spacr 0.2.5__py3-none-any.whl → 0.2.8__py3-none-any.whl

spacr/settings.py

@@ -3,8 +3,8 @@ import os, ast
 def set_default_plot_merge_settings():
     settings = {}
     settings.setdefault('include_noninfected', True)
-    settings.setdefault('include_multiinfected', True)
-    settings.setdefault('include_multinucleated', True)
+    settings.setdefault('include_multiinfected', 10)
+    settings.setdefault('include_multinucleated', 1)
     settings.setdefault('remove_background', False)
     settings.setdefault('filter_min_max', None)
     settings.setdefault('channel_dims', [0,1,2,3])
@@ -20,7 +20,7 @@ def set_default_plot_merge_settings():
     settings.setdefault('normalize', True)
     settings.setdefault('print_object_number', True)
     settings.setdefault('nr', 1)
-    settings.setdefault('figuresize', 50)
+    settings.setdefault('figuresize', 10)
     settings.setdefault('cmap', 'inferno')
     settings.setdefault('verbose', True)
     return settings
@@ -70,7 +70,7 @@ def set_default_settings_preprocess_generate_masks(src, settings={}):
     
     # Plot settings
     settings.setdefault('plot', False)
-    settings.setdefault('figuresize', 50)
+    settings.setdefault('figuresize', 10)
     settings.setdefault('cmap', 'inferno')
     settings.setdefault('normalize', True)
     settings.setdefault('normalize_plots', True)
@@ -116,7 +116,7 @@ def set_default_settings_preprocess_img_data(settings):
     skip_mode = settings.setdefault('skip_mode', False)
 
     cmap = settings.setdefault('cmap', 'inferno')
-    figuresize = settings.setdefault('figuresize', 50)
+    figuresize = settings.setdefault('figuresize', 10)
     normalize = settings.setdefault('normalize', True)
     save_dtype = settings.setdefault('save_dtype', 'uint16')
     
@@ -189,7 +189,7 @@ def set_default_umap_image_settings(settings={}):
     settings.setdefault('remove_cluster_noise', True)
     settings.setdefault('remove_highly_correlated', True)
     settings.setdefault('log_data', False)
-    settings.setdefault('figuresize', 60)
+    settings.setdefault('figuresize', 10)
     settings.setdefault('black_background', True)
     settings.setdefault('remove_image_canvas', False)
     settings.setdefault('plot_outlines', True)
@@ -277,7 +277,7 @@ def get_measure_crop_settings(settings):
 
 def set_default_analyze_screen(settings):
     settings.setdefault('src', 'path')
-    settings.setdefault('model_type','xgboost')
+    settings.setdefault('model_type_ml','xgboost')
     settings.setdefault('heatmap_feature','predictions')
     settings.setdefault('grouping','mean')
     settings.setdefault('min_max','allq')
@@ -314,7 +314,6 @@ def set_default_train_test_model(settings):
     settings.setdefault('batch_size',64)
     settings.setdefault('epochs',100)
     settings.setdefault('val_split',0.1)
-    settings.setdefault('train_mode','erm')
     settings.setdefault('learning_rate',0.001)
     settings.setdefault('weight_decay',0.00001)
     settings.setdefault('dropout_rate',0.1)
@@ -324,14 +323,90 @@ def set_default_train_test_model(settings):
     settings.setdefault('gradient_accumulation',True)
     settings.setdefault('gradient_accumulation_steps',4)
     settings.setdefault('intermedeate_save',True)
-    settings.setdefault('pin_memory',True)
+    settings.setdefault('pin_memory',False)
     settings.setdefault('n_jobs',cores)
-    settings.setdefault('channels',['r','g','b'])
+    settings.setdefault('train_channels',['r','g','b'])
     settings.setdefault('augment',False)
     settings.setdefault('verbose',False)
     return settings
 
+def set_generate_training_dataset_defaults(settings):
+
+    settings.setdefault('src','path')
+    settings.setdefault('dataset_mode','metadata')
+    settings.setdefault('annotation_column','test')
+    settings.setdefault('annotated_classes',[1,2])
+    settings.setdefault('classes',['nc','pc'])
+    settings.setdefault('size',224)
+    settings.setdefault('test_split',0.1)
+    settings.setdefault('class_metadata',[['c1'],['c2']])
+    settings.setdefault('metadata_type_by','col')
+    settings.setdefault('channel_of_interest',3)
+    settings.setdefault('custom_measurement',None)
+    settings.setdefault('tables',None)
+    settings.setdefault('png_type','cell_png')
+    
+    return settings
+
+def deep_spacr_defaults(settings):
+    
+    cores = os.cpu_count()-4
+    
+    settings.setdefault('src','path')
+    settings.setdefault('dataset_mode','metadata')
+    settings.setdefault('annotation_column','test')
+    settings.setdefault('annotated_classes',[1,2])
+    settings.setdefault('classes',['nc','pc'])
+    settings.setdefault('size',224)
+    settings.setdefault('test_split',0.1)
+    settings.setdefault('class_metadata',[['c1'],['c2']])
+    settings.setdefault('metadata_type_by','col')
+    settings.setdefault('channel_of_interest',3)
+    settings.setdefault('custom_measurement',None)
+    settings.setdefault('tables',None)
+    settings.setdefault('png_type','cell_png')
+    settings.setdefault('custom_model',False)
+    settings.setdefault('custom_model_path','path')
+    settings.setdefault('train',True)
+    settings.setdefault('test',False)
+    settings.setdefault('model_type','maxvit_t')
+    settings.setdefault('optimizer_type','adamw')
+    settings.setdefault('schedule','reduce_lr_on_plateau') #reduce_lr_on_plateau, step_lr
+    settings.setdefault('loss_type','focal_loss') # binary_cross_entropy_with_logits
+    settings.setdefault('normalize',True)
+    settings.setdefault('image_size',224)
+    settings.setdefault('batch_size',64)
+    settings.setdefault('epochs',100)
+    settings.setdefault('val_split',0.1)
+    settings.setdefault('learning_rate',0.001)
+    settings.setdefault('weight_decay',0.00001)
+    settings.setdefault('dropout_rate',0.1)
+    settings.setdefault('init_weights',True)
+    settings.setdefault('amsgrad',True)
+    settings.setdefault('use_checkpoint',True)
+    settings.setdefault('gradient_accumulation',True)
+    settings.setdefault('gradient_accumulation_steps',4)
+    settings.setdefault('intermedeate_save',True)
+    settings.setdefault('pin_memory',False)
+    settings.setdefault('n_jobs',cores)
+    settings.setdefault('train_channels',['r','g','b'])
+    settings.setdefault('augment',False)
+    settings.setdefault('preload_batches', 3)
+    settings.setdefault('verbose',True)
+    settings.setdefault('apply_model_to_dataset',True)
+    settings.setdefault('file_metadata',None)
+    settings.setdefault('sample',None)
+    settings.setdefault('experiment','exp.')
+    settings.setdefault('score_threshold',0.5)
+    settings.setdefault('tar_path','path')
+    settings.setdefault('model_path','path')
+    settings.setdefault('file_type','cell_png')
+    settings.setdefault('generate_training_dataset', True)
+    settings.setdefault('train_DL_model', True)
+    return settings
+
 def get_analyze_recruitment_default_settings(settings):
+    settings.setdefault('src','path')
     settings.setdefault('target','protein')
     settings.setdefault('cell_types',['HeLa'])
     settings.setdefault('cell_plate_metadata',None)
@@ -351,12 +426,10 @@ def get_analyze_recruitment_default_settings(settings):
     settings.setdefault('plot',True)
     settings.setdefault('plot_nr',10)
     settings.setdefault('plot_control',True)
-    settings.setdefault('figuresize',20)
-    settings.setdefault('remove_background',False)
-    settings.setdefault('backgrounds',100)
+    settings.setdefault('figuresize',10)
     settings.setdefault('include_noninfected',True)
-    settings.setdefault('include_multiinfected',True)
-    settings.setdefault('include_multinucleated',True)
+    settings.setdefault('include_multiinfected',10)
+    settings.setdefault('include_multinucleated',1)
     settings.setdefault('cells_per_well',0)
     settings.setdefault('pathogen_size_range',[0,100000])
     settings.setdefault('nucleus_size_range',[0,100000])
@@ -368,6 +441,7 @@ def get_analyze_recruitment_default_settings(settings):
     return settings
 
 def get_analyze_reads_default_settings(settings):
+    settings.setdefault('src', 'path')
     settings.setdefault('upstream', 'CTTCTGGTAAATGGGGATGTCAAGTT') 
     settings.setdefault('downstream', 'GTTTAAGAGCTATGCTGGAAACAGCAG') #This is the reverce compliment of the column primer starting from the end #TGCTGTTTAAGAGCTATGCTGGAAACAGCA
     settings.setdefault('barecode_length_1', 8)
@@ -380,7 +454,7 @@ def get_map_barcodes_default_settings(settings):
     settings.setdefault('src', 'path')
     settings.setdefault('grna', '/home/carruthers/Documents/grna_barcodes.csv')
     settings.setdefault('barcodes', '/home/carruthers/Documents/SCREEN_BARCODES.csv')
-    settings.setdefault('plate_dict', {'EO1': 'plate1', 'EO2': 'plate2', 'EO3': 'plate3', 'EO4': 'plate4', 'EO5': 'plate5', 'EO6': 'plate6', 'EO7': 'plate7', 'EO8': 'plate8'})
+    settings.setdefault('plate_dict', "{'EO1': 'plate1', 'EO2': 'plate2', 'EO3': 'plate3', 'EO4': 'plate4', 'EO5': 'plate5', 'EO6': 'plate6', 'EO7': 'plate7', 'EO8': 'plate8'}")
     settings.setdefault('test', False)
     settings.setdefault('verbose', True)
     settings.setdefault('pc', 'TGGT1_220950_1')
@@ -506,7 +580,7 @@ expected_types = {
     "timelapse": bool,
     "timelapse_displacement": int,
     "timelapse_memory": int,
-    "timelapse_frame_limits": list,  # This can be a list of lists
+    "timelapse_frame_limits": (list, type(None)),  # This can be a list of lists
     "timelapse_remove_transient": bool,
     "timelapse_mode": str,
     "timelapse_objects": list,
@@ -533,7 +607,7 @@ expected_types = {
     "save_png": bool,
     "crop_mode": list,
     "use_bounding_box": bool,
-    "png_size": list,  # This can be a list of lists
+    "png_size": list,  # This can be a list of lists 
     "normalize": bool,
     "png_dims": list,
     "normalize_by": str,
@@ -545,7 +619,7 @@ expected_types = {
     "cells": list,
     "cell_loc": list,
     "pathogens": list,
-    "pathogen_loc": (list, list),  # This can be a list of lists
+    "pathogen_loc": (list, list),  # This can be a list of lists 
     "treatments": list,
     "treatment_loc": (list, list),  # This can be a list of lists
     "channel_of_interest": int,
@@ -553,10 +627,9 @@ expected_types = {
     "measurement": str,
     "nr_imgs": int,
     "um_per_pixel": (int, float),
-    # Additional settings based on provided defaults
     "include_noninfected": bool,
-    "include_multiinfected": bool,
-    "include_multinucleated": bool,
+    "include_multiinfected": int,
+    "include_multinucleated": int,
     "filter_min_max": (list, type(None)),
     "channel_dims": list,
     "backgrounds": list,
@@ -650,7 +723,6 @@ expected_types = {
     "image_size": int,
     "epochs": int,
     "val_split": float,
-    "train_mode": str,
     "learning_rate": float,
     "weight_decay": float,
     "dropout_rate": float,
@@ -665,9 +737,9 @@ expected_types = {
     "augment": bool,
     "target": str,
     "cell_types": list,
-    "cell_plate_metadata": (list, type(None)),
+    "cell_plate_metadata": (list, list),
     "pathogen_types": list,
-    "pathogen_plate_metadata": (list, list),  # This can be a list of lists
+    "pathogen_plate_metadata": (list, list),  # This can be a list of lists 
     "treatment_plate_metadata": (list, list),  # This can be a list of lists
     "metadata_types": list,
     "cell_chann_dim": int,
@@ -720,10 +792,71 @@ expected_types = {
     "from_scratch": bool,
     "width_height": list,
     "resize": bool,
+    "compression": str,
+    "complevel": int,
     "gene_weights_csv": str,
     "fraction_threshold": float,
+    "barcode_mapping":dict,
+    "redunction_method":str,
+    "mix":str,
+    "model_type_ml":str,
+    "exclude_conditions":list,
+    "remove_highly_correlated_features":bool,
+    'barcode_coordinates':list,  # This is a list of lists 
+    'reverse_complement':bool,
+    'file_type':str,
+    'model_path':str,
+    'tar_path':str,
+    'score_threshold':float,
+    'sample':None,
+    'file_metadata':None,
+    'apply_model_to_dataset':False,
+    "train":bool,
+    "test":bool,
+    'train_channels':list,
+    "optimizer_type":str,
+    "dataset_mode":str,
+    "annotated_classes":list,
+    "annotation_column":str,
+    "apply_model_to_dataset":bool,
+    "metadata_type_by":str,
+    "custom_measurement":str,
+    "custom_model":bool,
+    "size":int,
+    "test_split":float,
+    "class_metadata":list, # This is a list of lists 
+    "png_type":str,
+    "custom_model_path":str,
+    "generate_training_dataset":bool,
+    'preload_batches':int,
+    "train_DL_model":bool,
 }
 
+categories = {"General": ["src", "metadata_type", "custom_regex", "experiment", "channels", "magnification", "channel_dims", "apply_model_to_dataset", "generate_training_dataset", "train_DL_model"],
+             "Cell": ["cell_intensity_range", "cell_size_range", "cell_chann_dim", "cell_channel", "cell_background", "cell_Signal_to_noise", "cell_CP_prob", "cell_FT", "remove_background_cell", "cell_min_size", "cell_mask_dim", "cytoplasm", "cytoplasm_min_size", "include_uninfected", "merge_edge_pathogen_cells", "adjust_cells"],
+             "Nucleus": ["nucleus_intensity_range", "nucleus_size_range", "nucleus_chann_dim", "nucleus_channel", "nucleus_background", "nucleus_Signal_to_noise", "nucleus_CP_prob", "nucleus_FT", "remove_background_nucleus", "nucleus_min_size", "nucleus_mask_dim", "nucleus_loc"],
+             "Pathogen": ["pathogen_intensity_range", "pathogen_size_range", "pathogen_chann_dim", "pathogen_channel", "pathogen_background", "pathogen_Signal_to_noise", "pathogen_CP_prob", "pathogen_FT", "pathogen_model", "remove_background_pathogen", "pathogen_min_size", "pathogen_mask_dim"],
+             "Timelapse": ["fps", "timelapse_displacement", "timelapse_memory", "timelapse_frame_limits", "timelapse_remove_transient", "timelapse_mode", "timelapse_objects", "compartments"],
+             "Plot": ["plot_control", "plot_nr", "examples_to_plot", "normalize_plots", "normalize", "cmap", "figuresize", "plot_cluster_grids", "img_zoom", "row_limit", "color_by", "plot_images", "smooth_lines", "plot_points", "plot_outlines", "black_background", "plot_by_cluster", "heatmap_feature","grouping","min_max","cmap","save_figure"],
+             "Measurements": ["remove_image_canvas", "remove_highly_correlated", "homogeneity", "homogeneity_distances", "radial_dist", "calculate_correlation", "manders_thresholds", "save_measurements", "tables", "image_nr", "dot_size", "filter_by", "remove_highly_correlated_features", "remove_low_variance_features", "channel_of_interest"],
+             "Paths":["grna", "barcodes", "custom_model_path", "tar_path","model_path"],
+             "Sequencing": ["upstream", "downstream", "barecode_length_1", "barecode_length_2", "chunk_size", "barcode_mapping", "reverse_complement", "barcode_coordinates", "complevel", "compression","plate_dict"],
+             "Embedding": ["visualize","n_neighbors","min_dist","metric","resnet_features","reduction_method","embedding_by_controls","col_to_compare","log_data"],
+             "Clustering": ["eps","min_samples","analyze_clusters","clustering","remove_cluster_noise"],
+             "Object Image": ["save_png", "dialate_pngs", "dialate_png_ratios", "png_size", "png_dims", "save_arrays", "normalize_by", "dialate_png_ratios", "crop_mode", "dialate_pngs", "normalize", "use_bounding_box"],
+             "Annotation": ["nc_loc", "pc_loc", "nc", "pc", "cell_plate_metadata","pathogen_types", "pathogen_plate_metadata", "treatment_plate_metadata", "metadata_types", "cell_types", "target","positive_control","negative_control", "location_column", "treatment_loc", "cells", "cell_loc", "pathogens", "pathogen_loc", "channel_of_interest", "measurement", "treatments", "um_per_pixel", "nr_imgs", "exclude", "exclude_conditions", "mix", "pos", "neg"],
+             "Machine Learning":[],
+             "Deep Learning": ["png_type","score_threshold","file_type", "train_channels", "epochs", "loss_type", "optimizer_type","image_size","val_split","learning_rate","weight_decay","dropout_rate", "init_weights", "train", "classes", "augment"],
+             "Generate Dataset":["preload_batches", "file_metadata","class_metadata", "annotation_column","annotated_classes", "dataset_mode", "metadata_type_by","custom_measurement", "sample", "size"],
+             "Cellpose":["from_scratch", "n_epochs", "width_height", "model_name", "custom_model", "resample", "rescale", "CP_prob", "flow_threshold", "percentiles", "circular", "invert", "diameter", "grayscale", "background", "Signal_to_noise", "resize", "target_height", "target_width"],
+             "Regression":["class_1_threshold", "plate", "other", "fraction_threshold", "alpha", "remove_row_column_effect", "regression_type", "min_cell_count", "agg_type", "transform", "dependent_variable", "gene_weights_csv"],
+             "Miscellaneous": ["all_to_mip", "pick_slice", "skip_mode", "upscale", "upscale_factor"],
+             "Test": ["test_mode", "test_images", "random_test", "test_nr", "test", "test_split"],
+             "Advanced": ["target_intensity_min", "cells_per_well", "include_multinucleated", "include_multiinfected", "include_noninfected", "backgrounds", "plot", "timelapse", "schedule", "test_size","exclude","n_repeats","top_features", "model_type_ml", "model_type","minimum_cell_count","n_estimators","preprocess", "remove_background", "normalize", "lower_percentile", "merge_pathogens", "batch_size", "filter", "save", "masks", "verbose", "randomize", "n_jobs", "amsgrad","use_checkpoint","gradient_accumulation","gradient_accumulation_steps","intermedeate_save","pin_memory"]
+             }
+
+category_keys = list(categories.keys())
+
 def check_settings(vars_dict, expected_types, q=None):
     from .gui_utils import parse_list
 
@@ -735,7 +868,7 @@ def check_settings(vars_dict, expected_types, q=None):
 
     for key, (label, widget, var, _) in vars_dict.items():
         if key not in expected_types:
-            if key not in ["General", "Nucleus", "Cell", "Pathogen", "Timelapse", "Plot", "Object Image", "Annotate Data", "Measurements", "Advanced", "Miscellaneous", "Test"]:
+            if key not in category_keys:
                 q.put(f"Key {key} not found in expected types.")
                 continue
 
@@ -743,13 +876,15 @@ def check_settings(vars_dict, expected_types, q=None):
         expected_type = expected_types.get(key, str)
 
         try:
-            if key in ["png_size", "pathogen_plate_metadata", "treatment_plate_metadata"]:
+            if key in ["cell_plate_metadata", "timelapse_frame_limits", "png_size", "pathogen_loc", "treatment_loc", "pathogen_plate_metadata", "treatment_plate_metadata", "barcode_coordinates", "class_metadata"]:
                 parsed_value = ast.literal_eval(value) if value else None
                 if isinstance(parsed_value, list):
                     if all(isinstance(i, list) for i in parsed_value) or all(not isinstance(i, list) for i in parsed_value):
                         settings[key] = parsed_value
                     else:
                         raise ValueError("Invalid format: Mixed list and list of lists")
+                #elif parsed_value == None:
+                #    settings[key] = None
                 else:
                     raise ValueError("Invalid format for list or list of lists")
             elif expected_type == list:
@@ -764,6 +899,20 @@ def check_settings(vars_dict, expected_types, q=None):
                 settings[key] = float(value) if '.' in value else int(value)
             elif expected_type == (str, type(None)):
                 settings[key] = str(value) if value else None
+            elif expected_type == dict:
+                try:
+                    # Ensure that the value is a string that can be converted to a dictionary
+                    if isinstance(value, str):
+                        settings[key] = ast.literal_eval(value)
+                    else:
+                        raise ValueError("Expected a string representation of a dictionary.")
+                    
+                    # Check if the result is actually a dictionary
+                    if not isinstance(settings[key], dict):
+                        raise ValueError("Value is not a valid dictionary.")
+                except (ValueError, SyntaxError) as e:
+                    settings[key] = {}
+                    q.put(f"Error: Invalid format for {key}. Expected type: dict. Error: {e}")
             elif isinstance(expected_type, tuple):
                 for typ in expected_type:
                     try:
@@ -814,7 +963,7 @@ def generate_fields(variables, scrollable_frame):
         "cell_Signal_to_noise": "(float) - The signal-to-noise ratio for the cell channel. This will be used to determine the range of intensities to normalize images to for cell segmentation.",
         "cell_size_range": "(list) - Size range for cell segmentation.",
         "cell_types": "(list) - Types of cells to include in the analysis.",
-        "cells": "(list) - The cell types to include in the analysis.",
+        "cells": "(list of lists) - The cell types to include in the analysis.",
         "cells_per_well": "(int) - Number of cells per well.",
         "channel_dims": "(list) - The dimensions of the image channels.",
         "channel_of_interest": "(int) - The channel of interest to use for the analysis.",
@@ -864,8 +1013,8 @@ def generate_fields(variables, scrollable_frame):
         "image_nr": "(int) - Number of images to process.",
         "image_size": "(int) - Size of the images for training.",
         "img_zoom": "(float) - Zoom factor for the images in plots.",
-        "include_multinucleated": "(bool) - Whether to include multinucleated cells in the analysis.",
-        "include_multiinfected": "(bool) - Whether to include multi-infected cells in the analysis.",
+        "include_multinucleated": "(int) - Whether to include multinucleated cells in the analysis.",
+        "include_multiinfected": "(int) - Whether to include multi-infected cells in the analysis.",
         "include_noninfected": "(bool) - Whether to include non-infected cells in the analysis.",
         "include_uninfected": "(bool) - Whether to include uninfected cells in the analysis.",
         "init_weights": "(bool) - Whether to initialize weights for the model.",
@@ -883,7 +1032,7 @@ def generate_fields(variables, scrollable_frame):
         "metadata_type": "(str) - Type of metadata to expect in the images. This will determine how the images are processed. If 'custom' is selected, you can provide a custom regex pattern to extract metadata from the image names.",
         "metadata_types": "(list) - Types of metadata to include in the analysis.",
         "merge_edge_pathogen_cells": "(bool) - Whether to merge cells that share pathogen objects.",
-        "merge_pathogens": "(bool) - Whether to merge pathogen objects that share more than 75% of their perimeter.",
+        "merge_pathogens": "(bool) - Whether to merge pathogen objects that share more than 75 percent of their perimeter.",
         "metric": "(str) - Metric to use for UMAP.",
         "min_cell_count": "(int) - Minimum number of cells required for analysis.",
         "min_dist": "(float) - Minimum distance for UMAP.",
@@ -892,6 +1041,7 @@ def generate_fields(variables, scrollable_frame):
         "mix": "(dict) - Mixing settings for the samples.",
         "model_name": "(str) - Name of the Cellpose model.",
         "model_type": "(str) - Type of model to use for the analysis.",
+        "model_type_ml": "(str) - Type of model to use for machine learning.",
         "nc": "(str) - Negative control identifier.",
         "nc_loc": "(str) - Location of the negative control in the images.",
         "negative_control": "(str) - Identifier for the negative control.",
@@ -922,12 +1072,7 @@ def generate_fields(variables, scrollable_frame):
         "pathogen_background": "(float) - The background intensity for the pathogen channel. This will be used to remove background noise.",
         "pathogen_chann_dim": "(int) - Dimension of the channel to use for pathogen segmentation.",
         "pathogen_channel": "(int) - The channel to use for the pathogen. If None, the pathogen will not be segmented.",
-        "pathogen_intensity_range": "(list) - Intensity range for pathogen segmentation.",
-        "pathogen_loc": "(list) - The locations of the pathogen types in the images.",
-        "pathogen_mask_dim": "(int) - The dimension of the array the pathogen mask is saved in.",
-        "pathogen_min_size": "(int) - The minimum size of pathogen objects in pixels^2.",
-        "pathogen_model": "(str) - Model to use for pathogen segmentation.",
-        "pathogen_plate_metadata": "(str) - Metadata for the pathogen plate.",
+        "pathogen_intensity_range": "(str) - Metadata for the pathogen plate.",
         "pathogen_Signal_to_noise": "(float) - The signal-to-noise ratio for the pathogen channel. This will be used to determine the range of intensities to normalize images to for pathogen segmentation.",
         "pathogen_size_range": "(list) - Size range for pathogen segmentation.",
         "pathogen_types": "(list) - Types of pathogens to include in the analysis.",
@@ -993,7 +1138,6 @@ def generate_fields(variables, scrollable_frame):
         "treatments": "(list) - The treatments to include in the analysis.",
         "top_features": "(int) - Top features to include in the analysis.",
         "train": "(bool) - Whether to train the model.",
-        "train_mode": "(str) - Mode to use for training the model.",
         "transform": "(dict) - Transformation to apply to the data.",
         "upscale": "(bool) - Whether to upscale the images.",
         "upscale_factor": "(float) - Factor by which to upscale the images.",
@@ -1003,6 +1147,20 @@ def generate_fields(variables, scrollable_frame):
         "verbose": "(bool) - Whether to print verbose output during processing.",
         "weight_decay": "(float) - Weight decay for regularization.",
         "width_height": "(tuple) - Width and height of the input images.",
+        "barcode_coordinates": "(list of lists) - Coordinates of the barcodes in the sequence.",
+        "barcode_mapping": "dict - names and barecode csv files",
+        "compression": "str - type of compression (e.g. zlib)",
+        "complevel": "int - level of compression (0-9). Higher is slower and yealds smaller files",
+        "file_type": "str - type of file to process",
+        "model_path": "str - path to the model",
+        "tar_path": "str - path to the tar file with image dataset",
+        "score_threshold": "float - threshold for classification",
+        "sample": "str - number of images to sample for tar dataset (including both classes). Default: None",
+        "file_metadata": "str - string that must be present in image path to be included in the dataset",
+        "apply_model_to_dataset": "bool - whether to apply model to the dataset",
+        "train_channels": "list - channels to use for training",
+        "dataset_mode": "str - How to generate train/test dataset.",
+        "annotated_classes": "list - list of numbers in annotation column.",
         "um_per_pixel": "(float) - The micrometers per pixel for the images."
     }
 
@@ -1018,29 +1176,6 @@ def generate_fields(variables, scrollable_frame):
         
     return vars_dict
 
-
-categories = {
-    "General": ["src", "metadata_type", "custom_regex", "experiment", "channels", "magnification", "channel_dims"],
-    "Paths":["grna", "barcodes"],
-    "Regression":["class_1_threshold", "plate", "other", "fraction_threshold", "alpha", "remove_row_column_effect", "regression_type", "min_cell_count", "agg_type", "transform", "dependent_variable", "gene_weights_csv"],
-    "Cellpose":["from_scratch", "n_epochs", "width_height", "model_name", "custom_model", "resample", "rescale", "CP_prob", "flow_threshold", "percentiles", "circular", "invert", "diameter", "grayscale", "background", "Signal_to_noise", "resize", "target_height", "target_width"],
-    "Nucleus": ["nucleus_intensity_range", "nucleus_size_range", "nucleus_chann_dim", "nucleus_channel", "nucleus_background", "nucleus_Signal_to_noise", "nucleus_CP_prob", "nucleus_FT", "remove_background_nucleus", "nucleus_min_size", "nucleus_mask_dim", "nucleus_loc"],
-    "Cell": ["cell_intensity_range", "cell_size_range", "cell_chann_dim", "cell_channel", "cell_background", "cell_Signal_to_noise", "cell_CP_prob", "cell_FT", "remove_background_cell", "cell_min_size", "cell_mask_dim", "cytoplasm", "cytoplasm_min_size", "include_uninfected", "merge_edge_pathogen_cells", "adjust_cells"],
-    "Pathogen": ["pathogen_intensity_range", "pathogen_size_range", "pathogen_chann_dim", "pathogen_channel", "pathogen_background", "pathogen_Signal_to_noise", "pathogen_CP_prob", "pathogen_FT", "pathogen_model", "remove_background_pathogen", "pathogen_min_size", "pathogen_mask_dim"],
-    "Timelapse": ["fps", "timelapse_displacement", "timelapse_memory", "timelapse_frame_limits", "timelapse_remove_transient", "timelapse_mode", "timelapse_objects", "compartments"],
-    "Plot": ["plot_control", "plot_nr", "examples_to_plot", "normalize_plots", "normalize", "cmap", "figuresize", "plot_cluster_grids", "img_zoom", "row_limit", "color_by", "plot_images", "smooth_lines", "plot_points", "plot_outlines", "black_background", "plot_by_cluster", "heatmap_feature","grouping","min_max","cmap","save_figure"],
-    "Object Image": ["save_png", "dialate_pngs", "dialate_png_ratios", "png_size", "png_dims", "save_arrays", "normalize_by", "dialate_png_ratios", "crop_mode", "dialate_pngs", "normalize", "use_bounding_box"],
-    "Annotate Data": ["nc_loc", "pc_loc", "nc", "pc", "cell_plate_metadata","pathogen_types", "pathogen_plate_metadata", "treatment_plate_metadata", "metadata_types", "cell_types", "target","positive_control","negative_control", "location_column", "treatment_loc", "cells", "cell_loc", "pathogens", "pathogen_loc", "channel_of_interest", "measurement", "treatments", "um_per_pixel", "nr_imgs", "exclude", "exclude_conditions", "mix", "pos", "neg"],
-    "Measurements": ["remove_image_canvas", "remove_highly_correlated", "homogeneity", "homogeneity_distances", "radial_dist", "calculate_correlation", "manders_thresholds", "save_measurements", "tables", "image_nr", "dot_size", "filter_by", "remove_highly_correlated_features", "remove_low_variance_features", "channel_of_interest"],
-    "Advanced": ["plate_dict", "target_intensity_min", "cells_per_well", "include_multinucleated", "include_multiinfected", "include_noninfected", "backgrounds", "plot", "timelapse", "schedule", "test_size","exclude","n_repeats","top_features", "model_type","minimum_cell_count","n_estimators","preprocess", "remove_background", "normalize", "lower_percentile", "merge_pathogens", "batch_size", "filter", "save", "masks", "verbose", "randomize", "n_jobs", "train_mode","amsgrad","use_checkpoint","gradient_accumulation","gradient_accumulation_steps","intermedeate_save","pin_memory","n_jobs","channels","augment"],
-    "Clustering": ["eps","min_samples","analyze_clusters","clustering","remove_cluster_noise"],
-    "Embedding": ["visualize","n_neighbors","min_dist","metric","resnet_features","reduction_method","embedding_by_controls","col_to_compare","log_data"],
-    "Train DL Model": ["epochs", "loss_type", "optimizer_type","image_size","val_split","learning_rate","weight_decay","dropout_rate", "init_weights", "train", "classes"],
-    "Miscellaneous": ["all_to_mip", "pick_slice", "skip_mode", "upscale", "upscale_factor"],
-    "Test": ["test_mode", "test_images", "random_test", "test_nr", "test"],
-    "Sequencing": ["upstream", "downstream", "barecode_length_1", "barecode_length_2", "chunk_size"]
-}
-
 descriptions = {
     'mask': "\n\nHelp:\n- Generate Cells, Nuclei, Pathogens, and Cytoplasm masks from intensity images in src.\n- To ensure that spacr is installed correctly:\n- 1. Downloade the training set (click Download).\n- 2. Import settings (click settings navigate to downloaded dataset settings folder and import preprocess_generate_masks_settings.csv).\n- 3. Run the module.\n- 4. Proceed to the Measure module (click Measure in the menue bar).\n- For further help, click the Help button in the menue bar.",
     
@@ -1048,8 +1183,6 @@ descriptions = {
     
     'classify': "Train and Test any Torch Computer vision model. (Requires PNG images from the Measure module). Function: train_test_model from spacr.deep_spacr.\n\nKey Features:\n- Deep Learning Integration: Train and evaluate state-of-the-art Torch models for various classification tasks.\n- Flexible Training: Supports a wide range of Torch models, allowing customization based on specific research needs.\n- Data Requirement: Requires PNG images generated by the Measure module for training and testing.",
     
-    'sequencing': "Find Barcodes and gRNA sequences in FASTQ files. (Requires paired-end FASTQ files, R1 and R2). Function: analyze_reads from spacr.sequencing.\n\nKey Features:\n- Barcode and gRNA Identification: Efficiently detect and extract barcode and gRNA sequences from raw sequencing data.\n- Paired-End Support: Specifically designed to handle paired-end FASTQ files, ensuring accurate sequence alignment and analysis.\n- High Throughput: Capable of processing large sequencing datasets quickly and accurately.",
-    
     'umap': "Generate UMAP or tSNE embeddings and represent points as single cell images. (Requires measurements.db and PNG images from the Measure module). Function: generate_image_umap from spacr.core.\n\nKey Features:\n- Dimensionality Reduction: Employ UMAP or tSNE algorithms to reduce high-dimensional data into two dimensions for visualization.\n- Single Cell Representation: Visualize embedding points as single cell images, providing an intuitive understanding of data clusters.\n- Data Integration: Requires measurements and images generated by the Measure module, ensuring comprehensive data representation.",
     
     'train_cellpose': "Train custom Cellpose models for your specific dataset. Function: train_cellpose_model from spacr.core.\n\nKey Features:\n- Custom Model Training: Train Cellpose models on your dataset to improve segmentation accuracy.\n- Data Adaptation: Tailor the model to handle specific types of biological samples more effectively.\n- Advanced Training Options: Supports various training parameters and configurations for optimized performance.",
@@ -1060,8 +1193,8 @@ descriptions = {
     
     'cellpose_all': "Run Cellpose on all images in your dataset and obtain masks and measurements. Function: cellpose_analysis from spacr.cellpose.\n\nKey Features:\n- End-to-End Analysis: Perform both segmentation and measurement extraction in a single step.\n- Efficiency: Process entire datasets with minimal manual intervention.\n- Comprehensive Output: Obtain detailed masks and corresponding measurements for further analysis.",
     
-    'map_barcodes': "Map barcodes to your data for identification and tracking. Function: barcode_mapping_tools from spacr.sequencing.\n\nKey Features:\n- Barcode Integration: Efficiently map and integrate barcode information into your dataset.\n- Tracking: Enable tracking and identification of samples using barcodes.\n- Compatibility: Works with sequencing data to ensure accurate mapping and analysis.",
-    
+    'map_barcodes': "\n\nHelp:\n- 1 .Generate consensus read fastq files from R1 and R2 files.\n- 2. Map barcodes from sequencing data for identification and tracking of samples.\n- 3. Run the module to extract and map barcodes from your FASTQ files in chunks.\n- Prepare your barcode CSV files with the appropriate 'name' and 'sequence' columns.\n- Configure the barcode settings (coordinates and reverse complement flags) according to your experimental setup.\n- For further help, click the Help button in the menu bar.",
+
     'regression': "Perform regression analysis on your data. Function: regression_tools from spacr.analysis.\n\nKey Features:\n- Statistical Analysis: Conduct various types of regression analysis to identify relationships within your data.\n- Flexible Options: Supports multiple regression models and configurations.\n- Data Insight: Gain deeper insights into your dataset through advanced regression techniques.",
     
     'recruitment': "Analyze recruitment data to understand sample recruitment dynamics. Function: recruitment_analysis_tools from spacr.analysis.\n\nKey Features:\n- Recruitment Analysis: Investigate and analyze the recruitment of samples over time or conditions.\n- Visualization: Generate visualizations to represent recruitment trends and patterns.\n- Integration: Utilize data from various sources for a comprehensive recruitment analysis."
@@ -1070,7 +1203,7 @@ descriptions = {
 def set_annotate_default_settings(settings):
     settings.setdefault('src', 'path')
     settings.setdefault('image_type', 'cell_png')
-    settings.setdefault('channels', 'r,g,b')
+    settings.setdefault('channels', "r,g,b")
     settings.setdefault('img_size', 200)
     settings.setdefault('annotation_column', 'test')
     settings.setdefault('normalize', 'False')
@@ -1079,3 +1212,15 @@ def set_annotate_default_settings(settings):
     settings.setdefault('threshold', '2')
     return settings
 
+def set_default_generate_barecode_mapping(settings={}):
+    settings.setdefault('src', 'path')
+    settings.setdefault('chunk_size', 100000)
+    
+    settings.setdefault('barcode_mapping', {'row': ['/home/carruthers/Documents/row_barcodes.csv',(80, 88), True],
+                                            'grna': ['/home/carruthers/Documents/grna_barcodes.csv',(34, 55), True],
+                                            'column': ['/home/carruthers/Documents/column_barcodes.csv',(0, 7), False]})
+    
+    settings.setdefault('n_jobs', None)
+    settings.setdefault('compression', 'zlib')
+    settings.setdefault('complevel', 5)
+    return settings