37 37 45 37 42 42 33
670
+ 30 30 33 33 33 40 34 34 34 34 34 34 40 40 40 37 37 37 34 34 34 34 34
671
+ 31 31 27 28 19 21 19 28 28 30 32 34 34 31 31 31 33 39 27 20 7 7 8 8 14
672
+ 15 11 11 17 28 23 28 17 9 9 11 23 27 33 33 40 40 40 40 40 40 40 37 32
673
+ 32 31 31 28 37 30 33 25 21 13 13 14 26 22 11 11 21 21 30 33 31 31 33
674
+ 37 37 37 45 49 45 40 40 40 40 40 45 40 40 40 40 40 31 29 29 32 27 37
675
+ 37 45 45 45 40 37 37 37 37 37 33 34 33 33 30 30 34 34 36 36 36 30 30
676
+ 28 28 28 27 38 38 36 31 33 32 27 20 20 20 28 32 33 24 24 29 36 34 30
677
+ 33 30 26 26 26 30 30 26 37 36 34 33 30 31 31 28 27 27 25 24 29 33 27
678
+ 27 31 31 31 31 33 36 38 38 32 32 21 13 13 16 19 19 24 25 33 30 33 33
679
+ 33 38 39 40 44 40 40 36 33 37 40 40 40 40 49 40 36 33 31 26 23 23 21
680
+ 18 20 14 12 11 14 17 25 31 33 33 33 36 30 30 30 30 30 28 28 20 15 14 4
681
+ 4 4 12 9 9 4 4 4 7 8 7 7 7 7 4 4 4 7 8 10 7 6 9 9 9 7 7 11 17 19 9 8 7
682
+ 7 8 7 8 9 7 6 10 6 7 6 6 7 7 8 8 8 12 13 8 8 8 8 10 10 9 8 7 6 6 8 13
683
+ 7 7 7 7
684
+
685
+
686
+ Sequence : 22ak64e2.s1t
687
+ Is_read
688
+ Padded
689
+ Staden_id 14
690
+ Clipping QUAL 41 420
691
+ Align_to_SCF 1 491 1 491
692
+ SCF_File 22ak64e2.s1tSCF
693
+ Primer Universal_primer
694
+ Strand Forward
695
+ Dye Dye_terminator
696
+ Template 22ak64e2
697
+ Clone bK216E10
698
+ Sequencing_vector "m13mp18"
699
+ Seq_vec SVEC 1 40 "M13mp"
700
+
701
+ DNA : 22ak70f10.s1t
702
+ TTGGCTGCCTGCAGGTCGACTCTAGAGGATCCCCCAGGGTTATTATGATGATTAAATGAG
703
+ AGAATAGCTGTGAGGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTAT
704
+ ACGGGTTGAGTGTTTCTAATCTGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACT
705
+ TTTTTGAGCACCGACCTAATGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAG
706
+ ATTTTTGGGTTGGGAATATTCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAA
707
+ ATCTGAAATCTGAAACATTTCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCT
708
+ GTAGTACGTTCTTTATCATTGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGT
709
+ GGTATAGCAAATTCGATTGTATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAG
710
+ GATTATTGGAGAGAATAAAACAGTGAAGCTTTGGTGTTATGAGGGAATnTTAGATAGAAA
711
+ AGTGCAGTnTTTCAGTTCATGCTCTnTCATTTnTTACTCCCTCCGGTTAAAGCTGAAGCT
712
+ CAACAAAGATATAGTGATCTCTGTGGGCATTATAATCCTGTCCC
713
+
714
+ BaseQuality : 22ak70f10.s1t
715
+ 4 4 6 8 8 9 19 23 33 33 34 33 27 21 18 27 18 27 27 34 34 31 27 23 13
716
+ 11 19 16 31 31 37 45 45 34 34 31 31 22 31 25 31 37 45 45 45 45 37 37
717
+ 37 37 37 37 45 37 37 37 45 38 29 27 27 32 32 37 45 33 37 37 45 37 45
718
+ 45 37 37 37 40 40 40 37 45 37 37 34 33 33 34 34 34 37 33 40 37 37 37
719
+ 33 33 33 33 33 33 33 33 33 32 33 41 41 35 35 35 40 40 36 36 36 34 33
720
+ 33 37 37 37 37 37 41 45 30 30 41 41 37 28 45 18 18 29 35 37 37 37 37
721
+ 41 41 51 51 51 51 51 33 33 33 33 33 33 45 45 45 41 39 39 51 51 41 45
722
+ 45 45 45 35 33 33 33 33 33 40 51 51 51 51 51 51 51 51 51 43 45 39 34
723
+ 30 30 33 33 33 33 45 45 38 38 38 38 33 30 29 14 15 27 27 30 33 51 51
724
+ 41 41 37 34 37 37 37 40 40 40 37 45 51 33 33 33 33 33 33 37 37 31 45
725
+ 33 25 22 27 21 28 33 28 28 33 41 37 45 41 33 45 33 22 22 33 33 34 44
726
+ 44 45 45 33 33 33 33 33 30 34 34 34 34 37 37 29 34 37 33 33 33 33 33
727
+ 33 34 40 33 33 33 30 30 30 37 37 37 30 30 33 30 33 33 49 49 45 45 45
728
+ 45 45 45 44 38 38 38 44 38 45 45 49 40 40 35 35 35 35 38 37 40 37 37
729
+ 34 34 34 34 34 34 34 36 36 36 34 36 33 31 31 36 33 28 28 27 23 19 17
730
+ 17 23 23 23 33 27 28 28 28 30 33 40 40 31 31 17 20 20 28 32 25 17 17
731
+ 32 27 37 37 36 33 33 33 33 32 36 34 28 30 32 31 31 14 18 10 9 9 19 21
732
+ 30 31 38 38 38 37 37 31 34 34 36 31 30 31 31 31 31 33 33 33 39 30 25
733
+ 24 24 29 33 33 34 33 33 23 23 12 23 23 30 33 33 37 37 37 38 40 37 34
734
+ 33 37 36 33 33 33 33 33 33 36 28 28 22 24 24 24 21 29 33 33 33 34 33
735
+ 33 33 33 33 33 33 33 33 27 28 28 31 31 23 27 19 15 11 20 21 33 33 31
736
+ 31 31 31 31 26 28 24 24 24 29 24 29 29 33 27 31 27 30 36 29 18 20 12
737
+ 17 9 9 9 19 19 15 8 8 13 15 14 8 9 9 9 10 12 4 4 4 9 10 11 12 24 26 18
738
+ 13 13 11 11 13 10 16 14 13 12 4 4 4 17 11 7 7 8 7 8 8 8 20 20 26 16 14
739
+ 4 4 4 8 8 10 18 4 4 4 8 8 21 11 13 10 8 10 6 6 6 6 6 8 9 12 14 17 11
740
+ 14 14 8 8 8 7 9 7 8 8 12 9 9 8 8 7 10 10 12 10 9 8 16 9 8 8 8 7 6 6 8
741
+ 6 6 6 6 6 6 6 9 12 7 7 8 8 7 7 7 12 8 7 7
742
+
743
+
744
+ Sequence : 22ak70f10.s1t
745
+ Is_read
746
+ Padded
747
+ Staden_id 2
748
+ Clipping QUAL 35 508
749
+ Align_to_SCF 1 644 1 644
750
+ SCF_File 22ak70f10.s1tSCF
751
+ Primer Universal_primer
752
+ Strand Forward
753
+ Dye Dye_terminator
754
+ Template 22ak70f10
755
+ Clone bK216E10
756
+ Sequencing_vector "m13mp18"
757
+ Seq_vec SVEC 1 34 "M13mp1"
758
+ Seq_vec SVEC 584 644 "M13mp1"
759
+
760
+ DNA : 22ak92c4.s1t
761
+ nGGGCGCTGCCTGCAGGTCGACTCTAnAGGATCCCCATTATACGGGTTGAGTGTTTCTAA
762
+ TCTGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAA
763
+ TGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATAT
764
+ TCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATT
765
+ TCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACGTTCTTTATCAT
766
+ TGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGCAAATTCGATTG
767
+ TATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTGGAGAGAATAAA
768
+ ACAGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGTTTTTCAGTTCA
769
+ TGCTCTTTCATTTC
770
+
771
+ BaseQuality : 22ak92c4.s1t
772
+ 4 4 6 4 6 8 11 14 18 26 32 34 36 34 23 25 10 23 9 23 23 34 29 23 22 4
773
+ 4 4 16 14 25 24 29 33 30 33 33 33 33 40 37 40 45 28 28 25 15 18 32 32
774
+ 17 14 28 13 13 38 38 40 40 37 37 37 37 38 45 45 45 38 33 32 33 33 33
775
+ 33 38 38 38 45 32 30 45 32 34 34 34 34 40 33 33 32 32 28 28 38 45 45
776
+ 49 45 45 45 45 40 37 41 45 45 40 30 30 33 33 33 33 40 40 45 45 45 45
777
+ 32 32 28 11 12 27 25 33 33 45 41 33 32 14 14 28 33 37 37 37 37 37 45
778
+ 45 37 37 37 37 37 37 37 37 28 33 32 21 14 32 20 24 32 21 21 32 36 41
779
+ 41 45 32 32 28 13 13 33 33 45 51 51 41 37 32 32 32 32 32 32 34 34 30
780
+ 30 31 32 12 12 27 31 30 35 35 35 33 39 41 28 28 28 28 28 28 41 41 41
781
+ 30 32 30 30 30 32 51 51 51 51 45 45 45 45 45 45 45 45 51 45 45 45 45
782
+ 33 33 33 33 33 33 51 51 51 51 51 41 41 45 45 45 39 39 39 39 39 39 41
783
+ 41 41 41 40 33 33 33 33 33 33 41 45 41 41 41 41 33 33 33 33 33 33 51
784
+ 51 45 34 22 22 20 28 30 17 15 15 45 30 33 33 33 33 33 33 33 33 37 37
785
+ 32 33 33 25 25 9 10 9 14 14 33 33 34 34 41 40 40 40 40 37 40 37 37 34
786
+ 33 33 29 24 22 32 32 45 45 40 27 27 14 32 32 45 38 34 45 19 21 10 21
787
+ 21 30 37 37 34 34 37 38 38 37 37 37 37 37 35 34 36 36 40 40 49 34 34
788
+ 34 34 37 37 38 37 33 30 30 30 30 30 40 40 34 34 34 27 27 31 31 33 35
789
+ 33 30 30 21 21 12 30 28 36 40 36 36 36 33 33 26 26 21 19 20 29 30 36
790
+ 34 34 33 31 28 28 32 35 32 35 26 30 25 26 26 25 21 19 12 11 19 21 23
791
+ 21 11 13 17 17 24 29 27 29 29 28 31 20 25 18 16 12 14 23 21 11 11 16
792
+ 14 10 21 23 33 33 34 31 31 22 22 14 21 11 16 18 31 40 40 36 36 24 27
793
+ 19 19 13 16 10 8
794
+
795
+ Sequence : 22ak92c4.s1t
796
+ Is_read
797
+ Padded
798
+ Staden_id 16
799
+ Clipping QUAL 37 490
800
+ Align_to_SCF 1 494 1 494
801
+ SCF_File 22ak92c4.s1tSCF
802
+ Primer Universal_primer
803
+ Strand Forward
804
+ Dye Dye_terminator
805
+ Template 22ak92c4
806
+ Clone bK216E10
807
+ Sequencing_vector "m13mp18"
808
+ Seq_vec SVEC 1 36 "M13mp1"
809
+
810
+ DNA : 22ap08f1.s1t
811
+ GAACTATCATnnnATATACGGGTTGAGTGTnTCTAATCTGAAAATCCAAAATTAGAAATG
812
+ CTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATGTTCAAAGGAAGTGCTTATTGGA
813
+ GCATTATGGGTTGTTAgATTTTTGGGTtGGGAATATTCAACCATTAAGCTACACACAATG
814
+ CAAATATCCCACAAACAATCTGAAATCTGAAACACTTCTGGTCCAAGCAAGCATCCGCAA
815
+ CGGATACGCAACCTGCACACGTTCTTATCATCGTTAACTCTnATATATGTGGACAAATCT
816
+ GACGTGGTACACACACTCATGTATATCACAACATATTACATTTGAAGCTGCTACGAATAT
817
+ GGAAGAATnnnnCCTGAACTTGGTGTATGACGAACTTAGATAGACAGTGACTCTTCAGTT
818
+ CAGCTCnTCATTTnTnnTCCCTCGGTTTTnCTAAnCnCnnCnnAAAAnnnnATCCnGTGG
819
+ GCATAAAnnCnGGTCCCACCGCCCCCnCCCCACAAAACCACACACTACCGACCTCCCAA
820
+
821
+ BaseQuality : 22ap08f1.s1t
822
+ 7 9 10 13 14 16 21 15 14 4 4 4 4 4 11 11 20 26 28 28 30 30 30 25 25 20
823
+ 25 23 28 4 4 4 18 18 18 21 24 31 33 34 33 34 34 40 30 31 30 24 24 24
824
+ 31 27 30 31 30 23 32 32 37 36 38 34 33 24 18 15 10 8 8 18 25 32 33 34
825
+ 31 31 33 29 21 12 9 7 8 11 13 18 22 25 25 33 33 32 29 22 27 24 25 16 9
826
+ 9 19 21 20 14 16 10 12 12 11 11 18 23 21 19 19 10 10 10 20 9 9 13 18
827
+ 18 20 21 18 17 14 16 9 9 9 10 10 10 9 9 21 25 22 18 18 14 20 21 13 13
828
+ 21 17 26 25 23 20 15 10 12 16 17 15 10 11 8 8 8 8 6 4 4 4 8 10 8 8 6 6
829
+ 8 13 15 21 21 15 11 9 12 11 7 6 6 6 6 6 6 10 6 6 6 6 10 14 10 10 9 12
830
+ 9 11 10 14 9 13 10 10 12 9 9 15 17 20 16 17 21 25 10 8 10 10 7 7 10 9
831
+ 7 8 14 7 7 8 10 8 6 6 6 8 8 10 11 14 8 9 11 19 17 13 9 9 9 8 8 10 9 8
832
+ 8 8 9 8 11 11 10 8 8 8 8 6 6 8 10 8 7 6 4 8 4 4 4 7 7 11 10 12 9 12 10
833
+ 10 10 11 6 6 9 9 14 8 7 7 7 7 12 16 11 6 6 6 6 6 6 6 6 6 8 13 9 8 8 15
834
+ 12 10 9 8 8 8 8 7 9 12 8 6 6 8 4 6 6 7 11 13 13 7 8 9 7 7 12 12 10 9 4
835
+ 4 4 6 7 7 12 14 7 7 12 6 6 6 7 4 4 4 4 4 4 8 8 14 12 13 16 16 16 10 11
836
+ 16 14 12 7 6 6 4 4 4 8 7 7 7 12 7 7 8 11 4 4 4 4 4 6 6 6 6 6 6 6 6 6 4
837
+ 4 8 6 6 12 12 12 9 8 4 4 4 6 11 6 9 4 4 4 4 4 4 9 9 9 15 9 9 6 6 6 8 4
838
+ 4 4 9 9 4 4 4 4 4 4 4 4 4 4 4 9 9 4 4 4 4 4 4 11 12 4 4 4 8 8 15 9 6 8
839
+ 9 9 9 4 4 4 4 4 4 7 10 6 8 15 8 8 4 6 14 15 17 18 4 4 4 14 8 6 6 8 8 9
840
+ 13 9 9 9 7 7 7 7 8 8 6 6 8 6 6 6 8 6 6 8 8 8 8 4
841
+
842
+ Sequence : 22ap08f1.s1t
843
+ Is_read
844
+ Padded
845
+ Staden_id 17
846
+ Clipping QUAL 17 155
847
+ Align_to_SCF 1 539 1 539
848
+ SCF_File 22ap08f1.s1tSCF
849
+ Primer Universal_primer
850
+ Strand Forward
851
+ Dye Dye_terminator
852
+ Template 22ap08f1
853
+ Clone bK216E10
854
+ Sequencing_vector "m13mp18"
855
+ Tag DONE 137 137 "AUTO-EDIT: replaced T by g at 137 (terminated, isolated, strong)"
856
+ Tag DONE 148 148 "AUTO-EDIT: replaced A by t at 148 (terminated, isolated, strong)"
857
+
858
+ DNA : 22ai01c4.s1t
859
+ GGAACATGCTGCAGGTCGACTCTAGAGGATCCCCGCTCTACAGTCTGAAACTTTTTTGAG
860
+ CACCGACCTAATGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGG
861
+ GTTGGGAATATTCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAA
862
+ TCTGAAACATTTCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACG
863
+ TTCTTTATCATTGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGC
864
+ AAATTCGATTGTATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTG
865
+ GAGAGAATAAAACAGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGT
866
+ TTTTCAGTTCATGCTCTTTCATTTTTTACTCCCTCAGGTTAAAGCT-GAAGCTCAACAAA
867
+ GATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTCAAGCCTCCTCCA
868
+ ATAAAGCTCTATCGGGAAACAAATGAAACAGTGAAAACCAAGAACCGGAACTTTAATACA
869
+ AGTACAGGCGGTTTGCTTTCTGCTAGCGATACCAAAAGTCTCAGGTAGGTAAAAATGCTn
870
+ nTGTGTTA
871
+
872
+ BaseQuality : 22ai01c4.s1t
873
+ 4 4 6 8 8 18 18 25 25 30 25 21 27 16 16 27 24 27 31 37 33 33 31 31 21
874
+ 21 23 25 37 34 37 45 45 45 45 40 40 40 33 33 30 30 30 30 38 45 45 49
875
+ 45 45 45 45 45 45 45 45 38 38 30 30 30 33 33 30 37 37 40 42 42 45 38
876
+ 45 35 25 27 33 33 33 33 37 37 37 40 37 37 37 37 42 42 42 40 37 40 45
877
+ 33 33 33 33 33 33 45 45 41 41 45 37 30 41 32 41 45 37 37 41 41 45 45
878
+ 41 32 38 37 30 30 30 41 41 51 51 51 51 33 33 35 35 35 29 33 33 33 33
879
+ 33 45 37 37 37 37 37 40 40 40 40 45 43 35 33 33 33 33 33 43 45 43 32
880
+ 33 33 28 28 29 51 51 45 51 51 51 51 51 51 51 51 51 51 51 51 51 51 42
881
+ 42 42 40 39 39 51 51 45 45 45 38 38 37 37 38 33 33 33 33 33 33 37 40
882
+ 39 39 42 33 33 33 33 33 33 37 37 41 41 41 41 33 33 33 33 33 33 51 45
883
+ 41 41 39 34 34 29 31 37 34 34 45 37 38 42 33 32 32 32 32 32 37 51 32
884
+ 32 32 32 32 21 24 12 25 25 33 33 33 33 40 40 40 37 37 41 45 45 45 35
885
+ 34 34 34 34 34 41 41 45 45 45 41 37 37 41 40 45 37 37 42 33 33 22 33
886
+ 33 33 37 37 37 37 37 37 37 37 37 36 33 33 33 33 33 33 40 40 45 34 34
887
+ 34 34 34 34 37 37 40 33 33 33 33 33 36 36 40 34 37 37 37 37 38 38 36
888
+ 33 33 33 31 31 20 29 27 34 34 34 40 40 34 34 38 38 38 34 34 40 37 40
889
+ 37 30 30 30 30 30 34 36 40 40 36 36 28 33 32 27 27 18 14 14 18 23 27
890
+ 34 33 29 29 24 29 29 27 27 28 28 25 25 33 22 24 23 31 28 33 34 31 25
891
+ 25 25 25 30 31 36 32 27 18 13 13 25 25 17 23 25 31 45 45 45 38 31 31
892
+ 24 22 20 27 35 34 31 33 33 33 33 36 36 36 38 20 13 10 8 12 11 18 20 23
893
+ 34 34 30 1 29 22 19 24 22 24 28 31 31 31 27 27 23 28 10 25 20 17 10 25
894
+ 25 35 35 38 38 36 36 27 27 17 17 11 13 16 19 18 18 18 22 15 11 11 15
895
+ 27 25 24 24 18 8 9 8 7 7 8 7 8 8 15 17 21 14 10 10 19 17 20 25 24 24
896
+ 21 16 15 21 21 26 33 33 26 23 19 23 23 28 21 20 15 10 8 7 8 6 8 11 7
897
+ 10 18 17 12 9 9 7 11 9 7 6 7 6 8 9 9 9 6 10 8 10 7 8 8 7 6 6 8 7 8 8
898
+ 14 23 24 19 14 14 7 7 7 7 8 8 6 6 7 6 6 6 6 6 9 21 13 12 13 15 15 10
899
+ 11 17 16 15 8 7 7 9 9 10 10 8 8 8 8 9 8 6 8 8 8 7 7 7 7 7 7 7 7 7 7 7
900
+ 10 8 7 7 8 11 4 4 4 4 9 6 6 6 6 6
901
+
902
+
903
+ Sequence : 22ai01c4.s1t
904
+ Is_read
905
+ Padded
906
+ Staden_id 6
907
+ Clipping QUAL 35 553
908
+ Align_to_SCF 1 466 1 466
909
+ Align_to_SCF 468 668 467 667
910
+ SCF_File 22ai01c4.s1tSCF
911
+ Primer Universal_primer
912
+ Strand Forward
913
+ Dye Dye_terminator
914
+ Template 22ai01c4
915
+ Clone bK216E10
916
+ Sequencing_vector "m13mp18"
917
+ Seq_vec SVEC 1 34 "M13mp18"
918
+
919
+ DNA : 22ak93c1.s1t
920
+ nGGTGAAGCTTGCATGCCTGCAGGTCGACTCTAAAGGATCCCCACAcCAAAGCTTCACTG
921
+ TTTTATTCTCTCCAATAATCCTAAgCAAGCTCTCAAAATATAAATATGCTTTtTAATAAT
922
+ ACAATCGAATTTGCTATACCACCTCAGAATCTGTACCACAATATATTAACTACTTAAAAC
923
+ AATGATAAAGAACGTACTACAGGTTGCGTATCCCTTTGCAAAATGCTTGCTTAgGACCAG
924
+ AAATGTtTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTACTGGTTG
925
+ AATATTCCCAACCCAAAaATCTAACAACCCATAATGCTCCAATAAGCACTTCCTTTGAAC
926
+ ATTATGTCGGTGCTCAAAAAAGTTTCAGACTGTAAAGCATTTCCTAATTTTGGATTTCCA
927
+ GAATAGAAACACTCAACCCGTATAATAAAATGATAATCTGTATTAAGCACAGCACTATAT
928
+ CAAGCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTACTGTACA
929
+ AGTGGTCTGGTCCCTGCTTTTATTTCTCCAAGAACGACTCTCACACTATTGGTTCGCCTG
930
+ GAGTGCnTCGCGTGATCCCCGCTCATGGCACCTCCACTCCCGGGTCCAAGCAATTCTCTT
931
+ GCTCAACTTCCAAGTGGTGGGATTAGGGCCCTGCCATAACCCACTTATTTCTTTTATTTT
932
+ AATAAAACGTTTCCCCATTTTGGCAGTGGGTTTTACCCTGACCCGTATTGCCCTTCCGGC
933
+ CCACGATTTGGGGGAACCAGTTGGGCCCCCCTTTGGGCCTCTCCTGTTCCGAGC
934
+
935
+ BaseQuality : 22ak93c1.s1t
936
+ 4 4 4 4 8 8 12 20 25 31 33 33 30 30 30 31 31 35 35 34 27 23 12 11 25
937
+ 11 14 14 28 32 20 14 6 6 6 6 8 16 16 25 28 15 15 13 17 9 10 9 16 16 18
938
+ 18 18 25 27 30 26 20 21 19 10 10 14 23 25 30 30 37 37 37 34 31 28 30
939
+ 22 18 29 18 22 18 15 11 21 12 15 15 22 24 28 37 37 37 37 32 27 10 10
940
+ 13 18 20 25 25 23 23 24 32 33 40 40 38 32 18 18 18 27 27 28 37 37 21
941
+ 21 15 15 12 22 32 23 23 30 30 45 45 37 37 32 32 23 22 22 22 27 28 31
942
+ 26 23 12 12 18 32 38 37 37 37 37 34 34 30 30 30 30 30 30 34 34 37 37
943
+ 37 34 34 31 31 31 28 27 24 22 22 22 30 30 33 30 30 32 26 24 15 15 9 7
944
+ 7 14 10 10 9 14 11 12 10 11 6 7 9 8 17 24 26 28 26 28 28 35 34 34 30
945
+ 26 26 26 28 28 31 31 33 33 31 23 20 15 13 15 18 14 6 6 8 13 13 19 9 7
946
+ 7 16 10 10 15 10 8 8 12 10 9 9 18 13 14 17 11 7 7 13 21 23 28 21 20 19
947
+ 19 22 25 27 31 32 32 28 28 25 25 25 25 25 25 31 30 19 19 13 13 13 27
948
+ 28 33 33 33 33 33 36 33 31 24 21 14 15 18 24 27 31 25 28 30 30 28 23
949
+ 23 21 17 14 8 9 9 25 25 33 25 25 28 30 30 30 22 21 20 20 22 25 28 34
950
+ 28 21 16 15 10 14 17 25 25 12 12 12 12 12 20 10 14 16 21 17 13 11 9 12
951
+ 11 7 6 6 6 8 14 8 8 6 6 11 23 21 28 28 31 31 34 23 10 7 7 7 7 7 9 8 8
952
+ 14 16 20 20 16 10 7 7 7 14 7 9 14 10 9 14 9 19 22 27 25 13 13 18 14 17
953
+ 23 16 9 8 9 7 7 7 7 9 8 8 13 16 21 19 15 15 10 10 15 11 18 25 23 21 21
954
+ 21 32 25 28 25 28 17 20 10 7 7 11 6 7 6 6 7 9 8 6 6 6 6 6 8 7 7 9 13
955
+ 11 13 13 20 21 18 15 10 10 9 9 8 8 8 9 9 13 16 16 14 14 14 25 10 11 6
956
+ 6 6 6 7 10 14 9 13 20 8 7 7 8 11 10 13 12 12 13 16 14 15 15 13 13 10
957
+ 12 7 8 9 14 11 12 12 9 10 8 8 8 10 20 12 9 9 12 6 6 6 6 8 9 6 6 6 6 7
958
+ 6 6 8 16 18 18 9 6 6 6 13 7 7 7 8 9 9 7 7 7 7 7 6 6 6 6 6 6 6 6 7 8 8
959
+ 10 9 8 8 6 7 8 4 4 4 4 4 10 7 7 9 9 8 8 4 4 4 4 4 4 8 4 9 9 12 9 8 6 6
960
+ 6 9 11 7 7 7 7 7 9 11 11 9 6 6 6 10 8 8 7 10 10 14 25 16 10 7 7 7 7 10
961
+ 10 8 8 7 7 7 8 6 6 6 6 8 11 12 7 6 13 6 7 7 7 8 7 7 7 8 8 10 8 6 6 6 4
962
+ 4 8 8 10 13 22 24 24 20 14 8 6 6 6 6 6 10 15 15 10 9 6 6 10 8 7 7 9 9
963
+ 13 13 10 11 11 11 8 7 7 6 14 6 7 8 6 6 7 7 7 7 7 7 12 7 8 10 10 13 14
964
+ 9 8 8 8 11 9 7 7 7 8 8 11 10 12 11 11 10 10 12 12 17 13 9 8 9 6 6 6 6
965
+ 6 12 8 8 8 8 9 8 8 9 8 7 7 7 9 9 8 8 6 6 8 8 11 12 8 6 8 6 6 6 6 6 7 8
966
+ 9 11 12 12 6 6 8 7 8 8 13 7 7 7 6 8 8 8 8 8 8 6 6 8 4 6 4 4 4 4
967
+
968
+ Sequence : 22ak93c1.s1t
969
+ Is_read
970
+ Padded
971
+ Staden_id 10
972
+ Clipping QUAL 44 345
973
+ Align_to_SCF 1 834 1 834
974
+ SCF_File 22ak93c1.s1tSCF
975
+ Primer Universal_primer
976
+ Strand Forward
977
+ Dye Dye_terminator
978
+ Template 22ak93c1
979
+ Clone bK216E10
980
+ Sequencing_vector "m13mp18"
981
+ Seq_vec SVEC 1 43 "M13mp1"
982
+ Tag DONE 47 47 "AUTO-EDIT: replaced T by c at 47 (terminator, isolated, strong)"
983
+ Tag DONE 85 85 "AUTO-EDIT: replaced C by g at 85 (terminated, isolated, strong)"
984
+ Tag DONE 113 113 "AUTO-EDIT: replaced A by t at 113 (terminated, isolated, strong)"
985
+ Tag DONE 234 234 "AUTO-EDIT: replaced C by g at 234 (terminated, isolated, strong)"
986
+ Tag DONE 247 247 "AUTO-EDIT: replaced C by t at 247 (terminated, isolated, strong)"
987
+ Tag DONE 318 318 "AUTO-EDIT: replaced G by a at 318 (terminated, isolated, strong)"
988
+
989
+ DNA : 22ak65e10.s1t
990
+ TGAGGGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTTAAAAAATAAATAAATAA
991
+ ATAAATTAGCTGGGTGTGATGTCACATGCCTGTGATCCCAGCTACTTGGGAGGCTGAGAC
992
+ AGAAGGATCGCTTGAGTCCAGGAGGTCAAGGCTGTAGCGAGTCATGTTCGCCCCACTGCA
993
+ CTCCAGCCTGGGCGACACAATGAGACCCTGTCTCAAAAACAACAACAACAAAAGGCATCT
994
+ CTACCTACCTGAGACCTCTTGGTATCGCTAGGCAGAAGCAAACCGCCTGTACTTGTATTA
995
+ AAGGTCCGGGTCTTGGTTTTCACTGGTTCATTTGTTTCCCGATAGAGCTTTATTGGAGGA
996
+ gGCTTGAGAGCCTTCTGGACCAGATTATaAATGCCCACAGAGATCACTATATCTTTGTTG
997
+ AGCTTC-AGCTTTAACCTGAGGGAGTAAAAAATGAAAGAGCATGAACTGAAAAACTGCAC
998
+ TTTTCTATCTAAAATTCCCTCATAACACCAAAGCTTCACTGTTTTATTCTCTCCAATAAT
999
+ CCTAAGCAAGCTCTCAAAATATAAATATGCTTTTTAATAATACAATCC
1000
+
1001
+ BaseQuality : 22ak65e10.s1t
1002
+ 4 4 8 8 9 9 14 15 31 31 28 28 28 30 30 33 33 33 30 22 20 12 22 12 18
1003
+ 18 30 31 27 23 32 10 10 14 12 32 32 37 45 45 45 45 45 38 34 29 29 29
1004
+ 29 29 29 29 32 32 30 34 34 34 34 35 34 34 32 35 29 27 32 32 32 37 45
1005
+ 32 45 37 37 37 24 24 32 32 19 22 11 21 21 31 31 34 45 45 45 28 30 30
1006
+ 37 40 34 33 33 28 28 28 37 45 41 41 41 41 45 41 27 27 33 37 37 32 27
1007
+ 20 20 20 30 20 20 21 24 17 38 32 30 42 37 37 37 30 28 13 12 18 25 21
1008
+ 24 14 25 25 22 28 17 28 28 18 32 36 36 32 32 21 32 32 31 31 27 27 21
1009
+ 32 32 27 13 13 32 33 38 45 36 34 30 30 21 21 23 23 23 23 30 33 33 37
1010
+ 34 41 36 41 37 37 34 29 29 19 30 30 40 37 37 36 37 25 25 26 26 30 45
1011
+ 41 51 37 33 30 28 28 33 20 18 20 20 20 20 26 20 20 18 21 21 31 31 28
1012
+ 32 14 18 20 29 33 34 45 45 40 40 40 37 37 37 37 37 32 45 30 23 23 32
1013
+ 32 37 34 35 34 34 34 34 37 37 37 37 45 37 37 32 27 23 14 12 12 14 17
1014
+ 19 27 27 28 30 37 45 45 45 45 37 37 37 42 42 40 37 37 34 33 33 40 31
1015
+ 26 28 25 27 31 34 34 34 31 27 27 27 31 27 31 23 23 18 18 18 25 25 31
1016
+ 35 31 30 27 25 27 35 33 32 30 21 21 21 23 23 27 26 21 20 16 16 17 18
1017
+ 30 30 36 36 36 34 34 36 34 26 15 12 6 6 6 12 11 23 23 26 17 17 21 32
1018
+ 35 35 40 33 33 33 38 33 27 23 23 12 12 18 18 19 10 8 8 17 19 34 33 34
1019
+ 31 34 31 31 22 22 19 18 27 27 32 22 25 24 32 32 34 34 34 37 34 30 33
1020
+ 27 27 27 31 32 27 27 18 1 12 12 11 15 15 17 27 28 28 34 34 30 25 18 13
1021
+ 19 15 15 25 21 29 26 34 24 28 25 27 21 20 23 24 24 26 29 30 26 27 22
1022
+ 29 27 33 34 34 36 38 38 38 34 31 30 24 24 24 31 33 35 35 29 33 33 31
1023
+ 31 28 28 29 26 22 14 8 9 9 9 14 9 13 18 21 21 27 23 18 15 21 21 25 33
1024
+ 33 31 31 21 21 24 27 29 25 19 19 19 25 27 27 34 34 34 14 9 7 7 9 18 23
1025
+ 27 23 19 19 23 24 21 18 8 8 9 21 20 31 24 20 13 11 16 24 32 32 25 18
1026
+ 13 13 20 20 26 21 27 21 20 13 17 15 21 12 12 18 15 15 15 15 8 8 7 10 8
1027
+ 4
1028
+
1029
+
1030
+ Sequence : 22ak65e10.s1t
1031
+ Is_read
1032
+ Padded
1033
+ Staden_id 4
1034
+ Clipping QUAL 42 575
1035
+ Align_to_SCF 1 426 1 426
1036
+ Align_to_SCF 428 588 427 587
1037
+ SCF_File 22ak65e10.s1tSCF
1038
+ Primer Universal_primer
1039
+ Strand Forward
1040
+ Dye Dye_terminator
1041
+ Template 22ak65e10
1042
+ Clone bK216E10
1043
+ Sequencing_vector "m13mp18"
1044
+ Seq_vec SVEC 1 41 "M13mp"
1045
+ Tag DONE 361 361 "AUTO-EDIT: replaced C by g at 361 (all_stranded, compound, strong)"
1046
+ Tag DONE 389 389 "AUTO-EDIT: replaced C by a at 389 (terminated, isolated, strong)"
1047
+
1048
+ DNA : 22ak93c2.s1t
1049
+ CTGGGAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACTCATTTTCTGCCTGG
1050
+ TGTTTATTCTCATCCAAATTCGTATACATGCTCGGTGTGAATGGTTACTCATTATAGTAT
1051
+ ACAATCGACTTTCTCAAACGACCACACATGCTGAATATCTATACATGTGCTAGTTGGACC
1052
+ TCTGATTATCAACGTGAGACTGGTGGCGTATCCCTTTGCAAAATGCTAACAAAAGACCAC
1053
+ AAACGTGTCACATTTCAGAATTGCTTGGAATATTCGCGTGTATAGTACTTACTGGTTCAA
1054
+ GGGTCCAAAACATACCTCTACACACCATCCTGATTCCCTGGGACACTTCCTTTGAACATC
1055
+ ACGTCGGTGCTCAAAAAAGTGTCAGACTGTAGAGCATATCTGGTTTCGGAATGTCGAGAT
1056
+ AGAAGGTCTCAAGCCGTATAAATAAACGAGAGTCTGTATCAAGCACTGCAGGAGAATCAT
1057
+ AACCTCACAGCTATGCTCTCATGGAAACATCTCAATACACCTCGTAGTACTGTACTAATA
1058
+ GTCATGTCGCTGCTTTTTGTTnCCGACAACCAATCTCACGGATTGGTTCGGCCGGTTTGC
1059
+ ATCCCTGATTCCGATCATTGAAGGTCGAACTCCCGGTCCAAGCAATCTCCTGCCCCGGCT
1060
+ CCAGATGACGGGATTCTTGCCTTTCAACACCCCGGCTAATTCATCCTCTCCCTCGACACC
1061
+ GATTTCACGAAATGGGGGTCGGCCCCAACCCGAACATTTGTTTACTGGGTAAAACGGTTC
1062
+ CCCAGTTACCCGTTGGCCCACTCCTGGGCCATTAATTGCCTC
1063
+
1064
+ BaseQuality : 22ak93c2.s1t
1065
+ 4 4 8 8 9 12 12 22 27 30 30 30 30 33 33 35 33 37 37 33 31 30 25 25 27
1066
+ 27 18 18 32 38 32 28 28 9 9 10 10 25 21 27 38 28 25 23 16 12 10 10 11
1067
+ 10 13 12 11 15 14 8 8 11 13 18 21 21 9 7 7 6 11 8 8 8 6 6 8 8 8 8 10 9
1068
+ 9 10 9 14 9 13 11 8 8 8 8 8 11 10 11 14 14 14 21 11 10 10 10 11 17 11
1069
+ 7 7 8 8 9 9 13 14 18 15 9 9 9 8 8 10 12 12 10 10 8 9 12 12 13 14 23 10
1070
+ 10 10 12 11 11 10 10 10 11 14 14 15 15 21 22 10 10 10 10 28 10 9 9 9
1071
+ 10 12 15 18 15 15 12 12 12 12 25 21 24 27 18 13 13 13 14 12 14 12 10
1072
+ 10 10 14 18 14 9 9 11 12 12 10 10 10 10 9 14 14 8 8 8 8 6 6 9 6 6 6 12
1073
+ 18 34 36 38 38 38 38 36 36 33 33 23 23 13 13 15 23 28 20 9 6 6 4 6 10
1074
+ 8 7 7 9 10 9 13 13 10 10 9 8 8 6 6 8 8 11 12 10 9 9 9 6 4 6 6 8 6 7 11
1075
+ 10 9 7 8 17 18 21 19 17 11 8 8 9 11 11 15 12 8 8 8 9 9 15 15 10 10 9
1076
+ 10 7 7 8 12 10 10 9 9 9 9 10 11 10 8 8 8 7 12 7 7 7 8 9 8 9 10 10 9 10
1077
+ 8 6 6 6 6 7 6 9 10 10 10 7 6 6 6 8 6 6 9 10 13 12 12 9 12 15 14 14 8 8
1078
+ 8 9 10 10 9 9 9 9 8 6 6 10 8 13 6 6 6 11 16 18 12 11 8 10 12 8 7 9 7 7
1079
+ 7 7 9 9 7 7 10 10 12 10 20 9 7 7 7 8 8 8 9 7 7 7 11 9 13 19 15 12 7 8
1080
+ 7 6 6 6 6 6 6 6 10 13 8 6 6 8 6 8 10 10 12 7 7 7 7 7 7 8 10 9 9 8 7 6
1081
+ 6 8 6 6 8 9 9 10 7 7 8 8 8 8 7 7 8 7 7 7 7 7 9 8 8 15 8 8 6 6 6 6 6 6
1082
+ 7 10 9 9 8 7 8 8 10 7 7 8 8 11 11 11 8 6 6 6 6 6 12 6 6 6 6 6 7 11 12
1083
+ 9 7 10 11 8 8 7 8 11 8 7 7 7 6 8 6 6 8 6 8 7 7 8 7 7 7 8 9 7 7 7 7 7 7
1084
+ 9 7 7 7 6 13 4 7 7 7 12 23 21 14 12 9 8 9 8 4 4 4 6 6 6 7 6 8 4 4 4 6
1085
+ 6 6 6 6 6 8 6 7 10 9 9 9 8 6 4 4 4 6 8 6 6 6 6 8 6 6 8 8 8 8 8 8 6 6 8
1086
+ 11 10 7 7 7 7 9 9 9 8 7 11 8 7 7 8 9 8 8 7 7 7 7 7 7 7 7 8 7 7 7 7 8 7
1087
+ 7 8 7 7 7 7 8 7 7 7 7 7 7 6 6 7 7 6 6 6 8 9 8 7 7 7 7 8 8 12 9 7 7 7 7
1088
+ 6 7 8 7 7 7 8 8 6 6 6 6 6 6 7 7 9 12 10 14 8 9 8 6 6 6 6 6 6 9 10 10 9
1089
+ 6 6 6 6 8 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 6 6 6 4 6 6 6 6 8 6
1090
+ 6 6 6 6 8 8 10 7 4 7 4 4 4 6 6 6 6 6 6 6 6 6 6 6 7 7 9 9 8 8 7 9 9 7 7
1091
+ 7 8 6 6 6 6 6 6 6 6 6 6 8 8 8 8 8 8 8 7 7 6 6 6 6 7 8 9 9 9 9 7 7 7 7
1092
+ 7 7 7 6 6 6 6
1093
+
1094
+ Sequence : 22ak93c2.s1t
1095
+ Is_read
1096
+ Padded
1097
+ Staden_id 13
1098
+ Clipping QUAL 44 45
1099
+ Align_to_SCF 1 822 1 822
1100
+ SCF_File 22ak93c2.s1tSCF
1101
+ Primer Universal_primer
1102
+ Strand Forward
1103
+ Dye Dye_terminator
1104
+ Template 22ak93c2
1105
+ Clone bK216E10
1106
+ Sequencing_vector "m13mp18"
1107
+ Seq_vec SVEC 1 43 "M13mp1"
1108
+
1109
+ DNA : 22am84d9.s1
1110
+ CAACCCGCACACCTGCACGTCGACTCTAGAGGATCCCCATAAATAAATAAATtAgCTGGG
1111
+ TGTGATGTCACATGCCTGTgATCCCAGCTACTTGGGAgGCTGAGACAGAAGGATCGCTTG
1112
+ AGTCCAGGAGGTCAAGGCTGTAGCGAGTCATGTTCGCCCCACTGCACTCCAGCCTGGGCG
1113
+ ACACAATGAGACCCTGTCTCAAAAACAACAACAACAAAAGGCATCTCTACCTACCTGAGA
1114
+ CCTCTTGGTATCGCTAGGCAGAAGCAAACCGCCTGTACTTGTATTAAAGGTCCGGGTCTT
1115
+ GGTTTTCACTGGTTCATTTGTTTCCCGATAGAGCTTTATTGGAGGAGGCTTGAGAGCCTT
1116
+ CTGGACCAGATTATAAATGCCCACAGAGATCACTATATCTTTGTTGAGCTTCAAGCTTTA
1117
+ ACCTGAGGGCAGTAAAAAATGGAAGAGCATGAACTGGCAAAATGCACTTTTCTATCTAAA
1118
+ ATTCC
1119
+
1120
+ BaseQuality : 22am84d9.s1
1121
+ 4 9 9 9 9 10 10 9 9 9 9 10 10 10 8 8 6 6 10 8 11 12 15 14 13 15 11 11
1122
+ 11 12 14 10 10 10 17 23 31 31 21 20 13 21 11 10 10 16 14 14 14 23 11
1123
+ 11 10 10 10 11 11 12 32 18 23 23 32 32 34 37 34 37 37 38 27 18 18 17
1124
+ 24 30 32 32 10 10 11 23 23 38 37 37 37 37 37 37 37 37 37 37 32 32 22
1125
+ 22 22 32 28 40 37 37 37 45 32 32 28 22 22 12 16 16 32 32 37 37 37 37
1126
+ 28 28 28 32 32 30 30 27 29 29 34 37 37 37 37 37 37 37 37 37 28 22 20
1127
+ 30 30 29 37 34 37 37 37 37 37 37 37 37 37 37 37 45 45 37 37 37 37 45
1128
+ 37 37 34 34 34 33 31 33 34 37 27 27 13 13 13 21 32 34 36 31 31 33 19
1129
+ 17 14 9 9 13 24 27 27 33 33 33 33 33 33 33 33 33 36 36 37 37 37 37 37
1130
+ 45 45 36 34 34 28 31 31 34 34 37 38 34 38 38 33 30 30 30 30 30 33 34
1131
+ 37 37 37 34 34 34 34 34 35 35 33 33 33 33 33 33 34 30 30 30 30 30 30
1132
+ 33 33 30 30 30 34 34 34 34 31 31 31 36 36 34 31 17 13 8 8 15 18 27 31
1133
+ 28 28 28 28 28 30 31 35 35 34 34 34 34 33 33 33 34 34 38 38 38 37 32
1134
+ 28 22 19 19 25 27 37 30 30 30 28 28 28 38 37 34 34 37 31 31 25 24 28
1135
+ 30 30 28 28 28 28 28 28 34 34 34 33 33 31 31 27 24 18 15 18 18 23 23
1136
+ 28 27 22 18 11 11 16 21 24 33 34 23 23 8 8 9 12 14 17 20 20 20 25 25
1137
+ 27 27 23 16 11 15 14 9 9 19 17 18 22 18 11 11 11 12 17 18 31 31 31 31
1138
+ 27 27 33 29 22 18 17 17 20 20 17 13 11 11 11 6 8 14 17 22 22 25 25 20
1139
+ 20 20 17 14 4 4 4 14 15 21 22 18 11 12 7 7 7 7 7 12 21 18 15 13 9 9 15
1140
+ 12 8 6 6 6 6 9 6 6 6 12 14 13 13 17 21 21 24 21 22 18 14 18 16 14 14
1141
+ 10 6 7 6 13 8 8 7
1142
+
1143
+
1144
+ Sequence : 22am84d9.s1
1145
+ Is_read
1146
+ Padded
1147
+ Staden_id 7
1148
+ Clipping QUAL 39 427
1149
+ Align_to_SCF 1 485 1 485
1150
+ SCF_File 22am84d9.s1SCF
1151
+ Primer Universal_primer
1152
+ Strand Forward
1153
+ Dye Dye_primer
1154
+ Template 22am84d9
1155
+ Clone bK216E10
1156
+ Sequencing_vector "m13mp18"
1157
+ Seq_vec SVEC 1 38 "M13mp18"
1158
+ Tag ALUS 41 210
1159
+ Tag DONE 53 53 "AUTO-EDIT: replaced C by t at 53 (all_stranded, isolated, strong)"
1160
+ Tag DONE 55 55 "AUTO-EDIT: replaced C by g at 55 (all_stranded, isolated, strong)"
1161
+ Tag DONE 80 80 "AUTO-EDIT: replaced C by g at 80 (all_stranded, isolated, strong)"
1162
+ Tag DONE 98 98 "AUTO-EDIT: replaced C by g at 98 (all_stranded, isolated, strong)"
1163
+ Tag AMBG 338 360 "AUTOEDIT: Check this edit cluster!"
1164
+ Tag CONF 413 413 "AUTOEDIT: possible compression"
1165
+
1166
+ DNA : 22ak66f10.s1lt
1167
+ CCCGCGGGGGAGGAGGGAnGGGGGGAGAGGAGnAnAAnnnnnnnnnnnnnAGCCCCAAnn
1168
+ nAnnCCCTCTTnnnnnnnnAGACGGGGGGnGCCCTGGGnGnGCnTnnnnnnnnnnTTGGT
1169
+ TGAGGTGnCGAGCAAATCTTGCATGCCTGtcCGTCTACTCtAGAGGATCCCACAAATGAA
1170
+ CCAGTGAAAACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGC
1171
+ GATACCAAGAGGTCTCAGGTAGGTAGAGATGCCTTTTGTTGTTGTTGTTTTTGAGACAGG
1172
+ GTCTCATTGTGTCGCCCAGGCTGGAGTGCAGTGGGGCGAACATGACTCGCTACAGCCTTG
1173
+ ACCTCCTGGACTCAAGCGATCCTTCTGTCTCAGCCTCCCAAGTAGCTGGGATCACAGGCA
1174
+ TGTGACATCACACCCAGCTAATTTATTTATTTATTTATTTTTTAAGAGACTGGATCGACT
1175
+ GGGCACAGTGGCTCATGCCTGTAATCCCAnCACTTTGGGAGGCCGAGGCAGGTGGATTAC
1176
+ CGAGGTCAGGAGTTCAAGACCAGCCTGACCAACATGGAGAAACCCCATCTCTACTAAAAA
1177
+ TACAAAATGAGCTGGGCATGGTGGTGCATGCCTGTAATCCCAGCTACTCCGGAGGCTGAG
1178
+ GCAnGAGAATCCCTTGAACCCGGGAGGCAAAAGTTGCGGTGAGCCGAAATCTCGCCATTG
1179
+ CGCTCCAGCCTGGGCAACAAAAGCGTAACTCCGTCTCCnnnnnnnnAAAAAAAGAGACGG
1180
+ TGTTTCGCTATGTTGCCTGGGCTGGGTGTCAAACTCCTGGGTCTTAAAGTAATCCCCCCC
1181
+ TGCTTTGGGTTCCCCCAAATTGCTGGGGGTGGCTGGGATTCCCGAACTTTGGGGCCACTG
1182
+ TTGCCCCAGCCGTTTTTTTGGTTTCGTTTTGGTTTTGGTTTTGTTTTAATAAAAAAATAA
1183
+ AGGGTCTCACCTATGTT
1184
+
1185
+ BaseQuality : 22ak66f10.s1lt
1186
+ 6 6 4 6 8 8 11 8 8 6 6 11 4 4 4 12 6 4 4 4 8 7 6 6 6 6 6 6 6 8 4 4 4 4
1187
+ 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 7 7 6 6 6 8 4 4 4 4 4 4 4 4 6 4 6 6
1188
+ 8 4 4 4 4 4 4 4 4 4 4 4 4 6 6 6 6 6 6 4 4 4 6 6 4 4 8 12 4 4 4 4 4 4 4
1189
+ 4 4 4 4 4 4 4 4 4 4 4 4 6 6 4 4 4 4 4 4 8 6 4 4 4 4 4 4 15 17 8 4 4 6
1190
+ 9 21 21 30 28 30 33 33 21 18 8 8 8 10 15 23 21 26 26 19 14 7 7 8 8 10
1191
+ 18 21 18 10 9 9 18 14 24 24 29 32 34 37 34 36 32 32 30 30 30 34 38 44
1192
+ 45 37 37 34 27 27 15 15 23 32 40 40 37 37 34 45 45 45 45 45 42 25 25
1193
+ 25 26 26 20 23 28 30 33 33 33 34 34 34 34 37 45 45 45 45 49 49 49 49
1194
+ 49 45 45 43 38 38 37 37 40 37 37 34 27 27 12 10 18 14 32 27 27 27 29
1195
+ 29 12 18 10 15 10 21 10 14 10 19 19 41 45 45 45 45 45 40 40 34 37 37
1196
+ 45 45 45 45 45 45 45 45 45 40 51 37 37 25 22 18 27 22 25 25 29 29 28
1197
+ 33 33 40 37 37 37 37 37 37 34 37 37 42 35 32 30 30 37 38 45 45 30 30
1198
+ 30 33 31 33 32 37 45 45 45 32 30 30 37 33 37 37 40 37 37 37 37 37 37
1199
+ 37 37 37 37 34 34 34 37 45 45 45 45 45 45 45 45 49 45 45 45 45 33 33
1200
+ 29 29 33 33 33 33 33 37 40 45 45 45 45 45 45 45 35 35 35 35 35 40 38
1201
+ 45 45 45 37 37 32 22 14 14 14 32 45 45 45 38 37 31 28 27 30 28 27 22
1202
+ 27 27 31 31 34 31 28 28 27 31 33 33 33 33 33 33 32 28 28 30 34 37 37
1203
+ 35 35 35 37 37 33 33 33 33 33 33 31 31 30 30 33 31 31 36 33 33 33 34
1204
+ 25 25 10 10 10 19 19 34 34 34 34 31 31 34 34 36 38 30 30 26 23 30 31
1205
+ 34 32 45 37 37 37 37 33 33 40 40 40 36 33 31 31 31 33 33 23 22 4 4 4
1206
+ 18 23 32 34 36 36 32 28 21 21 21 29 20 28 25 24 18 25 21 27 27 32 32
1207
+ 34 31 31 34 37 37 37 37 32 32 10 21 10 25 28 32 29 34 28 31 27 27 28
1208
+ 22 22 27 29 32 32 37 37 37 37 37 37 37 37 35 34 34 34 31 27 27 19 19
1209
+ 30 34 37 38 34 34 34 34 34 40 38 38 38 38 37 37 37 35 35 32 28 28 28
1210
+ 30 30 30 33 30 30 22 22 22 32 32 35 35 34 34 35 35 34 37 37 38 30 24
1211
+ 24 24 24 24 31 38 38 32 27 27 27 35 25 18 12 9 9 11 21 23 18 12 6 6 8
1212
+ 8 8 9 10 17 10 14 8 9 8 7 4 4 4 16 14 14 12 15 8 8 11 15 14 25 25 25
1213
+ 28 33 33 33 21 29 7 7 7 8 8 7 8 9 9 8 11 24 22 31 25 23 23 15 13 10 7
1214
+ 9 9 8 8 12 7 7 7 16 11 18 14 25 25 22 19 16 17 14 8 9 10 13 15 27 28
1215
+ 31 23 22 14 14 13 15 15 23 21 8 8 6 6 6 6 9 18 20 28 22 22 20 17 14 9
1216
+ 4 4 4 4 4 4 4 4 4 4 16 10 13 20 23 23 12 9 9 9 17 10 9 7 8 6 6 8 4 4 7
1217
+ 12 13 14 7 8 8 8 8 8 18 21 16 9 10 9 7 9 7 9 8 10 7 7 7 12 9 9 7 7 8 8
1218
+ 6 6 8 8 8 6 8 6 6 6 6 7 6 11 6 8 6 6 6 6 6 8 9 9 8 9 12 8 8 8 7 8 8 7
1219
+ 8 6 6 6 9 8 6 6 6 10 13 11 7 9 7 7 7 7 7 8 9 7 7 9 9 7 4 4 4 7 11 7 7
1220
+ 9 8 7 6 6 6 6 6 8 8 10 9 8 8 6 6 6 6 7 6 6 4 4 4 4 8 6 8 13 16 20 8 8
1221
+ 7 7 7 7 7 7 7 8 12 8 8 6 6 6 6 6 6 6 6 6 6 9 8 8 6 6 6 8 6 9 14 9 9 8
1222
+ 9 7 6 6 8 6 6 8 7 6 6 8 6 6 7 7 7 7 7 7 8 8 4 4
1223
+
1224
+
1225
+ Sequence : 22ak66f10.s1lt
1226
+ Is_read
1227
+ Padded
1228
+ Staden_id 9
1229
+ Clipping QUAL 140 640
1230
+ Align_to_SCF 1 977 1 977
1231
+ SCF_File 22ak66f10.s1ltSCF
1232
+ Primer Universal_primer
1233
+ Strand Forward
1234
+ Dye Dye_primer
1235
+ Template 22ak66f10
1236
+ Clone bK216E10
1237
+ Sequencing_vector "m13mp18"
1238
+ Seq_vec SVEC 1 3 "M13mp18"
1239
+ Tag DONE 150 150 "AUTO-EDIT: replaced C by t at 150 (all_stranded, compound, strong)"
1240
+ Tag DONE 151 151 "AUTO-EDIT: replaced G by c at 151 (all_stranded, compound, strong)"
1241
+ Tag DONE 161 161 "AUTO-EDIT: replaced A by t at 161 (all_stranded, compound, strong)"
1242
+ Tag ALUS 283 462
1243
+ Tag ALUS 477 767
1244
+
1245
+ DNA : 22ak70h4.r1t
1246
+ TGCCGCCTTAGATTACAGCTCTACACGGTACCTCTATCGGGAAACAAATGAACCAgTGAA
1247
+ AACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAA
1248
+ GAGGTCTCAGGTAGGTAGAGATGCCTTTTGTTGTTGTTGTTTTTGAGACAGGGTCTCATT
1249
+ GTGTCGCCCAgGCTGGAGTGCAGTGGGGCGAACATGACTCGCTACAGCCTTGACCTCCTG
1250
+ GACTCAAGCGATCCTTCTGTCTCAGCCTCCCAAGTAGCTGGGATCACAGGCATGTGACAT
1251
+ CACACCCAGCTAATTTATTTATTTATTTATTTTTTAAGAGACTGGATCGACTGGGCACAG
1252
+ TGGCTCATGCCTGTAATCCCACCACTTTGGGAGGCCGAGGCATGTGGATTACCGAGGTTC
1253
+ GGAGTTCAAGACCAGCCTGACCCTTCTGGAGAAACCCCATCTCCACTTTAAATACCAAAT
1254
+ GAAGCTGGGCCTGGTGGTGCCTGCCTGTAATCCCCCCTTCTCAGGATGCTGAAGCAGGAC
1255
+ ATTCCTTGAACCCCGGAAGCACATGTTGCCGTGACCCAATATCCCCCCTTGTCCCTCACC
1256
+ CCGGGCCACCAAACCTTATTCCCTCCCAAATAAAAAAAAAAAAAAACGGGTTCCCTTTTT
1257
+ TGCCGGGGGGGGTTTCTACCCC
1258
+
1259
+ BaseQuality : 22ak70h4.r1t
1260
+ 4 4 4 4 4 8 6 6 8 8 12 6 7 11 13 12 6 6 6 6 6 6 9 10 10 10 21 21 26 31
1261
+ 27 27 13 14 11 11 11 12 19 20 27 18 18 23 23 16 10 10 14 28 18 18 11
1262
+ 11 9 9 9 10 10 10 21 21 27 23 18 10 9 9 14 18 32 31 37 34 28 28 22 19
1263
+ 19 27 24 21 18 17 9 9 12 19 24 28 30 30 30 33 33 30 30 37 40 40 45 37
1264
+ 41 41 44 44 45 32 42 37 32 32 32 32 37 31 31 33 21 21 11 10 22 18 32
1265
+ 24 27 27 27 27 11 14 10 23 12 23 9 10 10 18 11 25 25 34 45 37 37 34 34
1266
+ 34 34 34 34 34 33 33 33 34 34 34 34 33 34 28 31 25 21 23 21 21 13 13
1267
+ 15 15 17 23 21 26 26 31 28 32 23 23 12 22 25 21 19 9 8 8 17 21 23 23
1268
+ 20 18 17 27 23 21 27 30 38 38 28 28 17 17 13 18 19 27 25 25 28 28 28
1269
+ 28 25 31 26 26 18 15 13 9 9 15 19 23 25 31 36 36 36 36 36 36 36 36 24
1270
+ 19 12 13 18 24 31 31 29 29 31 29 29 33 36 40 44 36 33 34 34 37 36 36
1271
+ 45 45 34 30 28 28 28 22 32 24 22 22 32 32 36 37 27 27 14 25 25 29 23
1272
+ 22 19 17 19 19 24 25 27 24 18 18 16 16 16 24 22 30 30 28 28 30 27 27
1273
+ 23 20 22 25 25 25 21 22 21 16 14 19 17 17 19 20 17 11 11 11 11 12 24
1274
+ 24 22 20 34 17 17 23 23 31 34 27 27 17 13 15 27 27 34 31 31 24 22 19
1275
+ 16 16 15 32 23 27 18 9 9 9 13 9 14 20 22 21 21 19 17 14 8 6 6 8 8 9 11
1276
+ 14 8 7 11 15 14 9 9 9 12 8 10 6 8 8 6 4 4 4 14 15 23 21 13 13 11 13 11
1277
+ 11 6 8 8 6 6 6 7 6 6 6 6 7 6 6 11 15 17 27 20 17 17 13 21 13 14 4 4 8
1278
+ 6 6 6 6 8 6 8 11 7 8 8 10 10 19 24 16 16 9 9 12 7 7 8 8 8 8 6 6 11 15
1279
+ 11 10 9 9 11 14 15 11 8 7 7 7 7 12 9 10 10 8 8 14 10 10 18 21 21 18 16
1280
+ 10 9 11 9 9 14 10 10 8 8 9 8 8 12 14 10 10 11 11 10 9 8 7 7 7 7 4 4 4
1281
+ 12 10 14 10 8 14 6 6 6 7 6 6 6 6 6 10 8 9 7 7 7 9 14 15 10 10 10 10 9
1282
+ 8 13 8 4 4 4 4 4 6 6 12 6 6 10 8 8 8 6 9 12 7 6 6 6 8 8 9 7 7 7 8 9 8
1283
+ 8 6 6 6 6 6 4 6 6 6 6 7 8 8 6 6 8 8 8 8 9 9 8 10 11 9 8 8 8 8 6 6 11 9
1284
+ 9 10 9 12 8 6 6 6 10 12 10 10 8 8 8 7 10 13 8 13 19 18 13 6 6 6 6 8 6
1285
+ 7 12 7 7 10 10 7 7 7 7 7 7 9 13 6 10 7 7 12 11 7 6 6 6 6 8 8 8 4
1286
+
1287
+
1288
+ Sequence : 22ak70h4.r1t
1289
+ Is_read
1290
+ Padded
1291
+ Staden_id 15
1292
+ Clipping QUAL 28 377
1293
+ Align_to_SCF 1 682 1 682
1294
+ SCF_File 22ak70h4.r1tSCF
1295
+ Primer Universal_primer
1296
+ Strand Reverse
1297
+ Dye Dye_terminator
1298
+ Template 22ak70h4
1299
+ Clone bK216E10
1300
+ Sequencing_vector "m13mp18"
1301
+ Seq_vec SVEC 1 27 "M13mp18"
1302
+ Tag DONE 56 56 "AUTO-EDIT: replaced C by g at 56 (all_stranded, isolated, strong)"
1303
+ Tag ALUS 155 334
1304
+ Tag DONE 191 191 "AUTO-EDIT: replaced T by g at 191 (all_stranded, isolated, strong)"
1305
+ Tag ALUS 349 579
1306
+
1307
+ Sequence : Contig1
1308
+ Is_contig
1309
+ Padded
1310
+ Assembled_from 22ak93c2.r1t 1 293 39 331
1311
+ Assembled_from 22ak93c1.r1ta 1 305 31 335
1312
+ Assembled_from 22am91h5.r1t 110 439 32 361
1313
+ Assembled_from 22aq40a8.s1 221 570 39 388
1314
+ Assembled_from 22an02b10.s1t 252 666 32 446
1315
+ Assembled_from 22ak67d6.r1t 260 522 30 292
1316
+ Assembled_from 22ak64b1.s1t 331 707 40 416
1317
+ Assembled_from 22ak81h10.s1t 331 713 36 418
1318
+ Assembled_from 22ak66c6.s1t 337 848 37 548
1319
+ Assembled_from 22ak93c1.s1lt 1024 482 56 598
1320
+ Assembled_from 22ak64e2.s1t 866 487 41 420
1321
+ Assembled_from 22ak70f10.s1t 554 1027 35 508
1322
+ Assembled_from 22ak92c4.s1t 635 1088 37 490
1323
+ Assembled_from 22ap08f1.s1t 639 777 17 155
1324
+ Assembled_from 22ai01c4.s1t 682 1200 35 553
1325
+ Assembled_from 22ak93c1.s1t 1036 735 44 345
1326
+ Assembled_from 22ak65e10.s1t 1499 966 42 575
1327
+ Assembled_from 22ak93c2.s1t 1036 1035 44 45
1328
+ Assembled_from 22am84d9.s1 1488 1100 39 427
1329
+ Assembled_from 22ak66f10.s1lt 1174 1674 140 640
1330
+ Assembled_from 22ak70h4.r1t 1190 1539 28 377
1331
+
1332
+ DNA : Contig1
1333
+ TTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTATAnACTGTGCGTGCGC
1334
+ CACCATGCCTGGCTAATTTTTGTATTTTTAGTAGGGATGGGGTTTCACCATGTTGGCCAA
1335
+ GCTGGTCTCGAGCTCCTGACCTAGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGG
1336
+ GTCTTTATTCTTCAAAGCAGGAGGAAGGGATCCTAGAAAAACAGAGACAAGGCCAAACAT
1337
+ GGTAGCTCACACCTGTAATnnnnnCACTTTGGGAGGCCAGTGCGGGTGAATCACGAnGTC
1338
+ AGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAnCACCGTCTCTACTAAAATAAAAAGA
1339
+ AATTAGCTGGGTGTCGTGGCAGGTGCnTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGG
1340
+ AGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTC
1341
+ CAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACnACT
1342
+ AGTACAGTACTTACAGGGTTATTATGATGATTAAATGAGAGAATAGCTGTGAGGTGATTG
1343
+ ATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTGTnTCTAATC
1344
+ TGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATG
1345
+ TTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATATTC
1346
+ AACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATTTC
1347
+ TGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACGTTCTTTATCATTG
1348
+ TTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGCAAATTCGATTGTA
1349
+ TTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTGGAGAGAATAAAAC
1350
+ AGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGTTTTTCAGTTCATG
1351
+ CTCTTTCATTTTTTACTCCCTCAGGTTAAAGCTnGAAGCTCAACAAAGATATAGTGATCT
1352
+ CTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTnnAnnCnnnTCCnnnnnnnCTnnAnn
1353
+ nnnnnACAAATGAACCAGTGAAAACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTT
1354
+ TGCTTCTGCCTAGCGATACCAAGAGGTCTCAGGTAGGTAGAGATGCCTTTTGTTGTTGTT
1355
+ GTTTTTGAGACAGGGTCTCATTGTGTCGCCCAGGCTGGAGTGCAGTGGGGCGAACATGAC
1356
+ TCGCTACAGCCTTGACCTCCTGGACTCAAGCGATCCTTCTGTCTCAGCCTCCCAAGTAGC
1357
+ TGGGATCACAGGCATGTGACATCACACCCAGCTAATTTATTTATTTATTTATTTTTTAAG
1358
+ AGACTGGATCGACTGGGCACAGTGGCTCATGCCTGTAATCCCAnCACTTTGGGAGGCCGA
1359
+ GGCAGGTGGATTACCGAGGTCAGGAGTTCAAGACCAGCCTGACCAACATGGAGAAACCCC
1360
+ ATCTCTACTAAAAATACAAAATGAGCTGGGCATGGTGGTGCATGCCTGTAATCC
1361
+
1362
+
1363
+
1364
+ DNA : 22ak93c2.r1t
1365
+ GTCGCnCATAAGATTACGAGATCTCGAGCTCGGTACCCTTCAAGCGATTCTCCTGCCTCA
1366
+ GCCTCCCGAGTAGCTGGGATTATAGACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTG
1367
+ TATTTTTAGTAGGGATGGGGTTTCACCATGTTGGCCAAGCTGGTCTCGAGCTCCTGACCT
1368
+ AGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAGGA
1369
+ GGAAGGGATCCTAgAAAAACAGAGACAAGGCCAAACATGGTAgCTCACACCTGTAATCCC
1370
+ AnCACTTTGGGAGGCCagTGCGGGTGAATCACGAAGTCAGGAGTTCAAGACCACCCTGGC
1371
+ CAACATGGTGTAACACCTGCTCTCCTAAAATTAAACAAAATTTCATGGTTTGCGTGGGCC
1372
+ GTCTTGTCTCATCACTTCACTCCTGAGGGCCGGCGCCGGAAAGATATCTTGATCTGCGGC
1373
+ GCTCCGACCGTTTTCTTTAAACCTTACAACTCCCGACCTCCTCGCCTATCCTCCCTAAAT
1374
+ CCTCGCCAGGCTCGCCTGCTTCAGCCACTCTTTCCTTCGCACCCTCCCCTCTCTTCAATA
1375
+ TACTTCACCCGCCCATCCTTCACGCCGGCACGTATCCAATCTCTTCTTATCTTTCCGTAT
1376
+ CCAAnTCCCTTCTCCCTCTGCCGCGACCTTCGCCATCCCTCTGCGCGTCCTCTTCC
1377
+
1378
+ BaseQuality : 22ak93c2.r1t
1379
+ 4 4 8 4 4 4 4 4 4 4 4 4 6 8 17 21 14 7 6 6 6 7 7 6 8 14 16 21 15 20 20
1380
+ 24 26 21 18 18 14 14 19 23 10 8 8 15 20 16 29 26 34 29 39 29 31 29 31
1381
+ 34 32 27 27 25 19 19 24 31 33 36 34 34 34 26 27 22 32 32 36 28 28 15
1382
+ 15 15 28 28 34 30 12 12 22 27 31 31 31 31 31 23 24 27 21 24 24 29 27
1383
+ 27 27 34 34 36 38 38 38 36 36 40 36 37 38 45 45 36 34 33 31 31 34 34
1384
+ 33 33 28 28 27 23 24 11 11 10 10 18 25 21 20 17 17 17 20 15 24 18 24
1385
+ 26 23 23 18 20 25 23 30 30 30 33 33 37 37 32 37 37 32 45 35 37 37 37
1386
+ 40 36 49 49 36 36 34 33 20 15 9 9 8 7 12 22 21 28 28 30 33 36 36 36 34
1387
+ 31 31 25 31 28 26 26 24 20 17 9 11 8 9 10 23 23 31 23 23 15 9 9 15 33
1388
+ 26 33 33 31 25 25 22 31 24 23 12 10 12 11 9 8 9 7 7 8 8 9 18 12 9 9 18
1389
+ 20 26 31 21 21 9 8 8 11 13 21 21 23 15 15 15 15 15 17 17 9 7 9 19 20
1390
+ 21 21 25 25 25 25 25 23 23 9 9 9 21 16 24 24 24 24 26 33 33 33 31 31
1391
+ 27 15 17 7 4 4 4 16 20 27 33 34 34 23 15 14 8 9 6 6 9 1 14 16 8 11 15
1392
+ 23 25 34 36 31 33 16 16 6 6 6 9 8 14 9 11 11 9 13 13 10 8 10 9 9 7 8
1393
+ 20 20 20 14 14 10 10 10 16 8 8 6 6 8 9 10 7 8 8 8 8 6 8 6 6 8 12 9 8 7
1394
+ 13 10 8 8 9 8 8 8 9 6 6 6 6 8 6 6 6 6 6 10 11 10 12 12 10 7 6 6 7 6 6
1395
+ 7 8 7 6 6 7 6 8 6 6 8 8 8 8 6 6 6 8 6 6 8 6 6 11 15 9 9 9 9 9 9 9 9 9
1396
+ 9 8 9 9 6 6 6 7 9 6 6 6 7 7 7 8 9 7 7 9 9 11 8 11 11 11 9 10 9 8 8 8
1397
+ 10 6 6 9 8 6 6 6 6 8 8 9 11 9 8 8 8 8 8 8 8 9 9 9 10 10 8 6 6 8 6 6 10
1398
+ 11 10 6 6 8 6 6 6 6 8 11 8 9 8 8 8 8 8 9 6 6 9 8 8 8 6 6 13 15 12 12 8
1399
+ 8 6 6 8 9 8 8 9 8 8 6 6 6 8 8 6 6 6 8 8 8 6 6 8 6 6 8 6 6 9 8 8 6 6 8
1400
+ 8 6 6 8 6 7 8 9 10 11 11 10 9 9 8 10 9 10 10 8 9 13 8 8 8 13 13 11 7 7
1401
+ 7 11 8 8 10 11 10 9 9 14 7 7 10 10 10 8 8 8 8 6 7 8 8 6 6 6 6 6 6 6 6
1402
+ 6 8 9 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 10 10 4 4 4 6 7 6 6 6 6
1403
+ 10 8 8 9 15 11 6 6 8 8 8 8 8 8 9 9 8 9 7 7 8 6 6 8 13 10 8 8 7 6 8 6 6
1404
+ 8 6 7 8 8 8 8 8 8 8 4
1405
+
1406
+
1407
+ Sequence : 22ak93c2.r1t
1408
+ Is_read
1409
+ Padded
1410
+ Staden_id 11
1411
+ Clipping QUAL 39 331
1412
+ Align_to_SCF 1 43 1 43
1413
+ Align_to_SCF 44 317 45 318
1414
+ Align_to_SCF 319 716 319 716
1415
+ SCF_File 22ak93c2.r1tSCF
1416
+ Primer Universal_primer
1417
+ Strand Reverse
1418
+ Dye Dye_terminator
1419
+ Template 22ak93c2
1420
+ Clone bK216E10
1421
+ Sequencing_vector "m13mp18"
1422
+ Seq_vec SVEC 1 38 "M13mp18"
1423
+ Tag ALUS 43 180
1424
+ Tag DONE 43 43 "AUTO-EDIT: deleted C at 43 (terminator, isolated, strong)"
1425
+ Tag DONE 254 254 "AUTO-EDIT: replaced T by g at 254 (terminator, isolated, strong)"
1426
+ Tag ALUS 269 402
1427
+ Tag DONE 283 283 "AUTO-EDIT: replaced T by g at 283 (terminated, isolated, strong)"
1428
+ Tag AMBG 298 302 "AUTOEDIT: Check this edit cluster!"
1429
+ Tag DONE 317 317 "AUTO-EDIT: replaced C by a at 317 (terminated, compound, strong)"
1430
+ Tag DONE 318 318 "AUTO-EDIT: inserted g at 318 (terminated, compound, strong)"
1431
+
1432
+ DNA : 22ak93c1.r1ta
1433
+ GGGGGGATGATACAATTCGAGCTCGGTACCTTCAAGCGATTCTCCTGCCTCAGCCTCCCG
1434
+ AGTAGCTGGGATTATAAACTGTGCGTGCGCCACCATGCCTGGCTAATTTTTGTATTTTTA
1435
+ GTAGGGATGGGGTTTCACCATGTTGGCCAaGCTGGTCTCGAGCTCCTGACCTAGGATtAC
1436
+ AGGCCTAaGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGCAgGAGGAAGGGA
1437
+ TCCTAGAAAAACAGAGACAAgGCCAAACATGGTAGCTCACACCTGTAATCCCAGCACTTT
1438
+ GGGAgGCCAgTGCGGGTGAATCACgAAGTCAGGAGTTCAAGACCATCCTGGCCAACATGG
1439
+ TGTAACACCGTCTCTCCTAGGATAAACCGAAATCACCTGGGTGTCCTGGCAAGTGCCTGT
1440
+ CATCCCTGACCACTTGGAAAGCTGAGCCGAATCCTTATCCCnGAAAGTAAGGTTACGTGA
1441
+ ACCCACATCAAACCACTGCGCTCCAGCCCAAAACATCGTGTTATACTCTGTCGCGACATT
1442
+ GATGCCCAAAAAACAGGACCGCTATTGGGAGACACTCCCGGGTAATTGGGATTGAGGAGG
1443
+ TTAAAGAAAACTCTTGATCTGAGAAAAAAGACCCTATCCTGGCGAGAAAACCACATGTGG
1444
+ ACCACACCGCTTCACTTTGTCTAAGCAAAAAACGCCCCACTTGAAGATGACCCCCCCAGC
1445
+ TGAAATCTTCCATTAATCCCCGAACATAAAGGTTTAACCCAAAATTTCCTGTTAGACCGC
1446
+ CTTCTGAAGTTTCTAAAATTCTATGGGTAGGGACAAAAGTCCCTCGTTGAATTTCTAGGA
1447
+ TACTTCCAAATATCCCCCACCTCTCCCCTGGGATCCCGATAGCTTTCTTGTCCCTAAAAA
1448
+ AAACTTTGTTCAAACGGAGAAACCACACCCGGGGAAAATTCCCCTTTTCTTGGGGTTTAG
1449
+ GTTTCTTTAAATAAATGCTGGGCACCAATCCTCAAATGAGTTCTTACCCAATCCCATATG
1450
+ TTTTTAATCCTCAACAACAACCTTATTTCCTTAAGAGACCTCTCCTCGGAAATCATTTCA
1451
+ AAACAAAAAAAACACTTAAGCCTTGGGTCTTTGGGACCCCCCAAAAAAAAAACATAAAGG
1452
+ GGTGGCACCGTATACGCCTTGCCCATCTTTCTAGTGGAAGATAACGAAACGGTAGCTGGG
1453
+ GCCAACCAGGCATCAGTGGGGGATACCGCTAAATGTTGGGGAACACCCAAAAACCCATCT
1454
+ GCAGGCACCGCGAATGCGGAAAAGCGCACGCTATCACAAATGGTATATGGGCACC
1455
+
1456
+ BaseQuality : 22ak93c1.r1ta
1457
+ 8 10 8 9 16 9 9 9 11 8 8 9 10 11 11 10 19 24 26 24 26 22 21 17 13 16
1458
+ 11 11 10 10 14 14 19 22 24 26 32 32 33 29 29 29 27 27 27 27 27 32 32
1459
+ 25 27 20 25 19 32 27 29 32 32 32 34 34 21 23 12 14 14 27 32 32 29 28
1460
+ 27 34 31 34 34 34 37 34 32 32 30 30 28 28 28 30 30 33 33 33 30 30 34
1461
+ 34 34 37 40 38 37 34 32 34 32 37 32 37 37 28 28 28 33 33 33 33 32 30
1462
+ 30 29 28 21 23 14 12 30 32 45 45 41 41 30 25 22 33 33 34 23 21 18 12
1463
+ 12 11 13 27 27 23 23 11 11 9 10 11 18 18 30 15 20 12 11 10 20 12 14 14
1464
+ 32 32 33 28 28 18 23 18 12 12 20 12 16 13 18 14 15 12 32 23 21 10 10 9
1465
+ 9 10 16 18 21 9 9 9 18 21 14 14 12 10 14 14 23 27 24 19 19 24 28 30 29
1466
+ 29 34 34 29 25 17 12 12 16 14 14 23 10 10 10 11 15 21 24 18 25 11 11
1467
+ 15 32 28 34 34 29 32 32 37 37 34 34 31 28 28 25 22 17 14 11 10 10 8 8
1468
+ 9 14 8 8 12 17 18 15 13 18 17 17 10 10 10 22 16 24 30 24 28 27 32 19
1469
+ 12 12 12 30 21 17 9 9 9 9 17 16 24 24 23 20 12 12 7 7 7 14 13 10 10 10
1470
+ 23 23 22 15 17 18 24 24 15 17 11 10 8 8 8 13 20 25 17 17 17 20 20 18
1471
+ 10 11 12 12 11 25 10 12 12 9 8 8 8 8 8 12 14 9 9 9 9 10 10 8 8 11 9 9
1472
+ 9 14 20 20 19 15 15 15 15 11 11 6 6 9 8 10 12 12 15 15 10 9 10 11 7 7
1473
+ 9 11 14 11 11 10 11 9 14 14 23 19 18 14 12 10 10 10 10 10 16 11 11 9 8
1474
+ 8 9 8 11 11 9 8 8 10 9 12 13 9 9 8 8 8 8 8 6 6 11 6 6 8 11 9 9 9 6 6
1475
+ 12 9 9 6 6 8 11 9 8 6 7 9 9 7 8 4 4 4 6 8 6 6 8 8 6 6 8 6 8 12 12 14
1476
+ 10 9 10 11 9 8 7 7 7 7 10 8 8 6 6 8 6 6 8 10 8 6 6 10 8 10 9 10 10 9 8
1477
+ 8 6 6 6 6 8 8 8 9 9 9 9 7 7 9 9 10 10 10 13 12 9 9 9 9 7 8 8 8 9 8 8 9
1478
+ 9 9 8 6 6 8 6 6 6 7 7 9 9 10 8 8 7 7 7 9 10 10 8 6 6 6 6 6 10 10 8 6 6
1479
+ 8 8 8 7 9 7 10 7 11 8 8 8 8 9 9 9 8 8 6 6 10 11 16 8 7 7 7 6 8 6 6 8
1480
+ 10 11 9 9 9 7 7 8 7 7 7 7 7 8 11 9 16 16 24 22 15 9 8 13 13 12 12 9 9
1481
+ 9 9 9 7 7 7 7 7 7 7 8 7 7 7 6 9 11 9 8 8 9 9 9 7 9 10 14 12 9 9 8 8 6
1482
+ 6 6 6 8 6 6 8 6 6 6 6 6 9 8 10 10 9 10 10 13 10 11 6 7 11 6 6 8 6 6 6
1483
+ 6 6 6 9 9 7 7 8 8 8 8 8 9 8 9 13 11 8 6 6 6 9 9 8 8 8 8 8 8 8 11 8 7
1484
+ 10 12 7 7 9 8 6 6 8 8 7 7 10 8 8 7 7 7 8 8 8 8 7 7 7 7 7 10 9 10 12 10
1485
+ 7 7 6 9 6 6 6 6 7 9 7 7 4 10 9 7 6 8 6 6 8 6 6 9 6 7 7 10 10 10 10 13
1486
+ 13 8 9 8 8 8 6 7 10 11 10 9 8 6 6 6 6 6 8 8 7 9 7 7 7 7 7 7 7 10 10 10
1487
+ 8 8 8 7 7 8 8 8 8 6 6 7 7 7 9 8 6 8 6 6 6 8 8 8 7 9 9 12 15 9 8 7 9 8
1488
+ 8 9 8 8 6 8 12 11 7 7 7 7 7 7 9 11 11 9 9 9 10 9 9 9 8 8 8 8 8 7 7 12
1489
+ 13 13 15 11 11 7 7 7 9 11 10 12 6 6 6 6 8 7 7 7 8 10 10 10 10 13 9 12
1490
+ 11 11 6 6 6 6 8 8 6 7 7 12 10 13 9 8 7 7 10 7 7 15 17 15 12 17 20 15
1491
+ 13 15 6 6 6 6 8 8 6 6 6 7 7 7 10 7 7 10 11 8 8 5 5 8 8 12 12 8 10 6 6
1492
+ 6 6 8 8 7 7 7 12 10 7 7 9 7 7 9 9 8 9 10 10 8 8 9 11 9 8 9 9 11 11 9 9
1493
+ 8 6 8 6 6 6 6 6 6 6 6 8 8 8 8 12 6 6 6 6 8 6 7 7 6 8 6 6 8 8 10 11 10
1494
+ 12 7 8 8 9 12 6 6 6 6 6 6 6 6 8 9 9 9 9 9 8 7 8 7 7 7 8 7 7 7 7 9 9 9
1495
+ 9 6 6 6 6 14 8 8 8 8 8 6 6 7 7 7 11 9 7 6 6 6 6 10 6 6 6 8 8 7 8 7 7 6
1496
+ 7 7 8 8 12 13 15 15 21 9 10 9 8 8 10 6 6 6 6 4 4 4 8 8 8 7 6 6 6 6 6 6
1497
+ 6 6 6 6 6 9 9 9 6 6 6 10 6 10 15 20 12 9 8 6 6 6 6 6 8 8 6 6 6 6 8 12
1498
+ 13 12 10 9 8 11 8 10 9 7 7 4 4 6 6 8 4 4 4 6 8 6 6 6 8 8 13 10 8 9 9 9
1499
+ 7 7 9 10 8 8 6 6 6 6 6 6 10 11 10 10 10 7 7 8 6 6 8 6 6 8 10 13 8 11 8
1500
+ 11 10 6 6 6 7 11 14 11 11 6 6 8 8 8 9 9 9 9 7 7 10 10 6 6 6 6 6 6 8 8
1501
+ 8 7 7 7 8 8 11 11 11 7 6 8 6 6 8 8 6 6 10 10 13 8 8 6 6 6 8 9 9 6 6 9
1502
+ 9 8 8 6 6 8 6 6 8 8 4
1503
+
1504
+
1505
+ Sequence : 22ak93c1.r1ta
1506
+ Is_read
1507
+ Padded
1508
+ Staden_id 12
1509
+ Clipping QUAL 31 335
1510
+ Align_to_SCF 1 1315 1 1315
1511
+ SCF_File 22ak93c1.r1taSCF
1512
+ Primer Universal_primer
1513
+ Strand Reverse
1514
+ Dye Dye_terminator
1515
+ Template 22ak93c1
1516
+ Clone bK216E10
1517
+ Sequencing_vector "m13mp18"
1518
+ Seq_vec SVEC 1 30 "M13mp18"
1519
+ Tag ALUS 31 172
1520
+ Tag DONE 150 150 "AUTO-EDIT: replaced T by a at 150 (terminator, isolated, strong)"
1521
+ Tag DONE 178 178 "AUTO-EDIT: replaced G by t at 178 (terminator, isolated, strong)"
1522
+ Tag DONE 188 188 "AUTO-EDIT: replaced T by a at 188 (terminator, isolated, strong)"
1523
+ Tag DONE 230 230 "AUTO-EDIT: replaced T by g at 230 (terminator, isolated, strong)"
1524
+ Tag DONE 261 261 "AUTO-EDIT: replaced C by g at 261 (terminated, isolated, strong)"
1525
+ Tag ALUS 262 446
1526
+ Tag DONE 305 305 "AUTO-EDIT: replaced T by g at 305 (terminated, isolated, strong)"
1527
+ Tag DONE 310 310 "AUTO-EDIT: inserted g at 310 (terminated, compound, strong)"
1528
+ Tag DONE 325 325 "AUTO-EDIT: replaced A by g at 325 (terminated, isolated, strong)"
1529
+
1530
+ DNA : 22am91h5.r1t
1531
+ GGGnnATAGATACGATCCGAGCTCGGTACCCATGTTGGCCAAGCTGGTCTCGAGCTCCTG
1532
+ ACCTAGGATTACAGGCCTAAGCCACCGCACCCGGCATGATGGGTCTTTATTCTTCAAAGC
1533
+ AGGAGGAAGGGATCCTAGAAAAACAGAGACAAGGCCAAACATGGTAGCTCACACCTGTAA
1534
+ TCCCAGCACTTTGGGAGGCCAGTGCGGGTGAATCACGAAGTCAGGAGTTCAAGACCAGCC
1535
+ TGGCCAACATGGTGAAACACCGTCTCTACTAAAATAAAAAGAAATTAGCTGGGTGTCGTG
1536
+ GCAGGTGCCTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGGAGAATCGCTTGAACCCGG
1537
+ GAGGTGGAGGTTGCAnTGAGCCGAGATCACGCGACTGCACTCCAGCCCAACCAATAATGT
1538
+ GAGACTCTGTCTCGAnAAnnnAAAGCnGAAAACAGACnnCTAGTACnGTACTTAACGGGG
1539
+ TAATTATAATAATTAAATGAAAAAAATAnCTGTGAGGTGATTGATATAnTGCTGTTGCTA
1540
+ AATACAACTAACATTTTAATATACCGGTGGAGTGTTTCTAATCTGAnAATCCAAATTAGA
1541
+ AATGCTCACAGTCTGAAACTTTTTGAGCACCAACTAATGTTCAAAGAATTGCTATGGACC
1542
+ ATATGGGTGGTTGATTTT
1543
+
1544
+ BaseQuality : 22am91h5.r1t
1545
+ 4 8 4 4 4 4 4 7 10 9 10 15 10 7 7 10 10 9 19 20 33 34 34 34 36 36 33
1546
+ 33 31 33 33 32 31 31 26 26 27 23 30 26 26 26 26 34 34 38 38 38 37 45
1547
+ 45 37 37 37 37 45 45 45 45 37 37 37 45 45 32 18 10 21 18 28 29 33 33
1548
+ 33 33 45 45 42 42 37 33 33 33 36 33 33 30 30 30 30 32 36 33 33 33 33
1549
+ 33 33 37 37 45 45 37 37 37 33 33 35 35 35 35 43 35 42 42 35 35 34 34
1550
+ 34 29 29 22 27 27 27 37 27 37 45 33 30 30 37 28 32 32 10 10 21 32 32
1551
+ 34 27 23 12 11 9 9 9 18 21 28 31 33 30 30 30 30 34 34 34 34 31 33 34
1552
+ 34 33 31 33 33 33 33 33 33 45 45 40 37 37 37 33 33 30 30 30 30 33 30
1553
+ 33 26 26 26 25 23 18 14 12 20 23 27 25 21 21 21 28 28 30 31 31 31 31
1554
+ 32 21 21 12 6 6 9 9 14 17 19 17 10 16 13 8 8 11 13 9 13 12 14 14 21 23
1555
+ 26 34 36 34 31 22 24 20 28 28 33 27 28 25 27 24 34 32 23 12 12 12 23
1556
+ 23 33 28 34 34 37 32 32 15 11 11 32 32 40 37 38 18 11 9 9 18 25 45 34
1557
+ 28 28 9 9 20 29 45 38 34 23 23 10 23 23 33 33 33 21 21 13 25 25 25 29
1558
+ 27 33 30 33 33 34 33 30 30 19 19 30 30 30 26 26 30 27 27 23 19 15 24
1559
+ 27 28 21 9 9 9 19 14 12 10 12 12 13 17 28 18 19 21 24 24 25 24 24 24
1560
+ 24 18 18 13 18 8 8 8 10 10 10 7 7 7 8 8 12 15 4 4 4 25 18 21 17 15 16
1561
+ 14 9 9 17 14 17 9 17 8 8 10 10 10 11 17 17 22 24 23 24 24 19 13 10 8
1562
+ 15 15 10 9 9 9 16 12 12 14 19 18 26 24 22 22 24 25 21 24 24 32 19 20 9
1563
+ 9 4 4 4 4 4 4 4 4 17 16 16 4 4 4 7 10 8 7 6 13 8 8 4 4 4 4 8 8 7 7 7 4
1564
+ 4 4 17 23 12 9 8 7 7 8 7 10 10 8 6 6 6 6 6 10 10 7 7 7 7 9 7 8 10 7 7
1565
+ 8 6 6 8 8 8 9 10 7 12 4 4 4 9 9 7 6 6 7 6 6 10 9 7 8 10 7 7 7 9 4 4 4
1566
+ 14 8 8 9 7 6 6 8 8 8 7 7 6 6 9 7 7 10 13 8 9 8 8 8 14 7 7 7 7 9 8 12
1567
+ 12 4 4 4 7 7 7 7 8 8 8 7 7 7 7 7 7 8 10 8 6 6 6 4 4 4 8 12 9 9 17 9 7
1568
+ 7 7 7 6 6 6 6 8 10 6 6 6 8 6 6 6 6 6 6 6 6 6 6 6 6 6 13 11 9 8 7 8 7 7
1569
+ 7 8 7 9 8 7 6 6 4 6 6 8 7 7 7 6 8 6 6 8 7 7 9 9 10 11 7 6 6 6 6 6 12 9
1570
+ 8 8 12 11 10 8 7 7 4 4 4 7 7 8 4
1571
+
1572
+
1573
+ Sequence : 22am91h5.r1t
1574
+ Is_read
1575
+ Padded
1576
+ Staden_id 20
1577
+ Clipping QUAL 32 361
1578
+ Align_to_SCF 1 678 1 678
1579
+ SCF_File 22am91h5.r1tSCF
1580
+ Primer Universal_primer
1581
+ Strand Reverse
1582
+ Dye Dye_terminator
1583
+ Template 22am91h5
1584
+ Clone bK216E10
1585
+ Sequencing_vector "m13mp18"
1586
+ Seq_vec SVEC 1 31 "M13mp18"
1587
+ Tag ALUS 153 443
1588
+
1589
+ DNA : 22aq40a8.s1
1590
+ AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACAGAGACAAGGCCAAACATGG
1591
+ TAGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAGTGCGGGTGAATCACGAGGTCAG
1592
+ GAGTTCAAGACCAGCCTGGCCAACATGGTGAA-CACCGTCTCTACTAAAATAAAAAGAAA
1593
+ TTAGCTGGGTGTCGTGGCAGGTGCTtGTAATCCCAGCCACTTGGGAAGCTGAGGCAGGAG
1594
+ AATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTCCA
1595
+ GCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACAACTAG
1596
+ TACAGTACTTACAGGGTTATTATGATGATTAnATGAGAGAATAGCTGTGAGGTGATTGAT
1597
+ ATAGTGCTGTGCTTAAATACAACTATCAATTTTATTATACGGGGTTGAGTGTTTCCAATC
1598
+ TGAAAATCCCAAATTTGGAATGCTCTACGGTCTGAAACCTTTTTTGAGCACCGACCTAAA
1599
+
1600
+ BaseQuality : 22aq40a8.s1
1601
+ 7 9 10 11 11 23 27 25 25 9 9 9 12 14 23 27 24 21 21 16 22 22 22 24 23
1602
+ 23 23 30 30 30 30 30 32 34 31 31 34 34 28 28 28 30 30 30 28 28 28 34
1603
+ 34 34 34 34 34 37 34 34 34 34 34 34 37 37 37 37 37 37 37 32 34 29 29
1604
+ 29 45 38 40 40 37 37 32 37 37 37 37 37 37 37 37 37 40 40 40 40 40 37
1605
+ 30 30 32 22 22 22 32 32 41 45 45 41 41 45 30 32 27 32 32 40 37 37 40
1606
+ 37 37 45 45 45 40 40 37 37 37 37 37 37 37 37 40 37 37 37 31 32 28 28
1607
+ 28 32 32 37 34 37 38 38 38 27 27 11 1 11 10 21 27 34 34 37 37 34 34 45
1608
+ 45 45 38 37 37 37 37 37 37 34 34 34 34 33 30 30 28 28 28 28 28 30 37
1609
+ 37 37 37 33 36 36 31 31 31 24 24 24 24 21 21 17 12 4 4 4 14 17 26 25
1610
+ 25 31 34 34 31 31 31 33 31 31 34 35 37 37 32 32 34 34 30 31 31 34 30
1611
+ 33 30 30 30 33 33 30 30 23 22 22 32 32 40 34 36 34 31 26 28 26 24 16 9
1612
+ 9 9 8 15 22 22 25 25 31 31 30 30 28 30 30 30 30 28 28 28 30 30 30 30
1613
+ 30 37 32 27 23 18 18 27 27 34 34 31 33 30 30 28 28 28 28 28 30 34 33
1614
+ 33 33 33 30 26 26 23 23 23 30 37 36 32 32 24 23 21 20 28 31 29 30 22
1615
+ 21 18 13 15 23 26 34 34 36 33 30 30 30 30 25 25 25 26 23 26 25 24 24
1616
+ 25 27 25 22 14 15 12 12 12 21 21 25 25 22 21 21 24 19 19 14 16 11 13
1617
+ 14 20 27 30 28 28 28 30 33 34 34 23 23 16 7 7 4 4 4 18 17 21 23 21 17
1618
+ 11 13 18 18 18 20 18 18 11 14 7 7 7 15 20 18 11 10 15 23 18 16 10 8 8
1619
+ 13 17 18 14 14 14 13 13 14 17 18 13 13 9 9 9 14 12 18 18 11 11 5 5 5 6
1620
+ 6 6 8 12 10 13 15 11 11 11 8 6 6 6 6 6 8 6 6 8 8 8 7 7 9 9 8 8 19 8 8
1621
+ 14 8 8 6 6 11 9 9 8 14 6 6 7 7 8 6 7 6 6 9 9 10 15 14 12 7 7 7 7 13 15
1622
+ 22 22 19 14 9 8 8 8 12 15 19 7 6 10 9 8 6 7 9 9 10 10 8 8 7 7 4 4
1623
+
1624
+
1625
+ Sequence : 22aq40a8.s1
1626
+ Is_read
1627
+ Padded
1628
+ Staden_id 3
1629
+ Clipping QUAL 39 388
1630
+ Align_to_SCF 1 152 1 152
1631
+ Align_to_SCF 154 540 153 539
1632
+ SCF_File 22aq40a8.s1SCF
1633
+ Primer Universal_primer
1634
+ Strand Forward
1635
+ Dye Dye_primer
1636
+ Template 22aq40a8
1637
+ Clone bK216E10
1638
+ Sequencing_vector "m13mp18"
1639
+ Seq_vec SVEC 1 38 "M13mp18"
1640
+ Tag ALUS 49 339
1641
+ Tag DONE 206 206 "AUTO-EDIT: replaced N by t at 206 (terminated, compound, strong)"
1642
+
1643
+ DNA : 22an02b10.s1t
1644
+ CGTGCCTGCAGGTCGACTCTAGAGGATCCCCCCTGTAATCCCAGCACTTTGGGAGGCCAg
1645
+ TGCGGGTGAATCACgATGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACACCG
1646
+ TCTCTACTAAAATAAAAAGAAATTAGCTGGGTGTCgTGGCAGGTGCCTGTAATCCCAGCC
1647
+ ACTTGGGAAGCTGAgGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCC
1648
+ GAgATCACGCGACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAA
1649
+ AAAGCAGAGACAAGACAACTAGTACAGTACTTACaGGGTTATTATGATGATTAAATGAGA
1650
+ gAATAGCTGTGAgGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATA
1651
+ CGGGTTGAGTGTATCTAATCTGAAAATCCAAAATCAGAAATGCGCTACAGTCTGAAACTT
1652
+ TTTTGAGCACCGACCTAATGTTCCAAGGAAGTGCTTATCGGAGCACCATGGGTCGGTACA
1653
+ CATTTGGGTCGGGAATATnCCACCAGTGAGTACCATAAAATGCCAATATCCCCTCCCACC
1654
+ CCCAACA
1655
+
1656
+ BaseQuality : 22an02b10.s1t
1657
+ 7 7 9 12 10 15 16 17 13 13 21 18 23 17 28 28 37 37 37 33 26 26 17 19
1658
+ 12 21 25 36 45 45 34 34 34 34 34 37 37 37 37 37 32 25 9 9 13 17 17 14
1659
+ 18 18 21 29 32 19 18 18 18 21 9 9 9 23 19 30 30 37 29 37 37 32 34 23
1660
+ 20 13 13 10 13 22 32 21 17 17 23 18 10 10 10 12 13 9 9 14 23 29 28 22
1661
+ 22 32 33 37 34 34 34 34 34 34 34 30 37 32 37 37 41 34 33 33 33 21 21
1662
+ 14 14 14 24 28 41 37 32 32 21 21 21 25 30 30 37 30 37 30 30 30 32 36
1663
+ 28 27 17 27 27 37 32 37 36 37 25 23 10 10 10 32 21 23 10 15 10 23 23
1664
+ 36 32 32 34 34 34 37 37 25 25 13 9 9 21 25 25 32 32 32 41 32 28 28 11
1665
+ 22 22 32 32 13 13 10 11 9 10 10 12 12 14 32 32 29 22 22 21 21 17 21 27
1666
+ 41 41 41 28 27 32 27 27 29 37 32 34 17 15 14 28 23 25 20 9 9 9 25 10
1667
+ 12 12 14 13 10 10 9 16 13 23 23 14 14 22 25 34 28 28 22 28 28 28 19 18
1668
+ 10 10 11 19 21 28 28 28 30 30 30 23 18 10 10 28 32 32 34 28 28 28 28
1669
+ 28 31 34 34 25 25 12 19 11 14 14 25 21 24 24 18 18 18 22 23 13 11 10
1670
+ 10 10 10 14 13 10 9 9 7 8 14 17 16 10 10 13 16 15 18 18 18 18 14 15 12
1671
+ 12 9 12 9 12 12 13 9 14 10 18 19 14 9 13 11 18 14 15 15 16 20 19 18 14
1672
+ 9 8 8 6 6 6 11 9 9 14 17 20 12 13 6 6 8 8 11 10 21 23 15 14 13 13 14
1673
+ 21 27 28 32 29 34 28 27 23 14 10 10 12 17 15 13 11 11 11 18 28 33 24
1674
+ 18 14 12 17 12 12 18 22 19 19 24 28 20 21 19 19 20 17 17 26 25 20 9 14
1675
+ 7 7 7 15 21 33 27 27 18 20 19 15 15 20 18 14 14 8 8 9 9 9 7 7 7 7 7 8
1676
+ 9 9 12 7 7 9 11 10 11 13 13 11 7 7 8 15 17 26 25 25 27 25 24 21 19 20
1677
+ 18 13 13 14 9 9 14 18 17 12 15 16 21 20 18 8 7 6 6 6 13 20 25 18 11 14
1678
+ 9 9 9 11 11 12 12 15 15 18 10 10 8 8 10 10 9 9 9 16 11 7 7 6 6 8 4 4 4
1679
+ 4 4 6 10 10 13 13 12 6 6 6 6 12 15 12 11 11 4 4 4 6 6 6 6 6 8 6 6 6 8
1680
+ 6 8 11 13 8 8 6 6 6 6 9 16 9 13 13 17 14 13 9 7 7 12 8 8 8 9 9 9 9 9 9
1681
+ 8 8 8 10 9 7
1682
+
1683
+
1684
+ Sequence : 22an02b10.s1t
1685
+ Is_read
1686
+ Padded
1687
+ Staden_id 21
1688
+ Clipping QUAL 32 446
1689
+ Align_to_SCF 1 607 1 607
1690
+ SCF_File 22an02b10.s1tSCF
1691
+ Primer Universal_primer
1692
+ Strand Forward
1693
+ Dye Dye_terminator
1694
+ Template 22an02b10
1695
+ Clone bK216E10
1696
+ Sequencing_vector "m13mp18"
1697
+ Seq_vec SVEC 1 31 "M13mp18"
1698
+ Tag ALUS 32 301
1699
+ Tag DONE 60 60 "AUTO-EDIT: inserted g at 60 (terminated, compound, strong)"
1700
+ Tag DONE 75 75 "AUTO-EDIT: replaced A by g at 75 (terminated, isolated, strong)"
1701
+ Tag DONE 156 156 "AUTO-EDIT: replaced C by g at 156 (terminated, isolated, strong)"
1702
+ Tag DONE 195 195 "AUTO-EDIT: replaced A by g at 195 (terminated, isolated, strong)"
1703
+ Tag DONE 243 243 "AUTO-EDIT: replaced T by g at 243 (terminated, isolated, strong)"
1704
+ Tag DONE 335 335 "AUTO-EDIT: replaced T by a at 335 (all_stranded, isolated, strong)"
1705
+ Tag DONE 361 361 "AUTO-EDIT: replaced C by g at 361 (terminated, isolated, strong)"
1706
+ Tag DONE 373 373 "AUTO-EDIT: replaced C by g at 373 (terminated, isolated, strong)"
1707
+
1708
+ DNA : 22ak67d6.r1t
1709
+ CGCGCCCCTCnGACTCCGGCCCTAnCACGGTACCCACTTTGGGAGGCCAGTGCGGGTGAA
1710
+ TCACGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACACCGTCTCTACTAA
1711
+ AATAAAAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAG
1712
+ CTGAgGCAGGAGAATCGCTTGAACCCGGGAgGTGGAGGTTGCAGTGAGCCGAGATCACGC
1713
+ GACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGA
1714
+ TCAGATCACTAGTACAGTACTTACGGGCTTATTATGATGATTAAATGAGAGAATACCTGT
1715
+ GAGGTGATTGATATATTGCTGTGCTTAATACAnACTATCATTTTATTATACGGGTCGAGT
1716
+ GTTTCTAATCTGACAATCCAAATTAGAAATGCTCTACAGTCTGAAACCTTTTTGAGCACC
1717
+ CACCTACTGTTCAAAGGACGTGCTTATTGGAGCATTATGGGTTGTAACATTTTTGGGTTG
1718
+ GGAATTTTCACCCATTAGTACTATAAATGCCATTTTCCAAAAAATCTGAATCTAAAATTT
1719
+ CTGGTCCTACCAGCATTTGCTAGGGATCCCACCCGTCTTCTTCCTTACCTGTTTAAGTCT
1720
+ TATAAATC
1721
+
1722
+ BaseQuality : 22ak67d6.r1t
1723
+ 6 6 6 4 8 11 15 8 4 4 4 4 8 6 6 9 7 8 9 8 4 4 4 4 4 4 10 9 9 21 19 33
1724
+ 30 33 30 30 30 28 28 28 23 23 20 11 11 16 12 13 17 21 25 28 33 33 33
1725
+ 38 34 34 34 33 30 22 22 12 14 21 10 12 21 21 16 14 11 13 13 14 21 21
1726
+ 21 19 15 18 23 23 25 30 28 33 38 38 33 33 30 30 30 30 30 30 30 37 37
1727
+ 45 45 33 33 33 33 33 33 40 42 49 42 40 40 40 34 34 31 35 34 35 37 42
1728
+ 42 37 32 19 9 9 11 23 19 28 30 30 28 38 45 37 37 37 32 32 24 34 34 30
1729
+ 30 26 21 20 11 27 27 40 34 30 30 28 30 30 30 23 18 17 9 9 18 16 16 24
1730
+ 24 24 23 21 18 11 11 18 25 25 16 9 7 9 15 11 8 7 9 7 7 8 16 16 27 28
1731
+ 25 20 16 10 10 9 13 8 8 7 12 4 4 4 14 6 6 6 7 9 6 7 7 7 7 16 10 20 15
1732
+ 13 11 9 9 8 8 8 15 8 10 10 17 14 9 9 19 15 15 7 7 12 20 19 25 25 22 18
1733
+ 17 7 9 12 20 21 25 21 21 20 22 28 32 30 25 25 12 12 18 32 32 36 49 49
1734
+ 33 33 24 20 13 12 16 18 20 14 25 23 25 19 12 11 8 8 4 4 4 4 4 8 8 6 4
1735
+ 6 8 15 17 21 19 15 8 8 8 8 10 7 7 13 9 7 11 14 6 6 4 4 4 6 12 8 13 17
1736
+ 21 18 19 19 20 18 18 15 10 15 14 13 14 8 8 8 9 8 8 10 10 8 8 15 17 17
1737
+ 17 17 14 13 19 17 16 12 10 14 15 17 15 14 8 8 7 7 15 19 18 12 11 16 12
1738
+ 15 11 10 13 13 11 4 4 4 10 12 12 18 12 14 9 10 9 10 21 22 18 14 6 6 6
1739
+ 6 6 8 4 4 4 8 8 7 8 7 9 14 7 8 7 10 16 31 17 14 4 4 4 10 11 8 10 13 17
1740
+ 13 8 8 9 8 8 12 12 14 14 7 7 7 7 7 7 7 8 9 13 11 10 7 10 7 6 6 10 8 8
1741
+ 23 23 12 7 7 7 7 7 10 10 18 6 6 6 6 6 6 7 7 7 6 6 6 7 6 6 4 4 4 4 8 11
1742
+ 18 15 23 11 9 8 7 7 7 7 7 7 8 15 18 8 10 10 12 8 6 8 6 6 6 7 7 12 10
1743
+ 12 18 11 12 10 19 19 15 15 10 10 9 7 11 7 8 9 10 7 7 6 6 6 6 4 6 7 7 7
1744
+ 7 9 9 9 13 13 9 7 7 7 9 7 7 7 6 6 6 6 8 8 9 8 11 8 7 6 6 6 6 9 7 8 7 7
1745
+ 6 8 6 6 9 10 12 10 13 12 6 6 6 6 6 7 6 6 7 7 7 11 13 11 9 8 6 6 8 6 6
1746
+ 8 12 14 8 8 8 6 13 8 8 8 6 7 8 7 8 9 8 10 6 6 10 11 17 20 16 11 11 7 6
1747
+ 8 8 9 8 6 12 10 7 7 8 8 4
1748
+
1749
+
1750
+ Sequence : 22ak67d6.r1t
1751
+ Is_read
1752
+ Padded
1753
+ Staden_id 19
1754
+ Clipping QUAL 30 292
1755
+ Align_to_SCF 1 668 1 668
1756
+ SCF_File 22ak67d6.r1tSCF
1757
+ Primer Universal_primer
1758
+ Strand Reverse
1759
+ Dye Dye_terminator
1760
+ Template 22ak67d6
1761
+ Clone bK216E10
1762
+ Sequencing_vector "m13mp18"
1763
+ Tag ALUS 35 291
1764
+ Tag DONE 185 185 "AUTO-EDIT: replaced C by g at 185 (terminated, isolated, strong)"
1765
+ Tag DONE 211 211 "AUTO-EDIT: replaced T by g at 211 (terminated, isolated, strong)"
1766
+
1767
+ DNA : 22ak64b1.s1t
1768
+ TGGGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTGAAACACCGTCTCTACTAAA
1769
+ ATAAAAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAGC
1770
+ TGAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAgATCACGCG
1771
+ ACTGCACTCCAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGAC
1772
+ AAGAcCACTAGTACAGTACTTACAGGGTtATTATGATGATTAAATGAGAGAATAGCTGTG
1773
+ AGGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTG
1774
+ TTTCTAATCTGAaAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACC
1775
+ GACCTAAATGTTCAAAGGGAGGTGCTTAATTGGAGCATTATGGGTTGTTAGATCTTTGGG
1776
+ TTGGGAATATTCAACC
1777
+
1778
+ BaseQuality : 22ak64b1.s1t
1779
+ 4 4 8 11 13 20 16 16 16 19 24 32 31 37 37 35 34 29 32 18 32 24 33 33
1780
+ 37 37 37 23 32 11 10 21 17 37 34 34 45 45 45 45 32 29 26 26 28 30 30
1781
+ 33 45 45 49 49 45 43 45 45 45 45 45 37 45 45 45 45 45 45 45 37 37 37
1782
+ 38 32 40 37 41 37 45 32 45 45 44 37 45 30 45 45 33 33 33 33 33 22 37
1783
+ 37 45 45 45 40 37 34 37 37 33 32 32 33 33 33 33 40 40 40 42 40 42 37
1784
+ 37 37 45 45 45 45 45 35 34 34 28 28 18 21 17 17 27 38 38 45 34 34 34
1785
+ 34 34 34 34 34 34 34 34 34 34 34 34 37 34 34 33 33 33 33 28 31 31 36
1786
+ 34 31 36 36 34 33 20 14 8 8 8 8 14 23 27 31 36 33 36 38 30 30 28 28 28
1787
+ 30 30 27 30 30 30 30 33 33 23 21 18 18 17 20 32 37 37 45 45 45 45 34
1788
+ 34 34 45 45 45 44 45 37 45 45 45 37 40 37 37 33 40 44 40 40 36 31 31
1789
+ 28 25 22 27 14 14 8 9 10 8 7 8 7 12 18 18 23 15 9 9 15 15 20 20 25 28
1790
+ 25 21 21 18 18 8 9 8 6 6 8 11 14 28 28 28 30 30 30 30 31 30 31 25 22
1791
+ 22 27 15 15 15 16 13 17 25 25 30 25 27 28 31 24 24 19 24 29 33 27 31
1792
+ 31 31 31 28 27 22 14 15 27 32 40 37 36 36 36 33 33 34 33 27 13 14 7 7
1793
+ 8 18 23 32 32 23 20 20 33 30 27 27 21 14 14 18 21 18 21 15 15 17 11 11
1794
+ 16 24 23 30 23 14 10 13 14 15 10 8 9 16 16 28 4 4 4 10 11 12 9 8 10 14
1795
+ 20 18 19 19 19 10 10 12 15 25 23 26 26 28 18 14 14 16 20 15 14 12 12
1796
+ 12 21 23 25 24 21 17 17 14 21 20 19 12 9 9 8 9 8 10 7 6 9 8 7 8 9 7 7
1797
+ 7 6 6 8 7 8 6 6 6 6 6 13 11 6 6 6 8 10 11 8 9 9 10 10 15 10 11 12 16
1798
+ 13 10 9 7 7 7 7 9 10 8 8 7 6 6 6 6 6 14 10 7 7 7 9 9 10 11 16 16 7 6 4
1799
+ 4 4 8 4
1800
+
1801
+
1802
+ Sequence : 22ak64b1.s1t
1803
+ Is_read
1804
+ Padded
1805
+ Staden_id 8
1806
+ Clipping QUAL 40 416
1807
+ Align_to_SCF 1 496 1 496
1808
+ SCF_File 22ak64b1.s1tSCF
1809
+ Primer Universal_primer
1810
+ Strand Forward
1811
+ Dye Dye_terminator
1812
+ Template 22ak64b1
1813
+ Clone bK216E10
1814
+ Sequencing_vector "m13mp18"
1815
+ Seq_vec SVEC 1 39 "M13mp"
1816
+ Tag CONF 44 44 "AUTOEDIT: possible compression"
1817
+ Tag CONF 96 96 "AUTOEDIT: possible compression"
1818
+ Tag DONE 172 172 "AUTO-EDIT: replaced A by g at 172 (terminated, isolated, strong)"
1819
+ Tag DONE 245 245 "AUTO-EDIT: replaced A by c at 245 (all_stranded, compound, strong)"
1820
+ Tag AMBG 246 246 "AUTOEDIT: Check this edit stack (conflict & possible misassembly))!"
1821
+ Tag DONE 269 269 "AUTO-EDIT: replaced C by t at 269 (all_stranded, isolated, strong)"
1822
+ Tag DONE 373 373 "AUTO-EDIT: replaced N by a at 373 (terminated, isolated, strong)"
1823
+
1824
+ DNA : 22ak81h10.s1t
1825
+ GTGGCATGCCTGCAGGTCAACTCTAAAAGATCCCCTGAAACACCGTCTCTACTAAAATAA
1826
+ AAAGAAATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAgCCACTTGGGAAGCTGAG
1827
+ GCAGGAGAATCGCTTGAACCCGGGAgGTGGAgGTTGCAGTGAGCCGAGATCACGCGACTG
1828
+ CACTCCAGCCCAAcCAATAGTGTGAGACTCTGTCTCGAaaAAaAAAAAGCAgAGACaAGA
1829
+ CCACTAGTACAGTACTTACAGGGTTATTATGATGATTAAaTGAGAGAATAGCTGTGAGGT
1830
+ GATTGATATAGTGCTGTGCTTAATACaAACTATCATTTTATTATACGGGTTGAGTGTTTC
1831
+ TAATCTGAAAATCCaaAATTAGAAATGCTCTACAGTCTGAAACTTTtTTGAGCACCGACC
1832
+ TACTGTGCACAGGAAGTGCTTATTGGAGCATGATGGGTTGTTACATATTTGGGTTGGGAA
1833
+ TATTCACCCAGTAAGTACTATAAAATGCAAATATTCCAACAAG
1834
+
1835
+ BaseQuality : 22ak81h10.s1t
1836
+ 6 6 6 6 6 8 9 16 11 13 21 20 22 22 22 15 14 9 9 9 9 15 18 15 9 9 9 9 9
1837
+ 15 23 36 36 36 36 34 38 40 30 28 28 28 30 32 37 37 36 38 37 44 45 45
1838
+ 49 49 45 45 37 37 38 45 45 45 38 37 37 38 38 37 37 34 34 34 32 32 38
1839
+ 45 49 45 45 45 45 37 33 33 27 27 18 18 30 32 36 36 36 36 36 36 36 34
1840
+ 32 21 18 4 4 4 18 17 27 28 33 36 36 36 49 36 36 36 34 34 45 27 27 30
1841
+ 25 27 12 20 20 34 34 38 37 37 34 34 25 25 18 18 21 29 38 45 21 28 14
1842
+ 14 14 27 21 34 18 17 17 32 27 25 22 13 13 10 18 15 32 32 32 37 28 22
1843
+ 22 21 14 10 10 11 23 22 28 20 14 14 8 8 11 20 20 16 12 16 16 28 21 19
1844
+ 10 10 10 19 18 20 20 14 14 32 32 34 32 25 18 18 18 18 27 32 32 24 24
1845
+ 23 23 14 10 10 10 9 9 10 11 12 12 12 12 17 11 11 11 10 8 6 6 8 8 10 16
1846
+ 16 16 11 14 10 9 9 9 17 11 11 11 14 15 22 18 14 14 11 11 15 27 22 19
1847
+ 23 27 30 28 22 18 16 11 10 10 11 9 10 11 11 12 15 20 27 27 23 21 14 10
1848
+ 10 10 10 14 22 25 22 14 14 22 32 38 34 34 34 31 24 18 14 12 9 10 10 23
1849
+ 18 24 16 16 18 18 18 19 18 17 21 18 18 12 14 21 27 37 34 34 28 28 34
1850
+ 27 27 28 31 20 18 11 9 9 12 11 11 27 15 15 20 23 26 14 8 8 8 8 14 16
1851
+ 23 19 19 28 31 31 31 25 18 11 11 18 10 10 10 10 11 12 16 16 21 23 12
1852
+ 12 13 23 13 13 19 11 10 10 10 10 10 18 21 28 16 19 29 32 19 19 8 8 8
1853
+ 10 10 18 18 22 21 16 18 22 21 11 11 14 14 15 14 18 7 7 7 7 7 7 14 18
1854
+ 10 10 9 9 14 15 15 23 20 22 19 19 21 16 11 11 9 8 8 9 9 18 14 11 9 9
1855
+ 15 8 9 10 8 9 8 8 8 14 14 25 27 16 9 8 14 8 9 17 13 18 15 8 8 7 7 7 7
1856
+ 6 6 6 6 6 4 4 4 8 9 10 17 11 15 12 17 9 9 10 7 7 7 10 11 10 7 7 7 6 6
1857
+ 8 6 6 8 4
1858
+
1859
+
1860
+ Sequence : 22ak81h10.s1t
1861
+ Is_read
1862
+ Padded
1863
+ Staden_id 5
1864
+ Clipping QUAL 36 418
1865
+ Align_to_SCF 1 523 1 523
1866
+ SCF_File 22ak81h10.s1tSCF
1867
+ Primer Universal_primer
1868
+ Strand Forward
1869
+ Dye Dye_terminator
1870
+ Template 22ak81h10
1871
+ Clone bK216E10
1872
+ Sequencing_vector "m13mp18"
1873
+ Seq_vec SVEC 1 35 "M13mp1"
1874
+ Tag ALUS 36 216
1875
+ Tag DONE 103 103 "AUTO-EDIT: replaced N by g at 103 (terminated, isolated, strong)"
1876
+ Tag DONE 146 146 "AUTO-EDIT: replaced T by g at 146 (terminated, isolated, strong)"
1877
+ Tag DONE 152 152 "AUTO-EDIT: replaced A by g at 152 (terminated, isolated, strong)"
1878
+ Tag DONE 194 194 "AUTO-EDIT: replaced G by c at 194 (all_stranded, isolated, strong)"
1879
+ Tag DONE 219 219 "AUTO-EDIT: replaced G by a at 219 (all_stranded, compound, strong)"
1880
+ Tag DONE 220 220 "AUTO-EDIT: replaced C by a at 220 (all_stranded, compound, strong)"
1881
+ Tag DONE 223 223 "AUTO-EDIT: replaced G by a at 223 (all_stranded, isolated, strong)"
1882
+ Tag DONE 232 232 "AUTO-EDIT: replaced C by g at 232 (all_stranded, isolated, strong)"
1883
+ Tag DONE 237 237 "AUTO-EDIT: replaced G by a at 237 (all_stranded, isolated, strong)"
1884
+ Tag DONE 280 280 "AUTO-EDIT: replaced G by a at 280 (terminated, isolated, strong)"
1885
+ Tag DONE 327 327 "AUTO-EDIT: replaced G by a at 327 (terminated, isolated, strong)"
1886
+ Tag DONE 375 375 "AUTO-EDIT: replaced T by a at 375 (terminated, compound, strong)"
1887
+ Tag DONE 376 376 "AUTO-EDIT: replaced C by a at 376 (terminated, compound, strong)"
1888
+ Tag DONE 407 407 "AUTO-EDIT: replaced C by t at 407 (terminated, isolated, strong)"
1889
+
1890
+ DNA : 22ak66c6.s1t
1891
+ nCGTGGCTGCCTGCAGGTCGACTCTAGAGGATCCCCACCGTCTCTACTAAAATAAAAAGA
1892
+ AATTAGCTGGGTGTCGTGGCAGGTGCCTGTAATCCCAGCCACTTGGGAAGCTGAGGCAGG
1893
+ AGAATCGCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATCACGCGACTGCACTC
1894
+ CAGCCCAACCAATAGTGTGAGACTCTGTCTCGAAAAAAAAAAAGCAGAGACAAGACAACT
1895
+ AGTACAGTACTTACAGGGTTATTATGATGATTAAATGAGAGAATAGCTGTGAGGTGATTG
1896
+ ATATAGTGCTGTGCTTAATACAAACTATCATTTTATTATACGGGTTGAGTGTTTCTAATC
1897
+ TGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATG
1898
+ TTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATATTC
1899
+ AACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATtTC
1900
+ TGGTCCTAAGCAAGCATnTTGCAAAGGGATACGCAACCTGTAGTACGTCCTTTATCATTG
1901
+ TnTCAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAnCAnATTCGATTGTA
1902
+ TTATT
1903
+
1904
+ BaseQuality : 22ak66c6.s1t
1905
+ 4 4 8 4 6 10 13 21 24 25 33 33 33 30 27 21 15 27 19 30 30 33 33 30 21
1906
+ 21 10 9 17 11 27 27 37 38 33 35 35 35 35 44 45 45 38 37 37 45 45 45 43
1907
+ 43 43 45 45 45 45 45 45 45 21 21 23 30 30 34 37 37 38 45 32 45 37 41
1908
+ 37 45 30 45 45 34 34 34 32 29 22 32 32 45 45 45 33 28 28 37 37 34 34
1909
+ 34 35 34 34 34 34 34 34 37 37 40 41 37 34 37 37 37 32 24 22 27 29 25
1910
+ 27 20 21 21 21 27 45 41 40 40 40 42 34 34 37 41 45 51 45 45 37 30 37
1911
+ 41 41 37 36 28 30 30 30 22 33 33 35 33 33 41 51 51 45 39 39 39 30 28
1912
+ 33 34 34 39 34 41 34 34 41 33 33 39 39 39 33 33 33 30 33 33 33 30 29
1913
+ 19 19 24 25 32 33 45 36 36 36 36 41 41 30 30 30 37 37 43 51 51 51 51
1914
+ 45 37 37 30 37 37 37 51 51 51 51 51 37 37 28 28 10 10 10 13 10 10 10 9
1915
+ 9 9 21 21 28 37 37 37 33 33 33 33 33 33 34 34 34 33 33 33 33 21 25 25
1916
+ 22 22 29 29 33 33 33 33 31 31 27 28 17 23 23 28 26 24 32 10 10 10 15
1917
+ 15 26 32 32 37 45 45 32 45 33 26 24 32 37 37 35 34 37 35 37 34 37 37
1918
+ 40 37 37 45 45 38 38 45 45 40 37 37 37 34 30 30 28 28 28 30 37 37 34
1919
+ 34 34 34 34 33 31 31 25 21 19 22 21 25 30 32 32 30 22 22 25 28 24 25
1920
+ 26 17 17 23 27 27 33 31 31 34 38 38 38 38 34 26 17 15 8 8 11 16 25 31
1921
+ 32 33 29 26 32 29 33 34 34 34 36 33 34 34 31 27 31 34 38 45 45 36 37
1922
+ 37 37 36 36 38 34 32 28 25 22 22 21 17 18 29 29 23 23 22 27 25 20 18
1923
+ 11 11 15 15 16 23 21 17 19 24 24 24 31 31 31 33 33 33 31 33 33 29 29
1924
+ 29 29 29 31 31 31 23 24 19 12 10 16 10 10 20 10 10 13 15 30 23 29 23
1925
+ 28 18 10 10 16 21 18 19 19 24 24 12 11 9 9 10 21 23 31 31 33 28 28 14
1926
+ 17 17 28 21 30 24 30 28 22 26 23 19 10 10 12 23 22 23 19 12 10 9 9 10
1927
+ 19 24 29 30 34 34 34 34 34 29 25 25 32 26 31 31 32 20 17 15 12 12 4 4
1928
+ 4 17 23 33 30 24 18 13 18 16 12 16 8 9 9 19 15 15 4 4 4 7 11 6 6 6 7 8
1929
+ 9 17 12 13 19 23 25 13 13 13 19 21 29 32 30 26 20 20 12 9 9 8 9 8 8 15
1930
+ 24 17 15 8 8 9 17 16 4 4 4 8 8 13 15 23 14 9 8 8 10 10 17 23 21 17 12
1931
+ 13 22 20 19 15 11 11 9 8 8 8 8 8 8 10 9 9 7 8 8 10 12 10 10 12 4 4 4 4
1932
+ 4 4 10 10 10 10 10 9 8 8 7 8 9 11 9 9 4
1933
+
1934
+
1935
+ Sequence : 22ak66c6.s1t
1936
+ Is_read
1937
+ Padded
1938
+ Staden_id 18
1939
+ Clipping QUAL 37 548
1940
+ Align_to_SCF 1 665 1 665
1941
+ SCF_File 22ak66c6.s1tSCF
1942
+ Primer Universal_primer
1943
+ Strand Forward
1944
+ Dye Dye_terminator
1945
+ Template 22ak66c6
1946
+ Clone bK216E10
1947
+ Sequencing_vector "m13mp18"
1948
+ Seq_vec SVEC 1 36 "M13mp"
1949
+ Tag ALUS 38 221
1950
+ Tag DONE 538 538 "AUTO-EDIT: replaced N by t at 538 (terminated, isolated, strong)"
1951
+
1952
+ DNA : 22ak93c1.s1lt
1953
+ TTTCTTTGGGGGCAATCTTGATGCTAGCGTCGTTCAAGATGATCCACACCCAGCTCACTG
1954
+ TTTTATTCTCTCCAATAATCCTAAGCAAGCTCTCAAAATATAAATATGCTTTTTAATAAT
1955
+ ACAATCGAATTTGCTATACCACCTCAGAATCTGTACCACAATATATTAACTACTTAAAAC
1956
+ AATGATAAAGAACGTACTACAGGTTGCGTATCCCTTTGCAAAATGCTTGCTTAGGACCAG
1957
+ AAATGTTTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTACTGGTTG
1958
+ AATATTCCCAACCCAAAAATCTAACAACCCATAATGCTCCAATAAGCACTTCCTTTGAAC
1959
+ ATTAGGTCGGTGCTCAAAAAAGTTTCAGACTGTAGAGCATTTCTAATTTTGGATTTTCAG
1960
+ ATTAGAAACACTCAACCCGTATAATAAAATGATAGTTTGTATTAAGCACAGCACTATATC
1961
+ AATCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTACTGTACTA
1962
+ gTTGTCTTGTCTCTGCTTTTTTTTTTTCgAgACAGAGTCTCACACTATTGGTTGGGCTGG
1963
+ AATGCAnTCGCGTGATCTCGGCTCACTGGCAACCTCCACCTCCCGGGG
1964
+
1965
+ BaseQuality : 22ak93c1.s1lt
1966
+ 4 4 4 4 4 4 4 4 9 6 4 8 15 11 4 6 4 12 8 9 10 12 11 8 8 6 7 8 14 14 9
1967
+ 4 4 8 8 8 8 8 4 6 8 11 9 10 8 9 9 11 10 9 9 9 9 9 9 16 16 32 23 29 21
1968
+ 27 27 22 22 20 28 32 37 37 34 31 30 28 28 24 29 29 34 34 38 32 32 18
1969
+ 22 18 22 22 28 29 37 37 37 37 35 35 34 34 35 34 37 37 37 37 37 37 34
1970
+ 37 37 37 37 32 32 28 28 31 30 30 30 23 23 23 28 27 21 32 13 13 16 24
1971
+ 32 34 31 30 28 28 28 28 28 34 34 34 34 33 25 16 9 9 10 23 32 33 41 37
1972
+ 34 28 30 30 30 28 28 22 27 25 32 25 30 27 22 24 22 22 28 25 24 30 30
1973
+ 30 30 30 30 24 28 13 10 10 23 20 18 9 9 9 18 23 30 30 30 28 24 19 25
1974
+ 11 11 12 27 31 34 30 30 30 30 37 45 51 41 39 28 28 28 25 25 24 30 34
1975
+ 39 39 39 39 39 39 36 31 13 10 9 10 10 23 23 9 9 13 23 31 31 14 14 31
1976
+ 31 13 9 9 9 23 23 23 13 9 9 9 31 31 41 51 36 31 14 13 31 19 30 31 31
1977
+ 22 34 25 33 33 33 30 24 29 30 18 24 24 11 11 24 24 33 39 34 34 30 30
1978
+ 34 22 22 14 19 18 23 23 17 31 24 37 33 33 33 33 33 28 34 18 18 27 34
1979
+ 34 38 27 20 20 24 24 30 30 39 34 34 30 22 22 24 33 33 33 33 28 24 24
1980
+ 22 30 22 24 24 33 33 33 39 51 51 41 32 27 17 25 17 31 31 34 19 15 10
1981
+ 10 31 14 27 21 30 30 24 24 30 34 39 39 41 36 34 30 30 30 34 31 16 9 9
1982
+ 10 20 19 16 11 9 9 9 13 23 22 28 28 37 33 33 33 28 32 18 13 10 20 18
1983
+ 10 32 21 31 23 14 9 9 9 16 11 9 9 10 20 25 33 30 30 28 32 28 28 37 35
1984
+ 35 34 34 34 34 34 37 40 37 33 32 25 12 10 10 16 16 28 32 32 34 30 28
1985
+ 28 29 31 33 32 28 30 30 25 21 16 19 19 19 27 19 14 14 22 22 28 25 29
1986
+ 29 29 30 30 23 23 21 18 14 21 17 24 19 32 32 37 37 31 30 30 28 31 30
1987
+ 34 34 28 28 28 28 31 31 30 28 28 28 30 30 25 32 10 10 10 23 23 27 17
1988
+ 17 22 17 23 23 23 24 20 17 4 4 4 14 16 24 22 19 18 13 19 9 12 14 25 25
1989
+ 33 32 29 40 38 49 49 49 34 34 17 14 8 7 7 9 9 10 8 7 7 9 10 15 17 18
1990
+ 22 24 18 18 18 22 20 24 24 28 18 19 18 19 21 24 25 14 12 8 8 9 14 12 4
1991
+ 4 4 17 17 17 14 9 9 9 12 21 21 18 12 10 13 10 11 9 12 12 8 7 8 8 9 10
1992
+ 9 15 10 8 9 10 10 21 21 28 27 18 14 7 7
1993
+
1994
+
1995
+ Sequence : 22ak93c1.s1lt
1996
+ Is_read
1997
+ Padded
1998
+ Staden_id 1
1999
+ Clipping QUAL 56 598
2000
+ Align_to_SCF 1 648 1 648
2001
+ SCF_File 22ak93c1.s1ltSCF
2002
+ Primer Universal_primer
2003
+ Strand Forward
2004
+ Dye Dye_primer
2005
+ Template 22ak93c1
2006
+ Clone bK216E10
2007
+ Sequencing_vector "m13mp18"
2008
+ Seq_vec SVEC 1 47 "M13mp18"
2009
+ Tag DONE 541 541 "AUTO-EDIT: replaced N by g at 541 (all_stranded, isolated, strong)"
2010
+ Tag ALUS 559 647
2011
+ Tag DONE 569 569 "AUTO-EDIT: replaced A by g at 569 (all_stranded, isolated, strong)"
2012
+ Tag DONE 571 571 "AUTO-EDIT: replaced A by g at 571 (all_stranded, isolated, strong)"
2013
+
2014
+ DNA : 22ak64e2.s1t
2015
+ GTAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTTTGCAAAATGCTTGCTTA
2016
+ GGACCAGAAATGTTTCAGATTTCAGATTTTTTTTGGAATATTTGCATTTTATAGTACTTA
2017
+ CTGGTTGAATATTCCCAACCCAAAAATCTAACAACCCATAATGCTCCAATAAGCACTTCC
2018
+ TTTGAACATTAGGTCGGTGCTCAAAAAAGTTTCAGACTGTAGAGCATTTCTAATTTTGGA
2019
+ TTTTCAGATTAGAAACACTCAACCCGTATAATAAAATGATAGTTTGTATTAAGCACAGCA
2020
+ CTATATCAATCACCTCACAGCTATTCTCTCATTTAATCATCATAATAACCCTGTAAGTAC
2021
+ TGTACTAGTTGTCTTGTCTCTGCTTTTTTTTTTTCGAGACAGAGTCTCACACTATTGGTT
2022
+ GGACTGGAGTGCAATTCnCCTGAATTCGGCTCACGGCAACTTCAACCTCCCGGGTTCAAG
2023
+ TGAATCTCCTC
2024
+
2025
+ BaseQuality : 22ak64e2.s1t
2026
+ 4 4 8 10 12 15 18 18 28 30 30 30 30 26 37 34 30 30 22 22 20 23 16 11
2027
+ 11 18 23 23 23 28 9 9 10 9 21 12 32 34 45 45 45 45 38 30 30 30 30 30
2028
+ 28 34 30 33 33 33 33 33 43 45 45 32 18 10 11 11 25 23 10 10 22 32 38
2029
+ 37 27 27 27 23 20 9 9 10 23 25 25 21 9 9 10 29 32 45 45 45 45 45 45 37
2030
+ 37 37 38 45 37 41 28 29 28 28 28 28 34 34 33 33 33 28 28 34 33 34 34
2031
+ 34 34 34 34 45 37 37 29 37 37 45 45 45 45 42 37 34 35 35 35 34 34 34
2032
+ 34 34 37 37 37 45 45 35 35 35 35 35 35 35 37 37 37 37 45 37 42 42 33
2033
+ 30 30 33 33 33 40 34 34 34 34 34 34 40 40 40 37 37 37 34 34 34 34 34
2034
+ 31 31 27 28 19 21 19 28 28 30 32 34 34 31 31 31 33 39 27 20 7 7 8 8 14
2035
+ 15 11 11 17 28 23 28 17 9 9 11 23 27 33 33 40 40 40 40 40 40 40 37 32
2036
+ 32 31 31 28 37 30 33 25 21 13 13 14 26 22 11 11 21 21 30 33 31 31 33
2037
+ 37 37 37 45 49 45 40 40 40 40 40 45 40 40 40 40 40 31 29 29 32 27 37
2038
+ 37 45 45 45 40 37 37 37 37 37 33 34 33 33 30 30 34 34 36 36 36 30 30
2039
+ 28 28 28 27 38 38 36 31 33 32 27 20 20 20 28 32 33 24 24 29 36 34 30
2040
+ 33 30 26 26 26 30 30 26 37 36 34 33 30 31 31 28 27 27 25 24 29 33 27
2041
+ 27 31 31 31 31 33 36 38 38 32 32 21 13 13 16 19 19 24 25 33 30 33 33
2042
+ 33 38 39 40 44 40 40 36 33 37 40 40 40 40 49 40 36 33 31 26 23 23 21
2043
+ 18 20 14 12 11 14 17 25 31 33 33 33 36 30 30 30 30 30 28 28 20 15 14 4
2044
+ 4 4 12 9 9 4 4 4 7 8 7 7 7 7 4 4 4 7 8 10 7 6 9 9 9 7 7 11 17 19 9 8 7
2045
+ 7 8 7 8 9 7 6 10 6 7 6 6 7 7 8 8 8 12 13 8 8 8 8 10 10 9 8 7 6 6 8 13
2046
+ 7 7 7 7
2047
+
2048
+
2049
+ Sequence : 22ak64e2.s1t
2050
+ Is_read
2051
+ Padded
2052
+ Staden_id 14
2053
+ Clipping QUAL 41 420
2054
+ Align_to_SCF 1 491 1 491
2055
+ SCF_File 22ak64e2.s1tSCF
2056
+ Primer Universal_primer
2057
+ Strand Forward
2058
+ Dye Dye_terminator
2059
+ Template 22ak64e2
2060
+ Clone bK216E10
2061
+ Sequencing_vector "m13mp18"
2062
+ Seq_vec SVEC 1 40 "M13mp"
2063
+
2064
+ DNA : 22ak70f10.s1t
2065
+ TTGGCTGCCTGCAGGTCGACTCTAGAGGATCCCCCAGGGTTATTATGATGATTAAATGAG
2066
+ AGAATAGCTGTGAGGTGATTGATATAGTGCTGTGCTTAATACAAACTATCATTTTATTAT
2067
+ ACGGGTTGAGTGTTTCTAATCTGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACT
2068
+ TTTTTGAGCACCGACCTAATGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAG
2069
+ ATTTTTGGGTTGGGAATATTCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAA
2070
+ ATCTGAAATCTGAAACATTTCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCT
2071
+ GTAGTACGTTCTTTATCATTGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGT
2072
+ GGTATAGCAAATTCGATTGTATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAG
2073
+ GATTATTGGAGAGAATAAAACAGTGAAGCTTTGGTGTTATGAGGGAATnTTAGATAGAAA
2074
+ AGTGCAGTnTTTCAGTTCATGCTCTnTCATTTnTTACTCCCTCCGGTTAAAGCTGAAGCT
2075
+ CAACAAAGATATAGTGATCTCTGTGGGCATTATAATCCTGTCCC
2076
+
2077
+ BaseQuality : 22ak70f10.s1t
2078
+ 4 4 6 8 8 9 19 23 33 33 34 33 27 21 18 27 18 27 27 34 34 31 27 23 13
2079
+ 11 19 16 31 31 37 45 45 34 34 31 31 22 31 25 31 37 45 45 45 45 37 37
2080
+ 37 37 37 37 45 37 37 37 45 38 29 27 27 32 32 37 45 33 37 37 45 37 45
2081
+ 45 37 37 37 40 40 40 37 45 37 37 34 33 33 34 34 34 37 33 40 37 37 37
2082
+ 33 33 33 33 33 33 33 33 33 32 33 41 41 35 35 35 40 40 36 36 36 34 33
2083
+ 33 37 37 37 37 37 41 45 30 30 41 41 37 28 45 18 18 29 35 37 37 37 37
2084
+ 41 41 51 51 51 51 51 33 33 33 33 33 33 45 45 45 41 39 39 51 51 41 45
2085
+ 45 45 45 35 33 33 33 33 33 40 51 51 51 51 51 51 51 51 51 43 45 39 34
2086
+ 30 30 33 33 33 33 45 45 38 38 38 38 33 30 29 14 15 27 27 30 33 51 51
2087
+ 41 41 37 34 37 37 37 40 40 40 37 45 51 33 33 33 33 33 33 37 37 31 45
2088
+ 33 25 22 27 21 28 33 28 28 33 41 37 45 41 33 45 33 22 22 33 33 34 44
2089
+ 44 45 45 33 33 33 33 33 30 34 34 34 34 37 37 29 34 37 33 33 33 33 33
2090
+ 33 34 40 33 33 33 30 30 30 37 37 37 30 30 33 30 33 33 49 49 45 45 45
2091
+ 45 45 45 44 38 38 38 44 38 45 45 49 40 40 35 35 35 35 38 37 40 37 37
2092
+ 34 34 34 34 34 34 34 36 36 36 34 36 33 31 31 36 33 28 28 27 23 19 17
2093
+ 17 23 23 23 33 27 28 28 28 30 33 40 40 31 31 17 20 20 28 32 25 17 17
2094
+ 32 27 37 37 36 33 33 33 33 32 36 34 28 30 32 31 31 14 18 10 9 9 19 21
2095
+ 30 31 38 38 38 37 37 31 34 34 36 31 30 31 31 31 31 33 33 33 39 30 25
2096
+ 24 24 29 33 33 34 33 33 23 23 12 23 23 30 33 33 37 37 37 38 40 37 34
2097
+ 33 37 36 33 33 33 33 33 33 36 28 28 22 24 24 24 21 29 33 33 33 34 33
2098
+ 33 33 33 33 33 33 33 33 27 28 28 31 31 23 27 19 15 11 20 21 33 33 31
2099
+ 31 31 31 31 26 28 24 24 24 29 24 29 29 33 27 31 27 30 36 29 18 20 12
2100
+ 17 9 9 9 19 19 15 8 8 13 15 14 8 9 9 9 10 12 4 4 4 9 10 11 12 24 26 18
2101
+ 13 13 11 11 13 10 16 14 13 12 4 4 4 17 11 7 7 8 7 8 8 8 20 20 26 16 14
2102
+ 4 4 4 8 8 10 18 4 4 4 8 8 21 11 13 10 8 10 6 6 6 6 6 8 9 12 14 17 11
2103
+ 14 14 8 8 8 7 9 7 8 8 12 9 9 8 8 7 10 10 12 10 9 8 16 9 8 8 8 7 6 6 8
2104
+ 6 6 6 6 6 6 6 9 12 7 7 8 8 7 7 7 12 8 7 7
2105
+
2106
+
2107
+ Sequence : 22ak70f10.s1t
2108
+ Is_read
2109
+ Padded
2110
+ Staden_id 2
2111
+ Clipping QUAL 35 508
2112
+ Align_to_SCF 1 644 1 644
2113
+ SCF_File 22ak70f10.s1tSCF
2114
+ Primer Universal_primer
2115
+ Strand Forward
2116
+ Dye Dye_terminator
2117
+ Template 22ak70f10
2118
+ Clone bK216E10
2119
+ Sequencing_vector "m13mp18"
2120
+ Seq_vec SVEC 1 34 "M13mp1"
2121
+ Seq_vec SVEC 584 644 "M13mp1"
2122
+
2123
+ DNA : 22ak92c4.s1t
2124
+ nGGGCGCTGCCTGCAGGTCGACTCTAnAGGATCCCCATTATACGGGTTGAGTGTTTCTAA
2125
+ TCTGAAAATCCAAAATTAGAAATGCTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAA
2126
+ TGTTCAAAGGAAGTGCTTATTGGAGCATTATGGGTTGTTAGATTTTTGGGTTGGGAATAT
2127
+ TCAACCAGTAAGTACTATAAAATGCAAATATTCCAAAAAAAATCTGAAATCTGAAACATT
2128
+ TCTGGTCCTAAGCAAGCATTTTGCAAAGGGATACGCAACCTGTAGTACGTTCTTTATCAT
2129
+ TGTTTTAAGTAGTTAATATATTGTGGTACAGATTCTGAGGTGGTATAGCAAATTCGATTG
2130
+ TATTATTAAAAAGCATATTTATATTTTGAGAGCTTGCTTAGGATTATTGGAGAGAATAAA
2131
+ ACAGTGAAGCTTTGGTGTTATGAGGGAATTTTAGATAGAAAAGTGCAGTTTTTCAGTTCA
2132
+ TGCTCTTTCATTTC
2133
+
2134
+ BaseQuality : 22ak92c4.s1t
2135
+ 4 4 6 4 6 8 11 14 18 26 32 34 36 34 23 25 10 23 9 23 23 34 29 23 22 4
2136
+ 4 4 16 14 25 24 29 33 30 33 33 33 33 40 37 40 45 28 28 25 15 18 32 32
2137
+ 17 14 28 13 13 38 38 40 40 37 37 37 37 38 45 45 45 38 33 32 33 33 33
2138
+ 33 38 38 38 45 32 30 45 32 34 34 34 34 40 33 33 32 32 28 28 38 45 45
2139
+ 49 45 45 45 45 40 37 41 45 45 40 30 30 33 33 33 33 40 40 45 45 45 45
2140
+ 32 32 28 11 12 27 25 33 33 45 41 33 32 14 14 28 33 37 37 37 37 37 45
2141
+ 45 37 37 37 37 37 37 37 37 28 33 32 21 14 32 20 24 32 21 21 32 36 41
2142
+ 41 45 32 32 28 13 13 33 33 45 51 51 41 37 32 32 32 32 32 32 34 34 30
2143
+ 30 31 32 12 12 27 31 30 35 35 35 33 39 41 28 28 28 28 28 28 41 41 41
2144
+ 30 32 30 30 30 32 51 51 51 51 45 45 45 45 45 45 45 45 51 45 45 45 45
2145
+ 33 33 33 33 33 33 51 51 51 51 51 41 41 45 45 45 39 39 39 39 39 39 41
2146
+ 41 41 41 40 33 33 33 33 33 33 41 45 41 41 41 41 33 33 33 33 33 33 51
2147
+ 51 45 34 22 22 20 28 30 17 15 15 45 30 33 33 33 33 33 33 33 33 37 37
2148
+ 32 33 33 25 25 9 10 9 14 14 33 33 34 34 41 40 40 40 40 37 40 37 37 34
2149
+ 33 33 29 24 22 32 32 45 45 40 27 27 14 32 32 45 38 34 45 19 21 10 21
2150
+ 21 30 37 37 34 34 37 38 38 37 37 37 37 37 35 34 36 36 40 40 49 34 34
2151
+ 34 34 37 37 38 37 33 30 30 30 30 30 40 40 34 34 34 27 27 31 31 33 35
2152
+ 33 30 30 21 21 12 30 28 36 40 36 36 36 33 33 26 26 21 19 20 29 30 36
2153
+ 34 34 33 31 28 28 32 35 32 35 26 30 25 26 26 25 21 19 12 11 19 21 23
2154
+ 21 11 13 17 17 24 29 27 29 29 28 31 20 25 18 16 12 14 23 21 11 11 16
2155
+ 14 10 21 23 33 33 34 31 31 22 22 14 21 11 16 18 31 40 40 36 36 24 27
2156
+ 19 19 13 16 10 8
2157
+
2158
+ Sequence : 22ak92c4.s1t
2159
+ Is_read
2160
+ Padded
2161
+ Staden_id 16
2162
+ Clipping QUAL 37 490
2163
+ Align_to_SCF 1 494 1 494
2164
+ SCF_File 22ak92c4.s1tSCF
2165
+ Primer Universal_primer
2166
+ Strand Forward
2167
+ Dye Dye_terminator
2168
+ Template 22ak92c4
2169
+ Clone bK216E10
2170
+ Sequencing_vector "m13mp18"
2171
+ Seq_vec SVEC 1 36 "M13mp1"
2172
+
2173
+ DNA : 22ap08f1.s1t
2174
+ GAACTATCATnnnATATACGGGTTGAGTGTnTCTAATCTGAAAATCCAAAATTAGAAATG
2175
+ CTCTACAGTCTGAAACTTTTTTGAGCACCGACCTAATGTTCAAAGGAAGTGCTTATTGGA
2176
+ GCATTATGGGTTGTTAgATTTTTGGGTtGGGAATATTCAACCATTAAGCTACACACAATG
2177
+ CAAATATCCCACAAACAATCTGAAATCTGAAACACTTCTGGTCCAAGCAAGCATCCGCAA
2178
+ CGGATACGCAACCTGCACACGTTCTTATCATCGTTAACTCTnATATATGTGGACAAATCT
2179
+ GACGTGGTACACACACTCATGTATATCACAACATATTACATTTGAAGCTGCTACGAATAT
2180
+ GGAAGAATnnnnCCTGAACTTGGTGTATGACGAACTTAGATAGACAGTGACTCTTCAGTT
2181
+ CAGCTCnTCATTTnTnnTCCCTCGGTTTTnCTAAnCnCnnCnnAAAAnnnnATCCnGTGG
2182
+ GCATAAAnnCnGGTCCCACCGCCCCCnCCCCACAAAACCACACACTACCGACCTCCCAA
2183
+
2184
+ BaseQuality : 22ap08f1.s1t
2185
+ 7 9 10 13 14 16 21 15 14 4 4 4 4 4 11 11 20 26 28 28 30 30 30 25 25 20
2186
+ 25 23 28 4 4 4 18 18 18 21 24 31 33 34 33 34 34 40 30 31 30 24 24 24
2187
+ 31 27 30 31 30 23 32 32 37 36 38 34 33 24 18 15 10 8 8 18 25 32 33 34
2188
+ 31 31 33 29 21 12 9 7 8 11 13 18 22 25 25 33 33 32 29 22 27 24 25 16 9
<